CN111394288A - Recombinant corynebacterium glutamicum, construction method thereof and method for producing tetrahydropyrimidine by using recombinant corynebacterium glutamicum - Google Patents

Abstract

The invention relates to a recombinant corynebacterium glutamicum, a method for constructing the recombinant corynebacterium glutamicum and a method for producing tetrahydropyrimidine by using the recombinant corynebacterium glutamicum. Compared with the wild corynebacterium glutamicum, the recombinant corynebacterium glutamicum has reduced expression levels of phosphoenolpyruvate carboxylase, homoserine dehydrogenase and dihydropyrimidine dicarboxylate synthase, and also has a gene expression cassette for expressing phosphoenolpyruvate carboxylase and a gene expression cassette for expressing ectA enzyme, ectB enzyme and ectC enzyme, so that tetrahydropyrimidine can be efficiently produced. The method for producing tetrahydropyrimidine by using the recombinant corynebacterium glutamicum has the advantages of high yield, improved safety of tetrahydropyrimidine products, greatly reduced production cost and good market application prospect.

Description

Recombinant corynebacterium glutamicum, construction method thereof and method for producing tetrahydropyrimidine by using recombinant corynebacterium glutamicum

Technical Field

The invention belongs to the technical field of genetic engineering and biological fermentation, and particularly relates to a recombinant corynebacterium glutamicum, a method for constructing the recombinant corynebacterium glutamicum and a method for producing tetrahydropyrimidine by using the recombinant strain.

Background

Tetrahydropyrimidine (Ectoine) is a compatible solute generated in cells by many salt-tolerant and halophilic microorganisms to maintain osmotic pressure balance, and can provide protection for cells, proteins, cell membranes, nucleic acids and the like under the stimulation of extreme conditions such as external high temperature, freezing, ray, drying and the like. In addition, the tetrahydropyrimidine has certain curative effect on neurological diseases such as Alzheimer's disease, Parkinson's disease and the like, and recent research finds that the tetrahydropyrimidine can improve the regeneration capability of skin and delay the aging of the skin. Therefore, the tetrahydropyrimidine has wide application prospect in the industries of fine chemical engineering, biological medicine and the like.

At present, the production method of tetrahydropyrimidine is mainly obtained by high-density fermentation of halophilic microorganisms, particularly halomonas. The process adopts a mode called 'bacteria milking method' to produce, namely culturing bacteria under high osmotic pressure, then hypotonic impacting to release solute, then carrying out hypertonic culture on thalli again, hypotonic impacting to release solute, and circulating for 8-9 times in sequence to obtain the product. The method has higher requirements on the stability of reactor materials, the difficulty of a downstream purification process is increased due to the discontinuous production flow and the high-concentration salt, in addition, the high-concentration salt is easy to corrode equipment, the growth of thalli is influenced, the yield of the tetrahydropyrimidine is influenced, the production cost is increased, and the large-scale application of the tetrahydropyrimidine is influenced.

The existing strain and method for producing tetrahydropyrimidine seriously restrict the industrial production and large-scale application of tetrahydropyrimidine, so that a novel tetrahydropyrimidine high-yield strain is developed, the production process is simplified, the synthesis efficiency is improved, the production cost is reduced, and the method has important practical significance for the application of tetrahydropyrimidine.

Disclosure of Invention

The existing tetrahydropyrimidine production process is complex, low in synthesis efficiency and high in production cost, and the industrial production and large-scale application of tetrahydropyrimidine are severely restricted.

The invention aims to provide a method for producing tetrahydropyrimidine by using recombinant corynebacterium glutamicum, which has high biological safety, high yield of tetrahydropyrimidine, simple and convenient fermentation operation and low production cost, and overcomes the defects of the prior art.

Accordingly, in a first aspect, the present invention provides a recombinant corynebacterium glutamicum starting from a wild-type corynebacterium glutamicum strain, which has:

a phosphoenolpyruvate carboxylase, a homoserine dehydrogenase and a dihydropyrimidinedicarboxylic acid synthetase that are expressed at reduced levels compared to the starting strain;

a gene expression cassette for expressing phosphoenolpyruvate carboxylase; and

a gene expression cassette for expressing the enzyme ectoA, the enzyme ectoB and the enzyme ectoC.

In a second aspect, the present invention provides a method for constructing the recombinant corynebacterium glutamicum of the first aspect, comprising: the recombinant corynebacterium glutamicum is obtained by taking a wild corynebacterium glutamicum as an initial strain, reducing the expression levels of phosphoenolpyruvate carboxylase, homoserine dehydrogenase and dihydropyrimidinedicarboxylic acid synthase in the wild corynebacterium glutamicum, and introducing a gene expression cassette for expressing the phosphoenolpyruvate carboxylase and a gene expression cassette for expressing ectA enzyme, ectB enzyme and ectC enzyme into the initial strain.

In a third aspect, the present invention provides the use of the recombinant corynebacterium glutamicum of the first aspect or the recombinant corynebacterium glutamicum constructed by the method of the second aspect, for producing tetrahydropyrimidine.

In a fourth aspect, the present invention also provides a process for producing tetrahydropyrimidine, the process comprising: fermenting the recombinant corynebacterium glutamicum of the first aspect or the recombinant corynebacterium glutamicum constructed by the method of the second aspect, thereby obtaining tetrahydropyrimidine.

The method has the advantages that the yield of the tetrahydropyrimidine can reach 25 g/L by utilizing the recombinant corynebacterium glutamicum, compared with other strains capable of producing the tetrahydropyrimidine (such as strains disclosed in CN107142234A) reported in the prior art, the yield of the tetrahydropyrimidine can be obviously improved, the corynebacterium glutamicum is a food-safety-level microorganism and is widely applied to production of amino acids (such as glutamic acid and lysine), and endotoxin cannot be secreted.

Drawings

FIG. 1 is a schematic diagram showing a tetrahydropyrimidine biosynthesis pathway in recombinant Corynebacterium glutamicum according to the present invention.

FIG. 2 shows the production of tetrahydropyrimidine according to time for the recombinant Corynebacterium glutamicum CG. ECT-2 of example 1 of the present invention.

Detailed Description

The following describes exemplary embodiments of the present invention, and it should be understood by those skilled in the art that the following embodiments do not limit specific embodiments of the present invention, and should be interpreted to include all modifications, equivalents, and alternatives falling within the spirit and scope of the present invention. Many modifications and other embodiments are within the ability of one of ordinary skill in the art and are contemplated as falling within the scope of the invention.

Unless otherwise indicated, the experimental procedures used hereinafter are conventional and well known to those skilled in the art and may be carried out, for example, using standard procedures described in Sambrook et al, Molecular Cloning: A L laboratory Manual (3 rd edition), Cold Spring Harbor L laboratory Press, Cold Spring Harbor, N.Y., USA (2001), Davis et al, Basic Methods in Molecular Biology, Elsevierscience Publishing, Inc., New York, USA (1995), and Current Protocols in cell Biology (CPCB) (Juan S.Bonifaci et al, John Wiley and Sons, Inc.).

The term "Corynebacterium glutamicum (Corynebacterium glutamicum)" or "wild-type Corynebacterium glutamicum" as used herein means Corynebacterium glutamicum in which the expression levels of phosphoenolpyruvate carboxylase, homoserine dehydrogenase and dihydropyrimidine dicarboxylate synthase are reduced, while a gene expression cassette for expressing phosphoenolpyruvate carboxylase and a gene expression cassette for expressing ectoA, ectoB and ectoC enzymes are introduced, without being subjected to the method for constructing a recombinant Corynebacterium glutamicum producing tetrahydropyrimidine according to the second aspect of the present invention or other methods known in the art, unless otherwise specified. Accordingly, the term "recombinant Corynebacterium glutamicum" as used herein is a Corynebacterium glutamicum in which the expression levels of phosphoenolpyruvate carboxylase, homoserine dehydrogenase and dihydropyrimidinedicarboxylate synthase are reduced relative to the wild-type Corynebacterium glutamicum, and which has both a recombinant expression cassette for the expression of phosphoenolpyruvate carboxylase and a gene expression cassette for the expression of the enzymes ectoA, ectB and ectC.

The term "intermediate recombinant bacterium" as used herein refers to a recombinant bacterium in which the expression level of a partial enzyme obtained in the process of constructing recombinant Corynebacterium glutamicum of the present invention is reduced and/or a partial gene expression cassette is introduced. In certain embodiments, the "intermediate recombinant bacterium" also falls within the scope of "wild-type corynebacterium glutamicum".

The term "target gene" as used herein refers to a gene encoding phosphoenolpyruvate carboxylase, homoserine dehydrogenase, dihydropyrimidinedicarboxylic acid synthase, phosphoenolpyruvate carboxylase, and ectA, ectB and ectC enzymes according to the present invention. The term "target gene" as used herein refers to a gene designed according to methods known in the art for the purpose of introducing, expressing, and/or reducing the level of a target gene (e.g., knocking out).

The term "decrease" or "reduction" as used herein generally means a decrease in a statistically significant amount. However, for the avoidance of doubt, the term "decrease" or "reduction" means a decrease of at least 10% compared to a reference level (e.g. a level of expression in wild-type corynebacterium glutamicum), for example a decrease of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including a decrease of 100% (e.g. a deletion level or a non-detectable level compared to the reference level), or any amount between 10% and 100% compared to the reference level.

The term "reduced expression level of a gene/enzyme" as used herein means that the expression level of the gene/enzyme in recombinant corynebacterium glutamicum is reduced by at least 10%, e.g., by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100% (i.e., no gene expression or no detectable level of gene expression) compared to wild-type corynebacterium glutamicum. In the case where the expression level of a gene in recombinant Corynebacterium glutamicum is reduced by at least about 90% compared to the expression level of a gene in wild-type Corynebacterium glutamicum, this may also be referred to herein as "gene inactivation". In this context, a gene can be inactivated by "knock-out", and even the expression level of the gene of the target gene can be reduced to 100%, and thus the expression level of the protein encoded by the gene can be reduced to an undetectable level.

As shown in FIG. 1, through extensive analysis and experiments, the inventors found that in Corynebacterium glutamicum, the expression level of phosphoenolpyruvate carboxylase is reduced, and phosphoenolpyruvate carboxylase is expressed at the same time, so that the carbon flow to oxaloacetate is enhanced, more precursor substances can be provided for tetrahydropyrimidine synthesis, the expression level of homoserine dehydrogenase is reduced, so that the carbon flow to L-threonine is blocked, the expression level of dihydropyrimidinedicarboxylate synthase is reduced, so that the carbon flow to L-lysine is blocked, and the ectA enzyme, the ectB enzyme and the ectC enzyme of the tetrahydropyrimidine synthesis pathway are overexpressed, so that a recombinant Corynebacterium glutamicum highly expressing tetrahydropyrimidine can be obtained.

In the present invention, the gene encoding phosphoenolpyruvate carboxylase in Corynebacterium glutamicum is phosphoenolpyruvate carboxylase gene pck (NCBI NO: CP025533.1), the polynucleotide sequence of which can be represented by SEQ ID NO: 1; the gene coding homoserine dehydrogenase in Corynebacterium glutamicum is homoserine dehydrogenase gene hom (NCBI No.: CP025533.1), and the polynucleotide sequence thereof can be shown as SEQ ID No.: 3; and the gene coding the dihydropyrimidine dicarboxylic acid synthetase in the corynebacterium glutamicum is a dihydropyrimidine dicarboxylic acid synthetase gene dapA (NCBI NO.: CP025533.1), and the polynucleotide sequence of the gene can be shown as SEQ ID NO. 4.

According to a first aspect of the present invention, there is provided a recombinant corynebacterium glutamicum starting from a wild-type corynebacterium glutamicum strain, which has:

a phosphoenolpyruvate carboxylase, a homoserine dehydrogenase and a dihydropyrimidinedicarboxylic acid synthetase that are expressed at reduced levels compared to the starting strain;

a gene expression cassette for expressing phosphoenolpyruvate carboxylase; and

a gene expression cassette for expressing the enzyme ectoA, the enzyme ectoB and the enzyme ectoC.

In some embodiments of the recombinant corynebacterium glutamicum of the present invention, the expression levels of phosphoenolpyruvate carboxylase, homoserine dehydrogenase, and dihydropyrimidinedicarboxylate synthase are reduced by knocking out the phosphoenolpyruvate carboxylase gene pck (also referred to as "pck gene"), homoserine dehydrogenase gene hom (also referred to as "hom gene"), and dihydropyrimidinedicarboxylate synthase genes (also referred to as "dapA gene") in the starting strain.

In some embodiments of the recombinant Corynebacterium glutamicum of the present invention, the gene expression cassette for expressing phosphoenolpyruvate carboxylase has the phosphoenolpyruvate carboxylase gene ppc (also referred to as "ppc gene", derived from the Corynebacterium glutamicum strain ATCC13032(NCBI No.: P025533.1)) represented by SEQ ID No.: 2. In a preferred embodiment, the pck gene can be replaced by the ppc gene to obtain said expression cassette for expressing phosphoenolpyruvate carboxylase while simultaneously reducing the expression level of phosphoenolpyruvate carboxylase.

In some embodiments of the recombinant Corynebacterium glutamicum of the present invention, the gene expression cassette for expressing the ectA, ectB and ectC enzymes has a promoter tac, a gene encoding the ectA, ectB and ectC enzymes, and a terminator rrnB. In a preferred embodiment of the recombinant Corynebacterium glutamicum strain of the present invention, the gene encoding ectoA, ectoB and ectoC is ectoC (ectoC) which is a gene involved in the tetrahydropyrimidine synthesis pathway. The ectABC gene is a gene cluster containing genes encoding the three enzymes ectoA, ectoB and ectoC in the biosynthetic pathway of tetrahydropyrimidine, and is present in the genome of halophiles producing tetrahydropyrimidine, such as Halomonas elongata. In the present invention, it is preferred to use the ectABC gene (NCBI NO: D88359.1) from Halomonas elongata, for example, a codon-optimized sequence shown in SEQ ID NO: 5, which in combination with the promoter tac and the terminator rrnB constitutes a gene expression cassette for overexpression of the ectA, ectB and ectC enzymes in Corynebacterium glutamicum.

According to a second aspect of the present invention, there is provided a method for constructing the recombinant Corynebacterium glutamicum of the first aspect, which produces tetrahydropyrimidine, the method comprising: the recombinant corynebacterium glutamicum is obtained by taking a wild corynebacterium glutamicum as an initial strain, reducing the expression levels of phosphoenolpyruvate carboxylase, homoserine dehydrogenase and dihydropyrimidinedicarboxylic acid synthetase in the initial strain, and introducing a gene expression cassette for expressing phosphoenolpyruvate carboxylase and a gene expression cassette for expressing ectoA, ectB and ectC enzymes into the initial strain.

Wherein, any method known to those skilled in the art may be used to decrease the expression level of a target gene (e.g., pck gene, hom gene, and dapA gene), including inactivation of the target gene, and thereby decrease the expression level of phosphoenolpyruvate carboxylase, homoserine dehydrogenase, and dihydropyrimidinedicarboxylate synthetase, such as by at least about 80%, or by at least about 90%, or by 100%.

In some embodiments of the construction methods of the present invention, the expression levels of phosphoenolpyruvate carboxylase, homoserine dehydrogenase, and dihydropyrimidinedicarboxylic acid synthase can be decreased by a knock-out method: for example, the ribosome binding site sequence (RBS), promoter sequence or open reading frame sequence of the pck gene, hom gene and dapA gene are knocked out partially or fully, resulting in a decrease in the expression level of the target gene and, in turn, the expression level of the various enzymes encoded thereby.

In a preferred embodiment of the construction method of the present invention, a partial or full-length sequence of the open reading frame sequence of a target gene (e.g., pck gene, hom gene and dapA gene) may be deleted, resulting in a decrease in the expression level of the target gene, and thus a decrease in the expression level of phosphoenolpyruvate carboxylase, homoserine dehydrogenase and/or dihydropyrimidinedicarboxylate synthetase.

Wherein, any method known to those skilled in the art can be used to introduce into the starting strain a gene expression cassette for expressing phosphoenolpyruvate carboxylase and a gene expression cassette for expressing ectoA, ectoB and ectoC enzymes.

In the method of the present invention, any method known in the art may be used to introduce a target gene (e.g., ppc gene) into the genome of Corynebacterium glutamicum, such as, but not limited to, homologous recombination, Crispr/Cas 9 system, Cre/L ox P system in a preferred embodiment, the target gene to be knocked out (e.g., pck gene) may be replaced with the target gene to be knocked out (e.g., ppc gene) to knock out the target gene to be knocked out while introducing the target gene to be introduced, which together with the upstream promoter and downstream terminator of the target gene to be knocked out constitutes a gene expression cassette for the target gene to be introduced, thereby expressing a protein encoded by the target gene.

In the construction method of the invention, the gene expression cassette for expressing the ectA enzyme, the ectB enzyme and the ectC enzyme has a gene cluster for expressing the ectA enzyme, the ectB enzyme and the ectC enzyme, namely a gene related to ectoine synthesis pathway, namely ectABC. In a preferred embodiment, the ectABC gene is ligated to a Corynebacterium glutamicum expression vector to obtain a recombinant expression vector, and then the vector is introduced into Corynebacterium glutamicum or an intermediate recombinant bacterium to obtain an intermediate recombinant bacterium overexpressing a target gene or the recombinant Corynebacterium glutamicum producing tetrahydropyrimidine of the present invention. In one embodiment, the gene expression cassette for expressing the ectA, ectB and ectC enzymes has a promoter tac, a gene encoding the ectA, ectB and ectC enzymes and a terminator rrnB.

In embodiments of the invention involving homologous recombination (e.g., knockout and/or introduction of a target gene by homologous recombination), the homologous sequence segment used in the homologous knockout and/or introduction can be derived from: artificially synthesized based on the sequence of the ectABC gene from a target gene derived from Corynebacterium glutamicum (e.g., ppc gene, pck gene, hom gene, and/or dapA gene) or from a strain producing tetrahydropyrimidine (e.g., Halomonas elongata) as published on a database known in the art (e.g., NCBI database); or amplifying the target gene from the genome of Corynebacterium glutamicum or Halomonas elongata by using a PCR method, thereby obtaining an initial homologous sequence fragment of the target gene. Here, the partial or entire initial homologous sequence of the target gene refers to a sequence containing the above-mentioned target gene (ppc gene, ectABC gene, pck gene, hom gene and/or dapA gene).

Specific procedures for homologous recombination are well known to those skilled in the art, and for example, homologous recombination can be performed with reference to "Corynebacterium Glutamicum: Biology and Biotechnology" (Yukawa et al, Springer Press, pp 51-106, 2012), which is not described herein in any further detail and is incorporated herein by reference in its entirety.

It will be appreciated by those skilled in the art that the same or different treatments (e.g., homologous recombination, Crispr/Cas 9 system, Cre/L ox P system, site-directed mutagenesis, or RNAi) can be independently applied to different target genes (e.g., pck gene, hom gene, and/or dapA gene) to achieve the goal of reducing the expression level of each target gene and thus the expression level of the protein encoded by each target gene.

It will also be understood by those skilled in the art that, in the construction method of the present invention, a target gene (e.g., hom gene and dapA gene) may be knocked out separately, or a target gene (e.g., ppc gene) may be introduced separately; a target gene (e.g., pck gene) may also be knocked out at the same time as the target gene (e.g., ppc gene) is introduced; alternatively, multiple target genes may be simultaneously knocked out (for example, the hom gene and dapA gene are simultaneously knocked out), or multiple target genes may be simultaneously introduced (for example, the ppc gene and the ectABC gene).

In the construction method of the present invention, the method of transforming (introducing) the constructed recombinant plasmid or polynucleotide fragment into corynebacterium glutamicum (including wild-type corynebacterium glutamicum and intermediate recombinant bacteria) may be a transformation method that is conventional in the art. For example, the transformation method may comprise the steps of: competent cells of Corynebacterium glutamicum are prepared and then transformed with the recombinant plasmid, for example, which may be selected from the group consisting of electroporation and chemical transformation. The competent cells can be prepared artificially or obtained commercially.

In the construction method of the present invention, the method further comprises the steps of screening and identifying the recombinant bacteria, for example, colony PCR analysis of the recombinant bacteria, and sequencing to determine whether the target gene is knocked out or introduced.

In the method of preparing recombinant corynebacterium glutamicum of the present invention, wild-type corynebacterium glutamicum includes, but is not limited to: corynebacterium glutamicum wild strain ATCC13032 or Corynebacterium glutamicum wild strain S9114. In some embodiments, when the wild type Corynebacterium glutamicum employed contains the ppc gene itself, for example, the starting strain, strain ATCC13032, can omit the introduction of a gene expression cassette for expressing phosphoenolpyruvate carboxylase into the starting strain. In some embodiments, when the wild type Corynebacterium glutamicum itself is employed with a low level of expression of phosphoenolpyruvate carboxylase, homoserine dehydrogenase and/or dihydropyrimidinedicarboxylic acid synthetase, the step of reducing the expression level of the corresponding enzyme may be omitted.

In some embodiments of the construction method of the present invention, the knockout and/or introduction of the target gene (e.g., ppc gene, pck gene, hom gene, and dapA gene) may be performed by an integration vector. In the present invention, the integration vector refers to a vector for integrating a target gene into the chromosomal genome of a target strain, for example, an integration plasmid such as suicide plasmid pK18 mobsacB.

In some embodiments of the construction methods of the present invention, overexpression of a target gene (ectABC gene) can be performed using an expression vector that can be used in corynebacterium glutamicum. In the present invention, the expression vector refers to a vector for expressing a target gene in a target strain, for example, a corynebacterium glutamicum overexpression plasmid pXMJ 19.

In some embodiments of the construction method of the present invention, the tetrahydropyrimidine-producing recombinant corynebacterium glutamicum strain of the present invention may be constructed by:

1) connecting a polynucleotide sequence for replacing pck gene with ppc gene to a corynebacterium glutamicum suicide plasmid to obtain a recombinant plasmid, and introducing the recombinant plasmid into the corynebacterium glutamicum to obtain a recombinant bacterium C.glutamcum-delta pck-ppc;

2) connecting a polynucleotide sequence for knocking out the hom gene to a corynebacterium glutamicum suicide plasmid to obtain a recombinant plasmid, and introducing the recombinant plasmid into the recombinant bacterium C.glutamicum-delta pck-ppc obtained in the step 1) to obtain a recombinant bacterium C.glutamicum-delta hom-delta pck-ppc;

3) connecting a polynucleotide sequence for knocking out the dapA gene to a corynebacterium glutamicum suicide plasmid to obtain a recombinant plasmid, and introducing the recombinant plasmid into the recombinant bacterium C.glutamicum-delta hom-delta pck-ppc obtained in the step 2) to obtain the recombinant bacterium C.glutamicum-delta dapA-delta hom-delta pck-ppc; and

4) connecting the optimized polynucleotide sequence for expressing the ectABC gene to an expression plasmid of Corynebacterium glutamicum according to the codon preference of the Corynebacterium glutamicum to obtain a recombinant plasmid, and introducing the recombinant plasmid into the recombinant bacterium C.glutamicum-delta dapA-delta hom-delta pck-ppc obtained in the step 3) to obtain the recombinant Corynebacterium glutamicum C.glutamicum-delta dapA-delta hom-delta pck-ppc-ectABC.

Wherein, in the step 1), the polynucleotide sequence for replacing the pck gene by the ppc gene is shown by SEQ ID NO. 6, wherein the SEQ ID NO. 6 comprises 1001bp upstream of the pck gene, the ppc gene of SEQ ID NO. 2 and 999bp downstream of the pck gene; in step 2), the polynucleotide sequence for knocking out the hom gene is represented by SEQ ID No. 7, wherein SEQ ID No. 7 comprises 1000bp upstream and 1000bp downstream of the hom gene of the genome of corynebacterium glutamicum; in step 3), the polynucleotide sequence for knocking out the dapA gene is represented by SEQ ID No. 8, wherein SEQ ID No. 8 comprises 1000bp upstream and 1000bp downstream of the dapA gene of the genome of Corynebacterium glutamicum; in step 4), the polynucleotide sequence for expressing the ectABC gene is shown by SEQ ID No. 5.

The suicide plasmid in steps 1) -3) is a commercially available suicide plasmid of Corynebacterium glutamicum, i.e.a suicide plasmid suitable for Corynebacterium glutamicum, such as pK18 mobsacB.

The expression plasmid in step 4) is a commercially available Corynebacterium glutamicum expression plasmid, i.e.an expression plasmid suitable for expressing a target gene in Corynebacterium glutamicum, such as pXMJ 19.

Among them, in the steps 1) to 4), methods for ligating the target gene to the suicide vector or the expression vector are known to those skilled in the art, for example, blunt end ligation, sticky end ligation. In a preferred embodiment of the construction method of the present invention, the artificially synthesized polynucleotide sequence of the target gene is double-digested and then ligated to a plasmid using DNA ligase, and the reaction system and the reaction procedure for double-digestion and ligation may be performed according to the instructions provided by the manufacturer.

In a particular embodiment of the invention, in step 1), the polynucleotide sequence represented by SEQ ID No. 6 is ligated to suicide plasmid pK18mobsacB, double digested with SmaI/SalI restriction enzymes and ligated; in step 2), the polynucleotide sequence shown by SEQ ID No. 7 is ligated to the suicide plasmid pK18mobsacB using XbaI/HindIII restriction endonuclease double cleavage and ligation; in step 3), the polynucleotide sequence shown by SEQ ID No. 8 is ligated to the suicide plasmid pK18mobsacB, using SmaI/SalI restriction endonuclease double cleavage and ligation; in step 4), the polynucleotide sequence shown by SEQ ID No. 5 was ligated to expression plasmid pXMJ19 using NdeI/EcoRI restriction endonuclease double cleavage and ligation.

Among them, methods for introducing the recombinant plasmid into Corynebacterium glutamicum or an intermediate recombinant bacterium in steps 1) to 4) are known to those skilled in the art, for example, transformation methods conventional in the art, such as electroporation or chemical transformation. In a preferred embodiment of the construction method of the present invention, in steps 1) to 4), the recombinant plasmid is introduced into Corynebacterium glutamicum or an intermediate recombinant bacterium, for example, the recombinant plasmid is introduced into the intermediate recombinant bacterium under an electric shock condition of a voltage of 2.5kV, a resistance of 200. omega., a capacitance of 25. mu.F, and an electric shock time of 5ms using an electroporator.

In the steps 1) to 4), screening and identifying recombinant bacteria are further included, wherein the screening method can be various methods for screening transformants which are well known to a person skilled in the art, for example, screening by antibiotic resistance (such as kanamycin resistance screening) and/or sucrose screening.

According to a third aspect of the present invention, there is provided a use of the recombinant Corynebacterium glutamicum of the first aspect of the present invention or the recombinant Corynebacterium glutamicum constructed by the method of the second aspect of the present invention for producing tetrahydropyrimidine.

According to a fourth aspect of the present invention, there is also provided a process for producing tetrahydropyrimidine, the process comprising: fermenting the recombinant corynebacterium glutamicum of the first aspect of the present invention or the recombinant corynebacterium glutamicum constructed by the method of the second aspect, thereby obtaining tetrahydropyrimidine.

The fermentation method of the recombinant corynebacterium glutamicum can be a fermentation method for producing tetrahydropyrimidine by using the recombinant corynebacterium glutamicum, which is conventional in the art, for example, the fermentation method can comprise the steps of activating freshly prepared recombinant corynebacterium glutamicum or recombinant corynebacterium glutamicum frozen in a glycerol freezing tube in a corynebacterium glutamicum liquid culture medium, then culturing at 28-32 ℃ for 12-24 h to obtain an activated seed solution, inoculating the seed solution into a 5L full-automatic fermentation tank filled with a 2L corynebacterium glutamicum liquid culture medium in an inoculation amount of 5-15 v/v%, controlling the initial culture temperature of the fermentation tank to be 30-33 ℃, the initial aeration amount to be 1-2vvm, and the initial stirring speed to be 350-500rpm, wherein relevant parameters in the fermentation process can be set as follows, the temperature is controlled to be 32 ℃, the dissolved oxygen concentration in the fermentation broth is controlled by adjusting the stirring speed, so that the dissolved oxygen concentration in the fermentation process is kept to be more than 10%, the pH value is automatically fed-stream-up, ammonia water is added in the fermentation process, the pH is controlled to be 0.7, and the fermentation process can be induced according to actual conditions such as IPTG and IPT 3.

It should be noted that the fermentation conditions are only suitable for the fermentation conditions for producing tetrahydropyrimidine by recombinant Corynebacterium glutamicum, and those skilled in the art may modify or optimize the culture conditions and the medium according to the actual needs, and such modifications and/or optimizations are also within the scope of the present invention.

In a preferred embodiment of the present invention, the corynebacterium glutamicum liquid medium contains a fermentable sugar, including, but not limited to, molasses, sucrose, glucose, starch hydrolysate, corn steep liquor, xylose, mannose, or glycerol, or any mixture thereof; and thiamine and biotin. Fermentable sugar is added in the fermentation process.

In a preferred embodiment of the invention, during the fermentative production of tetrahydropyrimidine, the fermentation temperature is controlled to be 30-33 ℃, preferably 32 ℃, the pH is controlled to be 7.0-7.2, and IPTG is added at a final concentration of 0.01-2mM, preferably 1mM, during the fermentation for 3-5h, preferably 3 h.

For illustrative purposes, the present invention may be represented by the following paragraphs:

1. a recombinant Corynebacterium glutamicum, which uses a wild-type Corynebacterium glutamicum as a starting strain, and which has:

a phosphoenolpyruvate carboxylase, a homoserine dehydrogenase and a dihydropyrimidinedicarboxylic acid synthetase that are expressed at reduced levels compared to the starting strain;

a gene expression cassette for expressing phosphoenolpyruvate carboxylase; and

a gene expression cassette for expressing the enzyme ectoA, the enzyme ectoB and the enzyme ectoC.

2. The recombinant Corynebacterium glutamicum of paragraph 1, wherein the expression levels of phosphoenolpyruvate carboxylase, homoserine dehydrogenase, and dihydropyrimidinedicarboxylate synthase are decreased by knocking out phosphoenolpyruvate carboxylase gene pck, homoserine dehydrogenase gene hom, and dihydropyrimidinedicarboxylate synthase gene dapA in the starting strain.

3. The recombinant Corynebacterium glutamicum of paragraphs 1 or 2, wherein the gene expression cassette for expressing phosphoenolpyruvate carboxylase has the phosphoenolpyruvate carboxylase gene ppc represented by SEQ ID No.: 2.

4. The recombinant Corynebacterium glutamicum of paragraph 3, wherein the phosphoenolpyruvate carboxylase gene pck in the starting strain is replaced with the phosphoenolpyruvate carboxylase gene ppc.

5. The recombinant Corynebacterium glutamicum of any of paragraphs 1 to 4, wherein the gene expression cassette for expressing ectA, ectB, and ectC has a promoter tac, genes encoding ectA, ectB, and ectC, and a terminator rrnB.

6. The recombinant Corynebacterium glutamicum of paragraph 5, wherein the gene encoding ectA, ectB, and ectC is an ectABC gene.

7. The recombinant Corynebacterium glutamicum of paragraph 6, wherein the ectABC gene is represented by SEQ ID No. 5.

8. The recombinant Corynebacterium glutamicum of any of paragraphs 1 to 7, wherein the starting strain is selected from the group consisting of Corynebacterium glutamicum wild-type strain ATCC13032 and Corynebacterium glutamicum wild-type strain S9114.

9. A method of constructing a recombinant corynebacterium glutamicum strain of any of paragraphs 1-8, comprising: the recombinant corynebacterium glutamicum is obtained by taking a wild corynebacterium glutamicum as an initial strain, reducing the expression levels of phosphoenolpyruvate carboxylase, homoserine dehydrogenase and dihydropyrimidinedicarboxylic acid synthase in the wild corynebacterium glutamicum, and introducing a gene expression cassette for expressing the phosphoenolpyruvate carboxylase and a gene expression cassette for expressing ectA enzyme, ectB enzyme and ectC enzyme into the initial strain.

10. The method of paragraph 9, wherein the expression level of phosphoenolpyruvate carboxylase, homoserine dehydrogenase and dihydropyrimidinedicarboxylate synthetase is reduced by knocking out phosphoenolpyruvate carboxylase gene pck, homoserine dehydrogenase gene hom and dihydropyrimidinedicarboxylate synthetase gene dapA in the starting strain.

11. The method of paragraphs 9 or 10 wherein the gene expression cassette for expressing phosphoenolpyruvate carboxylase has the phosphoenolpyruvate carboxylase gene ppc represented by SEQ ID No.: 2.

12. The method of paragraph 11 wherein said phosphoenolpyruvate carboxylase gene pck in said starting strain is replaced with said phosphoenolpyruvate carboxylase gene ppc.

13. The method according to any of paragraphs 9-11, wherein the gene expression cassette for expressing ectoA, ectoB and ectoC has a promoter tac, a gene encoding ectoA, ectoB and ectoC and a terminator rrnB.

14. The method of paragraph 13 wherein the gene encoding ectoA, ectoB and ectoC is the ectoABC gene.

15. The method of paragraph 14 wherein the ectABC gene is represented by SEQ ID No. 5.

16. The method of any of paragraphs 9-15, wherein the method comprises the steps of:

1) connecting a polynucleotide sequence for replacing pck gene with ppc gene to a corynebacterium glutamicum suicide plasmid to obtain a recombinant plasmid, and introducing the recombinant plasmid into the corynebacterium glutamicum to obtain a recombinant bacterium C.glutamcum-delta pck-ppc;

2) connecting a polynucleotide sequence for knocking out the hom gene to a corynebacterium glutamicum suicide plasmid to obtain a recombinant plasmid, and introducing the recombinant plasmid into the recombinant bacterium C.glutamicum-delta pck-ppc obtained in the step 1) to obtain a recombinant bacterium C.glutamicum-delta hom-delta pck-ppc;

3) connecting a polynucleotide sequence for knocking out the dapA gene to a corynebacterium glutamicum suicide plasmid to obtain a recombinant plasmid, and introducing the recombinant plasmid into the recombinant bacterium C.glutamicum-delta hom-delta pck-ppc obtained in the step 2) to obtain the recombinant bacterium C.glutamicum-delta dapA-delta hom-delta pck-ppc; and

4) connecting the optimized polynucleotide sequence for expressing the ectABC gene to an expression plasmid of Corynebacterium glutamicum according to the codon preference of the Corynebacterium glutamicum to obtain a recombinant plasmid, and introducing the recombinant plasmid into the recombinant bacterium C.glutamicum-delta dapA-delta hom-delta pck-ppc obtained in the step 3) to obtain the recombinant Corynebacterium glutamicum C.glutamicum-delta dapA-delta hom-delta pck-ppc-ectABC.

17. The method of paragraph 16 wherein, in step 1), the polynucleotide sequence used to replace the pck gene with the ppc gene is represented by SEQ ID No. 6, wherein SEQ ID No. 6 consists of 1001bp upstream of the pck gene, the ppc gene of SEQ ID No. 2, and 999bp downstream of the pck gene;

in step 2), the polynucleotide sequence for knocking out the hom gene is shown in SEQ ID No. 7, wherein, the SEQ ID No. 7 consists of 1000bp upstream and 1000bp downstream of the hom gene of the genome of Corynebacterium glutamicum;

in the step 3), the polynucleotide sequence for knocking out the dapA gene is shown as SEQ ID NO. 8, wherein the SEQ ID NO. 8 consists of 1000bp upstream and 1000bp downstream of the dapA gene of a Corynebacterium glutamicum genome; and/or

In step 4), the polynucleotide sequence for expressing the ectABC gene is shown by SEQ ID No. 5.

18. The method of paragraph 16 or 17 wherein, in step 1-step 3), the suicide plasmid is pK18 mobsacB.

19. The method of any one of paragraphs 16-18, wherein in step 4) said expression plasmid is pXMJ 19.

20. The method of any of paragraphs 16-19, wherein in step 1) the Corynebacterium glutamicum is Corynebacterium glutamicum wild-type strain S9114.

21. Use of a recombinant corynebacterium glutamicum as described in any of paragraphs 1 to 8 or a recombinant corynebacterium glutamicum constructed by a method as described in any of paragraphs 9 to 20 for producing tetrahydropyrimidine.

22. A method of producing tetrahydropyrimidine, wherein the method comprises: fermenting the recombinant corynebacterium glutamicum of any of paragraphs 1-8 or the recombinant corynebacterium glutamicum constructed by the method of any of paragraphs 9-20, thereby obtaining tetrahydropyrimidine.

23. The method of paragraph 22, wherein the recombinant Corynebacterium glutamicum is fermented in a Corynebacterium glutamicum medium at 30-33 ℃, wherein the pH is maintained at 7.0-7.2 and the dissolved oxygen is greater than 10%.

24. The method of paragraph 23, wherein the recombinant corynebacterium glutamicum is fermented at 32 ℃.

25. The method of paragraphs 23 or 24 wherein the C.glutamicum medium contains a fermentable sugar and thiamine and biotin.

26. The method of paragraph 25 wherein the fermentable sugar is selected from molasses, sucrose, glucose, starch hydrolysate, corn steep liquor, xylose, mannose or glycerol, or any mixture thereof.

27. The method of any of paragraphs 23-26, wherein the fermentable sugar is fed-through during fermentation.

28. The method of any of paragraphs 23-27, wherein IPTG is added to the fermentation broth at a final concentration of 0.01-2mM at 3-5h of fermentation.

29. The method of paragraph 28 wherein IPTG is added to the fermentation broth at a final concentration of 0.01-2mM at 3h of fermentation.

30. The method of paragraph 28 or 29, wherein IPTG is added to the fermentation broth at a final concentration of 1mM at 3h of fermentation.

Examples

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be described in further detail below with reference to the accompanying drawings and the detailed description. It should be understood that the detailed description and specific examples, while indicating the invention, are intended for purposes of illustration only and are not intended to limit the scope of the invention. The experimental methods and equipment described in the following examples are conventional methods and equipment unless otherwise specified. The experimental materials used in the following examples were all obtained from OXOID, NEB, TIANGEN, Invitrogen, etc., unless otherwise specified.

Reagents used in examples:

l B solid culture medium (L B plate) including tryptone 10 g/L, yeast extract 5 g/L, agar 15 g/L, sodium chloride 20-100 g/L, and water in balance, and sterilizing at 121 deg.C and pH 7.0 for 15 min.

The seed culture medium comprises 40 g/L g of glucose (NH)₄)₂SO₄5.0g/L；K₂HPO₄1.5g/L；MgSO₄1.0g/L；MnSO₄0.005g/L；FeSO₄0.005 g/L g/30 g/L g/g of corn steep liquor and the balance of water.

The fermentation medium comprises 80 g/L g of glucose (NH)₄)₂SO₄30.0g/L；K₂HPO₄2.5g/L；MgSO₄1.0g/L；MnSO₄0.010g/L；FeSO₄0.010 g/L, corn steep liquor 15 g/L, biotin 0.0005 g/L, thiamine hydrochloride 0.005 g/L, and water in balance.

In the following examples, pK18mobsacB plasmid and Corynebacterium glutamicum S9114 were purchased from NTCC; the double cleavage reagents and ligation reagents were purchased from NEB.

The gene sequence and the primer are synthesized by Jinwei Zhi company; sequencing was performed by Shanghai Bioengineering, Inc.

The primer sequences used in the examples are as follows:

TABLE 1 primer sequences

Primer name	Sequence (5 '-3')	Sequence numbering
			P1	CTGCGACGACTGGAAAACCA	SEQ ID NO.:9
P2	GGCTGGACCCTAGAATTCGG	SEQ ID NO.:10
			P3	TTAAGAAGTCGACCGCGTGA	SEQ ID NO.:11
P4	AATAATTGCTGCACTAATAA	SEQ ID NO.:12
			P5	TCATTTCAGCAGCGGGTGGA	SEQ ID NO.:13
P6	TCGTCACCGAAACGGGACAA	SEQ ID NO.:14
			P7	ATGAACGCTACCACCGAGCC	SEQ ID NO.:15
P8	TTACAGTGGCTTCTGGTCGT	SEQ ID NO.:16

The double-restriction reaction systems and reaction conditions used in the examples are shown in the following tables 2 to 4:

TABLE 2 Sma I/Sal I double digestion reaction System and reaction conditions

TABLE 3 Xba I/Hind III double digestion reaction System and reaction conditions

TABLE 4 Nde I/EcoR I double digestion reaction System and reaction conditions

The ligation reaction systems and reaction conditions used in the examples are shown in table 5 below:

TABLE 5T 4DNA ligase ligation System and reaction conditions

The reaction system and the reaction procedure for performing colony PCR in the examples are shown in table 6 below:

TABLE 6 reaction System and reaction procedure for colony PCR

EXAMPLE 1 construction of recombinant Corynebacterium glutamicum

(1) Knock-out of pck Gene and simultaneous introduction of ppc Gene

The wild-type strain S9114 of corynebacterium glutamicum is used as an original strain, and pck gene on the genome of the wild-type corynebacterium glutamicum is replaced by ppc gene, so that the pck gene is knocked out and the ppc gene is introduced. A polynucleotide sequence shown in SEQ ID No. 6 for replacing the pck gene with the ppc gene was artificially synthesized. SEQ ID No. 6 consisted of 1001bp upstream of the pck gene, 2(ppc gene) and 999bp downstream of the pck gene.

The Corynebacterium glutamicum suicide plasmid pK18mobsacB and the polynucleotide sequence were double-digested with Sma I/Sal I restriction enzyme according to the digestion reaction system and reaction conditions of Table 2. The digested fragments were recovered separately, and then the digested fragments were ligated to pK18mobsacB using T4DNA ligase according to the ligation system and conditions of Table 5, to obtain recombinant plasmids. The resulting recombinant plasmid was designated pK18 mobsacB-. DELTA.pck-ppc.

The recombinant bacterium is obtained by introducing pK18 mobsacB-delta pck-ppc into Corynebacterium glutamicum S9114 through electrotransformation by using an electroporator (Edwarder), under the condition of electric shock, wherein the electric shock is 2.5kV in voltage, 200 omega in resistance, 25 mu F in capacitance and 5 ms. in shock time, and through two screening processes, a) the recombinant bacterium after electrotransformation is smeared on a L B plate containing 15 mg/L kanamycin and is subjected to static culture at 32 ℃ for 48h to screen positive clones, B) a single colony is picked up and is subjected to streak culture on a L B plate containing 100 g/L sucrose and is subjected to static culture at 32 ℃ for 16h to screen positive clones for the second time, and the obtained delta fragment is subjected to colony PCR on the P1-P2 according to the PCR reaction conditions and the reaction program of the following table 6, and is subjected to sequencing, so that the obtained PCR product is about 4.7kb in size, the strain with the sequence consistent with the sequence shown in SEQ ID No. 6 is named as the recombinant bacterium pcamik-14.

(2) Knock out hom gene in C.glutamicum S9114-delta pck-ppc

The hom gene was knocked out from the genome of C.glutamcum S9114- Δ pck-ppc. Artificially synthesizing a polynucleotide sequence shown as SEQ ID No. 7 for knocking out the hom gene, wherein the SEQ ID No. 7 consists of 1000bp upstream and 1000bp downstream of the hom gene of a Corynebacterium glutamicum S9114 genome.

The suicide plasmid pK18mobsacB of Corynebacterium glutamicum and the above-mentioned polynucleotide sequence were double-digested with Xba I/Hind III restriction enzymes according to the digestion reaction system and reaction conditions of Table 3. After recovering the digested fragments, the digested fragments were ligated to pK18mobsacB using T4DNA ligase according to the ligation system and conditions of Table 5, to obtain recombinant plasmids. The resulting recombinant plasmid was designated pK18 mobsacB-. DELTA.hom.

The recombinant plasmid pK18 mobsacB-delta hom is introduced into Corynebacterium glutamicum S9114-delta pck-ppc through electrotransformation by using an electroporator, the electric shock condition is 2.5kV, the resistance is 200 omega, the capacitance is 25 mu F, and the electric shock time is 5 ms., recombinant bacteria are obtained through two screening steps of a) smearing the recombinant bacteria after electrotransformation on a L B plate containing 15 mg/L kanamycin, standing and culturing for 48h at 32 ℃, screening positive clones, B) picking single colonies, carrying out streak culture on a L B plate containing 100 g/L sucrose, standing and culturing for 16h at 32 ℃, carrying out secondary screening positive clones, carrying out colony PCR on the secondary positive clones by using primers to carry out colony PCR on P3-P4, sending the obtained amplified fragments to be sequenced, obtaining a strain of which the PCR product size is about 2.0kb and the sequence is consistent with the sequence shown in SEQ ID NO. 7, namely the positive recombinant bacteria, and the strain is named as C.gluticum S9114-delta-ppc.

(3) Knock-out dapA gene in C.glutamicum S9114-delta hom-delta pck-ppc

The dapA gene was knocked out from the genome of C.glutamicum S9114-. DELTA.hom-. DELTA.pck-ppc. Artificially synthesizing a polynucleotide sequence for knocking out the dapA gene shown in SEQ ID No. 8, wherein the SEQ ID No. 8 consists of 1000bp upstream and 1000bp downstream of the dapA gene of a Corynebacterium glutamicum S9114 genome.

The Corynebacterium glutamicum suicide plasmid pK18mobsacB and the polynucleotide sequence were double-digested with Sma I/Sal I restriction enzyme according to the digestion reaction system and reaction conditions of Table 2. After recovering the digested fragments, the digested fragments were ligated to pK18mobsacB using T4DNA ligase according to the ligation system and reaction conditions shown in Table 5, to obtain recombinant plasmids. The obtained recombinant plasmid was designated pK18 mobsacB-. DELTA.dapA.

The recombinant plasmid pK18 mobsacB-delta dapA is introduced into Corynebacterium glutamicum C.glutamicum S9114-delta hom-delta pck-ppc through electrotransformation by using an electroporator, the electric shock condition is 2.5kV, the resistance is 200 omega, the capacitance is 25 mu F, and the electric shock time is 5 ms., recombinant bacteria are obtained through two screening processes, namely, a) the recombinant bacteria after the electrotransformation are smeared on a L B plate containing 15 mg/L kanamycin, static culture is carried out for 48h at 32 ℃, positive clones are screened, B) a single colony is picked, streak culture is carried out on a L B plate containing 100 g/L sucrose, static culture is carried out for 16h at 32 ℃, secondary screening positive clones are carried out, the secondary positive clones are subjected to colony PCR by using a primer pair P5-P6, the obtained amplified fragment is sent to be sequenced, the obtained PCR product is about 2.0kb in size, the strain with the sequence consistent with the sequence shown in SEQ ID NO. 8, namely, the recombinant bacteria pcsacicum C.14-delta dmac-delta.

(4) Overexpression of ectoABC Gene in C.glutamicum S9114-delta dapA-delta hom-delta pck-ppc

The polynucleotide sequence of the ectABC gene described in SEQ ID No. 5 was synthesized by optimizing the polynucleotide sequence based on NCBI No. D88359.1 according to the codon usage preference of Corynebacterium glutamicum.

The expression plasmid pXMJ19 of Corynebacterium glutamicum and the above-mentioned polynucleotide sequence were double-digested with Nde I/EcoR I restriction enzymes according to the digestion reaction system and reaction conditions of Table 4. After recovering the cleaved fragments, respectively, the cleaved fragments were ligated to pXMJ19 using T4DNA ligase according to the ligation system and conditions shown in Table 5 to obtain recombinant plasmids. The resulting recombinant plasmid was named 19-ectABC.

Recombinant plasmid 196-ectABC is introduced into Corynebacterium glutamicum C.glutamicum S9114-delta dapA-delta hom-delta pck-ppc through electrotransformation by using an electroporator, the electric shock condition is 2.5kV, the resistance is 200 omega, the capacitance is 25 muF, the electric shock time is 5 ms., the recombinant plasmid is kept standing and cultured for 48h at 32 ℃ on a L B plate containing 15 mg/L kanamycin, positive clones are screened, colony PCR is carried out on the positive clones by using a primer pair P7-P8, the obtained amplified fragment is sent to be sequenced, a strain with the PCR product size of about 2.2kb and the sequence consistent with that shown in SEQ ID NO. 5 is obtained, namely the positive recombinant strain, and the positive recombinant strain is named as C.glutamicum S9114-delta dapA-delta hom-delta pck-ppc-19-ectABC (also named as CG.C.glutamicum).

EXAMPLE 2 fermentative production of tetrahydropyrimidines using CG. ECT-2

The recombinant Corynebacterium glutamicum CG. ECT-2 obtained in example 1 was cultured on L B plates overnight at 30 ℃ the next day, a single colony was picked from the plate and inoculated into a 250m L baffled shake flask containing 30m L seed medium (containing 15 mg/L kanamycin) and cultured at 32 ℃ and 200rpm for 12 hours to obtain a seed solution.

Inoculating the seed liquid into a 2L fermentation medium (containing 15 mg/L kanamycin) with the inoculation amount of 10 v/v%, fermenting by adopting a 5L fermentation tank, controlling the temperature to be 32 ℃, the ventilation quantity to be 1vvm, the initial rotation speed to be 350-500rpm, adjusting the rotation speed in the fermentation process to keep the dissolved oxygen level to be more than 10%, controlling the pH value to be stabilized at about 7.0 by adding 13% ammonia water in a flowing manner, adding 1mM IPTG when fermenting for 3h, sampling at different fermentation time points and detecting the yield of the tetrahydropyrimidine in the fermentation liquid.

The tetrahydropyrimidine content of the fermentation broth was determined by liquid chromatography (HP L C) under HP L C conditions of Agilent technologies 1260Infinity II chromatography, UV detector chromatography, ZORBAX SB-C18 column, 250X 4.6mM 5um, 80A chromatography, 40 ℃ column temperature, mobile phase 10mM sodium dihydrogen phosphate buffer (pH 2.6), acetonitrile 70:30, flow rate 1m L/min, sample introduction 10. mu. L, and target product formation by external standard method, tetrahydropyrimidine standard was purchased from Bitop.

The result is shown in figure 2, the yield of tetrahydropyrimidine can reach about 25 g/L when fermentation is carried out for 70 hours, so that compared with other strains (such as CN107142234A) capable of producing tetrahydropyrimidine reported in the prior art, the method for producing tetrahydropyrimidine by using the recombinant corynebacterium glutamicum CG.ECT-2 prepared in the embodiment 1 of the invention has obvious improvement, and the recombinant corynebacterium glutamicum CG.ECT-2 of the invention does not produce endotoxin, so that the complicated steps of removing toxin, separating and purifying products in subsequent engineering are omitted, the safety of products is improved, the production cost is greatly reduced, and the method has good industrial application prospect.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Beijing Baioengnu Biotech Co., Ltd

<120> recombinant corynebacterium glutamicum, construction method thereof and method for producing tetrahydropyrimidine

<160>16

<170>SIPOSequenceListing 1.0

<210>1

<211>1833

<212>DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400>1

atgactactg ctgcaatcag gggccttcag ggcgaggcgc cgaccaagaa taaggaactg 60

ctgaactgga tcgcagacgc cgtcgagctc ttccagcctg aggctgttgt gttcgttgat 120

ggatcccagg ctgagtggga tcgcatggcg gaggatcttg ttgaagccgg taccctcatc 180

aagctcaacg aggaaaagcg tccgaacagc tacctagctc gttccaaccc atctgacgtt 240

gcgcgcgttg agtcccgcac cttcatctgc tccgagaagg aagaagatgc tggcccaacc 300

aacaactggg ctccaccaca ggcaatgaag gacgaaatgt ccaagcatta cgctggttcc 360

atgaaggggc gcaccatgta cgtcgtgcct ttctgcatgg gtccaatcag cgatccggac 420

cctaagcttg gtgtgcagct cactgactcc gagtacgttg tcatgtccat gcgcatcatg 480

acccgcatgg gtattgaagc gctggacaag atcggcgcga acggcagctt cgtcaggtgc 540

ctccactccg ttggtgctcc tttggagcca ggccaggaag acgttgcatg gccttgcaac 600

gacaccaagt acatcaccca gttcccagag accaaggaaa tttggtccta cggttccggc 660

tacggcggaa acgcaatcct ggcaaagaag tgctacgcac tgcgtatcgc atctgtcatg 720

gctcgcgaag aaggatggat ggctgagcac atgctcatcc tgaagctgat caacccagag 780

ggcaaggcgt accacatcgc agcagcattc ccatctgctt gtggcaagac caacctcgcc 840

atgatcactc caaccatccc aggctggacc gctcaggttg ttggcgacga catcgcttgg 900

ctgaagctgc gcgaggacgg cctctacgca gttaacccag aaaatggttt cttcggtgtt 960

gctccaggca ccaactacgc atccaaccca atcgcgatga agaccatgga accaggcaac 1020

accctgttca ccaacgtggc actcaccgac gacggcgaca tctggtggga aggcatggac 1080

ggcgacgccc cagctcacct cattgactgg atgggcaacg actggacccc agagtccgac 1140

gaaaacgctg ctcaccctaa ctcccgttac tgcgtagcaa tcgaccagtc cccagcagca 1200

gcacctgagt tcaacgactg ggaaggcgtc aagatcgacg caatcctctt cggtggacgt 1260

cgcgcagaca ccgtcccact ggttacccag acctacgact gggagcacgg caccatggtt 1320

ggtgcactgc tcgcatccgg tcagaccgca gcttccgcag aagcaaaggt cggcacactc 1380

cgccacgacc caatggcaat gctcccattc attggctaca acgctggtga atacctgcag 1440

aactggattg acatgggtaa caagggtggc gacaagatgc catccatctt cctggtcaac 1500

tggttccgcc gtggcgaaga tggacgcttc ctgtggcctg gcttcggcga caactctcgc 1560

gttctgaagt gggtcatcga ccgcatcgaa ggccacgttg gcgcagacga gaccgttgtt 1620

ggacacaccg ctaaggccga agacctcgac ctcgacggcc tcgacacccc aattgaggat 1680

gtcaaggaag cactgaccgc tcctgcagag cagtgggcaa acgacgttga agacaacgcc 1740

gagtacctca ctttcctcgg accacgtgtt cctgcagagg ttcacagcca gttcgatgct 1800

ctgaaggccc gcatttcagc agctcacgct taa 1833

<210>2

<211>2760

<212>DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400>2

atgactgatt ttttacgcga tgacatcagg ttcctcggtc aaatcctcgg tgaggtaatt 60

gcggaacaag aaggccagga ggtttatgaa ctggtcgaac aagcgcgcct gacttctttt 120

gatatcgcca agggcaacgc cgaaatggat agcctggttc aggttttcga cggcattact 180

ccagccaagg caacaccgat tgctcgcgca ttttcccact tcgctctgct ggctaacctg 240

gcggaagacc tctacgatga agagcttcgt gaacaggctc tcgatgcagg cgacacccct 300

ccggacagca ctcttgatgc cacctggctg aaactcaatg agggcaatgt tggcgcagaa 360

gctgtggccg atgtgctgcg caatgctgag gtggcgccgg ttctgactgc gcacccaact 420

gagactcgcc gccgcactgt ttttgatgcg caaaagtgga tcaccaccca catgcgtgaa 480

cgccacgctt tgcagtctgc ggagcctacc gctcgtacgc aaagcaagtt ggatgagatc 540

gagaagaaca tccgccgtcg catcaccatt ttgtggcaga ccgcgttgat tcgtgtggcc 600

cgcccacgta tcgaggacga gatcgaagta gggctgcgct actacaagct gagccttttg 660

gaagagattc cacgtatcaa ccgtgatgtg gctgttgagc ttcgtgagcg tttcggcgag 720

ggtgttcctt tgaagcccgt ggtcaagcca ggttcctgga ttggtggaga ccacgacggt 780

aacccttatg tcaccgcgga aacagttgag tattccactc accgcgctgc ggaaaccgtg 840

ctcaagtact atgcacgcca gctgcattcc ctcgagcatg agctcagcct gtcggaccgc 900

atgaataagg tcaccccgca gctgcttgcg ctggcagatg cagggcacaa cgacgtgcca 960

agccgcgtgg atgagcctta tcgacgcgcc gtccatggcg ttcgcggacg tatcctcgcg 1020

acgacggccg agctgatcgg cgaggacgcc gttgagggcg tgtggttcaa ggtctttact 1080

ccatacgcat ctccggaaga attcttaaac gatgcgttga ccattgatca ttctctgcgt 1140

gaatccaagg acgttctcat tgccgatgat cgtttgtctg tgctgatttc tgccatcgag 1200

agctttggat tcaaccttta cgcactggat ctgcgccaaa actccgaaag ctacgaggac 1260

gtcctcaccg agcttttcga acgcgcccaa gtcaccgcaa actaccgcga gctgtctgaa 1320

gcagagaagc ttgaggtgct gctgaaggaa ctgcgcagcc ctcgtccgct gatcccgcac 1380

ggttcagatg aatacagcga ggtcaccgac cgcgagctcg gcatcttccg caccgcgtcg 1440

gaggctgtta agaaattcgg gccacggatg gtgcctcact gcatcatctc catggcatca 1500

tcggtcaccg atgtgctcga gccgatggtg ttgctcaagg aattcggact catcgcagcc 1560

aacggcgaca acccacgcgg caccgtcgat gtcatcccac tgttcgaaac catcgaagat 1620

ctccaggccg gcgccggaat cctcgacgaa ctgtggaaaa ttgatctcta ccgcaactac 1680

ctcctgcagc gcgacaacgt ccaggaagtc atgctcggtt actccgattc caacaaggat 1740

ggcggatatt tctccgcaaa ctgggcgctt tacgacgcgg aactgcagct cgtcgaacta 1800

tgccgatcag ccggggtcaa gcttcgcctg ttccacggcc gtggtggcac cgtcggccgc 1860

ggtggcggac cttcctacga cgcgattctt gcccagccca ggggggctgt ccaaggttcc 1920

gtgcgcatca ccgagcaggg cgagatcatc tccgctaagt acggcaaccc cgaaaccgcg 1980

cgccgaaacc tcgaagccct ggtctcagcc acgcttgagg catcgcttct cgacgtctcc 2040

gaactcaccg atcaccaacg cgcgtacgac atcatgagtg agatctctga gctcagcttg 2100

aagaagtacg cctccttggt gcacgaggat caaggcttca tcgattactt cacccagtcc 2160

acgccgctgc aggagattgg atccctcaac atcggatcca ggccttcctc acgcaagcag 2220

acctcctcgg tggaagattt gcgagccatc ccatgggtgc tcagctggtc acagtctcgt 2280

gtcatgctgc caggctggtt tggtgtcgga accgcattag agcagtggat tggcgaaggg 2340

gagcaggcca cccaacgcat tgccgagctg caaacactca atgagtcctg gccatttttc 2400

acctcagtgt tggataacat ggctcaggtg atgtccaagg cagagctgcg tttggcaaag 2460

ctctacgcag acctgatccc agatacggaa gtagccgagc gagtctattc cgtcatccgc 2520

gaggagtact tcctgaccaa gaagatgttc tgcgtaatca ccggctctga tgatctgctt 2580

gatgacaacc cacttctcgc acgctctgtc cagcgccgat acccctacct gcttccactc 2640

aacgtgatcc aggtagagat gatgcgacgc taccgaaaag gcgaccaaag cgagcaagtg 2700

tcccgcaaca ttcagctgac catgaacggt ctttccactg cgctgcgcaa ctccggctag 2760

<210>3

<211>1338

<212>DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400>3

atgacctcag catctgcccc aagctttaac cccggcaagg gtcccggctc agcagtcgga 60

attgcccttt taggattcgg aacagtcggc actgaggtga tgcgtctgat gaccgagtac 120

ggtgatgaac ttgcgcaccg cattggtggc ccactggagg ttcgtggcat tgctgtttct 180

gatatctcaa agccacgtga aggcgttgca cctgagctgc tcactgagga cgcttttgca 240

ctcatcgagc gcgaggatgt tgacatcgtc gttgaggtta tcggcggcat tgagtaccca 300

cgtgaggtag ttctcgcagc tctgaaggcc ggcaagtctg ttgttaccgc caataaggct 360

cttgttgcag ctcactctgc tgagcttgct gatgcagcgg aagccgcaaa cgttgacctg 420

tacttcgagg ctgctgttgc aggcgcaatt ccagtggttg gcccactgcg tcgctccctg 480

gctggcgatc agatccagtc tgtgatgggc atcgttaacg gcaccaccaa cttcatcttg 540

gacgccatgg attccaccgg cgctgactat gcagattctt tggctgaggc aactcgtttg 600

ggttacgccg aagctgatcc aactgcagac gtcgaaggcc atgacgccgc atccaaggct 660

gcaattttgg catccatcgc tttccacacc cgtgttaccg cggatgatgt gtactgcgaa 720

ggtatcagca acatcagcgc tgccgacatt gaggcagcac agcaggcagg ccacaccatc 780

aagttgttgg ccatctgtga gaagttcacc aacaaggaag gaaagtcggc tatttctgct 840

cgcgtgcacc cgactctatt acctgtgtcc cacccactgg cgtcggtaaa caagtccttt 900

aatgcaatct ttgttgaagc agaagcagct ggtcgcctga tgttctacgg aaacggtgca 960

ggtggcgcgc caaccgcgtc tgctgtgctt ggcgacgtcg ttggtgccgc acgaaacaag 1020

gtgcacggtg gccgtgctcc aggtgagtcc acctacgcta acctgccgat cgctgatttc 1080

ggtgagacca ccactcgtta ccacctcgac atggatgtgg aagatcgcgt gggggttttg 1140

gctgaattgg ctagcctgtt ctctgagcaa ggaatctccc tgcgtacaat ccgacaggaa 1200

gagcgcgatg atgatgcacg tctgatcgtg gtcacccact ctgcgctgga atctgatctt 1260

tcccgcaccg ttgaactgct gaaggctaag cctgttgtta aggcaatcaa cagtgtgatc 1320

cgcctcgaaa gggactaa 1338

<210>4

<211>906

<212>DNA

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400>4

atgagcacag gtttaacagc taagaccgga gtagagcact tcggcaccgt tggagtagca 60

atggttactc cattcacgga atccggagac atcgatatcg ctgctggccg cgaagtcgcg 120

gcttatttgg ttgataaggg cttggattct ttggttctcg cgggcaccac tggtgaatcc 180

ccaacgacaa ccgccgctga aaaactagaa ctgctcaagg ccgttcgtga ggaagttggg 240

gatcgggcga agctcatcgc cggtgtcgga accaacaaca cgcggacatc tgtggaactt 300

gcggaagctg ctgcttctgc tggcgcagac ggccttttag ttgtaactcc ttattactcc 360

aagccgagcc aagagggatt gctggcgcac ttcggtgcaa ttgctgcagc aacagaggtt 420

ccaatttgtc tctatgacat tcctggtcgg tcaggtattc caattgagtc tgataccatg 480

agacgcctga gtgaattacc tacgattttg gcggtcaagg acgccaaggg tgacctcgtt 540

gcagccacgt cattgatcaa agaaacggga cttgcctggt attcaggcga tgacccacta 600

aaccttgttt ggcttgcttt gggcggatca ggtttcattt ccgtaattgg acatgcagcc 660

cccacagcat tacgtgagtt gtacacaagc ttcgaggaag gcgacctcgt ccgtgcgcgg 720

gaaatcaacg ccaaactatc accgctggta gctgcccaag gtcgcttggg tggagtcagc 780

ttggcaaaag ctgctctgcg tctgcagggc atcaacgtag gagatcctcg acttccaatt 840

atggctccaa atgagcagga acttgaggct ctccgagaag acatgaaaaa agctggagtt 900

ctataa 906

<210>5

<211>2259

<212>DNA

<213> Halomonas elongata (Halomonas elongata)

<400>5

atgaacgcta ccaccgagcc attcacccca tccgctgacc tggctaagcc atccgttgct 60

gacgctgttg ttggccacga ggcttcccca ctgttcatcc gcaagccatc cccagacgac 120

ggctggggca tctacgagct ggttaagtcc tgcccaccac tggacgttaa ctccgcttac 180

gcttacctgc tgctggctac ccagttccgc gactcctgcg ctgttgctac caacgaggag 240

ggcgagatcg ttggcttcgt ttccggctac gttaagtcca acgctccaga cacctacttc 300

ctgtggcagg ttgctgttgg cgagaaggct cgcggcaccg gcctggctcg ccgcctggtt 360

gaggctgtta tgacccgccc agagatggct gaggttcacc acctggagac caccatcacc 420

ccagacaacc aggcttcctg gggcctgttc cgccgcctgg ctgaccgctg gcaggctcca 480

ctgaactccc gcgagtactt ctccaccgac cagctgggcg gcgagcacga cccagagaac 540

ctggttcgca tcggcccatt ccagaccgac cagatctaaa tgcagaccca gatcctggag 600

cgcatggagt ccgacgttcg cacctactcc cgctccttcc cagttgtttt caccaaggct 660

cgcaacgctc gcctgaccga cgaggagggc cgcgagtaca tcgacttcct ggctggcgct 720

ggcaccctga actacggcca caacaaccca cacctgaagc aggctctgct ggactacatc 780

gactccgacg gcatcgttca cggcctggac ttctggaccg ctgctaagcg cgactacctg 840

gagaccctgg aggaggttat cctgaagcca cgcggcctgg actacaaggt tcacctgcca 900

ggcccaaccg gcaccaacgc tgttgaggct gctatccgcc tggctcgcgt tgctaagggc 960

cgccacaaca tcgtttcctt caccaacggc ttccacggcg ttaccatggg cgctctggct 1020

accaccggca accgcaagtt ccgcgaggct accggcggcg ttccaaccca ggctgcttcc 1080

ttcatgccat tcgacggcta cctgggctcc tccaccgaca ccctggacta cttcgagaag 1140

ctgctgggcg acaagtccgg cggcctggac gttccagctg ctgttatcgt tgagaccgtt 1200

cagggcgagg gcggcatcaa cgttgctggc ctggagtggc tgaagcgcct ggagtccatc 1260

tgccgcgcta acgacatcct gctgatcatc gacgacatcc aggctggctg cggccgcacc 1320

ggcaagttct tctccttcga gcacgctggc atcaccccag acatcgttac caactccaag 1380

tccctgtccg gctacggcct gccattcgct cacgttctga tgcgcccaga gctggacaag 1440

tggaagccag gccagtacaa cggcaccttc cgcggcttca acctggcttt cgctaccgct 1500

gctgctgcta tgcgcaagta ctggtccgac gacaccttcg agcgcgacgt tcagcgcaag 1560

gctcgcatcg ttgaggagcg cttcggcaag atcgctgctt ggctgtccga gaacggcatc 1620

gaggcttccg agcgcggccg cggcctgatg cgcggcatcg acgttggctc cggcgacatc 1680

gctgacaaga tcacccacca ggctttcgag aacggcctga tcatcgagac ctccggccag 1740

gacggcgagg ttgttaagtg cctgtgccca ctgaccatcc cagacgagga cctggttgag 1800

ggcctggaca tcctggagac ctccaccaag caggctttct cctaaatgat cgttcgcaac 1860

ctggaggagg ctcgccagac cgaccgcctg gttaccgctg agaacggcaa ctgggactcc 1920

acccgcctgt ccctggctga ggacggcggc aactgctcct tccacatcac ccgcatcttc 1980

gagggcaccg agacccacat ccactacaag caccacttcg aggctgttta ctgcatcgag 2040

ggcgagggcg aggttgagac cctggctgac ggcaagatct ggccaatcaa gccaggcgac 2100

atctacatcc tggaccagca cgacgagcac ctgctgcgcg cttccaagac catgcacctg 2160

gcttgcgttt tcaccccagg cctgaccggc aacgaggttc accgcgagga cggctcctac 2220

gctccagctg acgaggctga cgaccagaag ccactgtaa 2259

<210>6

<211>4760

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ctgcgacgac tggaaaacca tggattttca acagtgatga caacaatgag atgcccatga 60

gggaaccagc ccacgagggg ccaggtggag gtaagaccgc agcgtagctt ttggtcgaag 120

aaggagtggg catgcccatt actttaagcc tttggggcag tgaaaccgct aaatgggagc 180

gttgtgcgct cgatcactgg tctagacctt tgggctccaa aagttgcaat ttcgcgaata 240

cttcaacact tgtttgcaat gtttgttaat aaatgggttc gctagtggat tctgtcgtta 300

gtactggccg tcgtggtggg gtcatgtatt taggtagggc aaagttaaga tcagagcact 360

ttttgatacg actaactgga tataaccttt ggggtaacgt ggggatgtgt gtgagtaatt 420

ttcaaagtat ttaaaagggg gatctagggt aaaaatttgg cttcaagtac atatctttag 480

ttcggtagtt gagggcgggt ggtgacagtg cgggcatgca tgtgagtgta aatgttgttt 540

taaaaaggtg tgtactgaca gtgggccggt ttgtgctggt cggccactag cggagtgctt 600

ggattgtgat ggcagggtaa gggaaaggga ttaccattac cgctgttctt ggcgttttgt 660

tgcctattgt ccgaatgtta agtgttaatg gtgggaaaac tgggaaagtt gtcccctgga 720

atgtgtgaga attgcccaaa tctgaaccca atggccatgg acggggaatg aactgtcgga 780

gaacggttga ggttaattct tgaaaccacc cccaaaatag gctatttaaa cgggtgctct 840

catattaaag aaagtgtgta gatgcgtgtg ggcagggggt aggtccactg gtaatgacaa 900

atgtgtccgt tgtctcacct aaagttttaa ctagttctgt atctgaaagc tacgctaggg 960

ggcgagaact ctgtcgaatg acacaaaatc tggagaagta atgactgatt ttttacgcga 1020

tgacatcagg ttcctcggtc aaatcctcgg tgaggtaatt gcggaacaag aaggccagga 1080

ggtttatgaa ctggtcgaac aagcgcgcct gacttctttt gatatcgcca agggcaacgc 1140

cgaaatggat agcctggttc aggttttcga cggcattact ccagccaagg caacaccgat 1200

tgctcgcgca ttttcccact tcgctctgct ggctaacctg gcggaagacc tctacgatga 1260

agagcttcgt gaacaggctc tcgatgcagg cgacacccct ccggacagca ctcttgatgc 1320

cacctggctg aaactcaatg agggcaatgt tggcgcagaa gctgtggccg atgtgctgcg 1380

caatgctgag gtggcgccgg ttctgactgc gcacccaact gagactcgcc gccgcactgt 1440

ttttgatgcg caaaagtgga tcaccaccca catgcgtgaa cgccacgctt tgcagtctgc 1500

ggagcctacc gctcgtacgc aaagcaagtt ggatgagatc gagaagaaca tccgccgtcg 1560

catcaccatt ttgtggcaga ccgcgttgat tcgtgtggcc cgcccacgta tcgaggacga 1620

gatcgaagta gggctgcgct actacaagct gagccttttg gaagagattc cacgtatcaa 1680

ccgtgatgtg gctgttgagc ttcgtgagcg tttcggcgag ggtgttcctt tgaagcccgt 1740

ggtcaagcca ggttcctgga ttggtggaga ccacgacggt aacccttatg tcaccgcgga 1800

aacagttgag tattccactc accgcgctgc ggaaaccgtg ctcaagtact atgcacgcca 1860

gctgcattcc ctcgagcatg agctcagcct gtcggaccgc atgaataagg tcaccccgca 1920

gctgcttgcg ctggcagatg cagggcacaa cgacgtgcca agccgcgtgg atgagcctta 1980

tcgacgcgcc gtccatggcg ttcgcggacg tatcctcgcg acgacggccg agctgatcgg 2040

cgaggacgcc gttgagggcg tgtggttcaa ggtctttact ccatacgcat ctccggaaga 2100

attcttaaac gatgcgttga ccattgatca ttctctgcgt gaatccaagg acgttctcat 2160

tgccgatgat cgtttgtctg tgctgatttc tgccatcgag agctttggat tcaaccttta 2220

cgcactggat ctgcgccaaa actccgaaag ctacgaggac gtcctcaccg agcttttcga 2280

acgcgcccaa gtcaccgcaa actaccgcga gctgtctgaa gcagagaagc ttgaggtgct 2340

gctgaaggaa ctgcgcagcc ctcgtccgct gatcccgcac ggttcagatg aatacagcga 2400

ggtcaccgac cgcgagctcg gcatcttccg caccgcgtcg gaggctgtta agaaattcgg 2460

gccacggatg gtgcctcact gcatcatctc catggcatca tcggtcaccg atgtgctcga 2520

gccgatggtg ttgctcaagg aattcggact catcgcagcc aacggcgaca acccacgcgg 2580

caccgtcgat gtcatcccac tgttcgaaac catcgaagat ctccaggccg gcgccggaat 2640

cctcgacgaa ctgtggaaaa ttgatctcta ccgcaactac ctcctgcagc gcgacaacgt 2700

ccaggaagtc atgctcggtt actccgattc caacaaggat ggcggatatt tctccgcaaa 2760

ctgggcgctt tacgacgcgg aactgcagct cgtcgaacta tgccgatcag ccggggtcaa 2820

gcttcgcctg ttccacggcc gtggtggcac cgtcggccgc ggtggcggac cttcctacga 2880

cgcgattctt gcccagccca ggggggctgt ccaaggttcc gtgcgcatca ccgagcaggg 2940

cgagatcatc tccgctaagt acggcaaccc cgaaaccgcg cgccgaaacc tcgaagccct 3000

ggtctcagcc acgcttgagg catcgcttct cgacgtctcc gaactcaccg atcaccaacg 3060

cgcgtacgac atcatgagtg agatctctga gctcagcttg aagaagtacg cctccttggt 3120

gcacgaggat caaggcttca tcgattactt cacccagtcc acgccgctgc aggagattgg 3180

atccctcaac atcggatcca ggccttcctc acgcaagcag acctcctcgg tggaagattt 3240

gcgagccatc ccatgggtgc tcagctggtc acagtctcgt gtcatgctgc caggctggtt 3300

tggtgtcgga accgcattag agcagtggat tggcgaaggg gagcaggcca cccaacgcat 3360

tgccgagctg caaacactca atgagtcctg gccatttttc acctcagtgt tggataacat 3420

ggctcaggtg atgtccaagg cagagctgcg tttggcaaag ctctacgcag acctgatccc 3480

agatacggaa gtagccgagc gagtctattc cgtcatccgc gaggagtact tcctgaccaa 3540

gaagatgttc tgcgtaatca ccggctctga tgatctgctt gatgacaacc cacttctcgc 3600

acgctctgtc cagcgccgat acccctacct gcttccactc aacgtgatcc aggtagagat 3660

gatgcgacgc taccgaaaag gcgaccaaag cgagcaagtg tcccgcaaca ttcagctgac 3720

catgaacggt ctttccactg cgctgcgcaa ctccggctag agttcacgct taagaactgc 3780

taaataacaa gaaaggctcc caccgaaagt gggagccttt cttgtcgtta agcgatgaat 3840

tcctcaaaac ctcagtgctt tttaaacacc aacaccaagt tacttaccgc gaattctcgg 3900

agcactggga ctttaaccat ccaccagacc caatacgggt ggtagcgggg aaaagcggca 3960

accaattccg cattgcccac ggaggctccc cattccagcc cctcccggca ggacacatta 4020

aacagtgact ccccgaaaac gttcttaggc gggtgcccgt gtttcttcgt gtagcgatcg 4080

cgggcaaatt ctccgccaac gtagtgttcc cacagtccgg tttcatggcc gccgaagggc 4140

cctaaccaaa tggtgtagct caggattgcc aggccgccgc tgcgggtgac gcggagcatt 4200

tcttctccca attcccacgg tgcggagaca tgttctgcaa cgttggagga gtacaccacg 4260

tcaaaggaat cgggaagaaa cggcaggtcg aggccggatc cgcggactga tccgtggacg 4320

tcgatgccag ctgcggacat ttcgccaacg tcgggttcga cggagaagta ggtggcgccc 4380

agtgtctcaa aggcttcggc gaagtatccg ggtccgccgc cgacgtcgag aactttcagg 4440

tcatttaatc cggcgccaga aatatcttca gacaaagccg ccaccagact cgaggtatcg 4500

agggccaggt ttccgtaaaa gatgtcaggt cgggtttgtt cgtatttgaa atcagacagt 4560

aaaccccacg acctgcccaa ggtagccaag cgacgaagag ccggaagctc cggaaatgag 4620

gccatttatg cgcgggtcca gttgaggtcg cggatgtctt cgccgttcat ccatcgcaaa 4680

atggtggtga tggcatcgtc gatggaggaa acaatggtgg tgttttttac tcctgcgacg 4740

ccgaattcta gggtccagcc 4760

<210>7

<211>2000

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

ttaagaagtc gaccgcgtga agtcgccctt taggagaatt ctgactaact ggagccaaaa 60

cttgatccac tcgagagctg tgcagtctct ttttccttca attctgcctg ctcgagctcg 120

tagaagtaga ggtctacttc agttggttca ccttgcacac aagcatgaag tagtgggtag 180

gtcgagttgt taaatgcggt gtagaagggg agtagttcgc tagcaaaggt taatttggag 240

tcgctgtact gcgggttctc gggtggagta ttcccggagg attcaagaaa tcttgacgca 300

tctttgatga ggtatgtttg gaattcgtcg gcaccttcct cgccggagag gtagtaggag 360

ttgtcgtaat ttggaaccca gatggcaaat cgtgcgtttt cgattgcgtc caggagttcc 420

tctacgttgt atctcgcact tgttgcagcg gaagcgactc ggttgccgat gtctccgtat 480

gcagtgagcg tggcgtttcc gaggggaact tgatcagagg aatacaccat ggagccgatg 540

tcagaggcga ctgcgggcag atccttttga agctgtttca caatttcttt gcccagttcg 600

cggcggatct ggaaccactt ttgcatgcga tcgtcgtcag agtggttcat gtgaaaaata 660

cactcaccat ctcaatggtc atggtgaagg cctgtactgg ctgcgacagc atggaactca 720

gtgcaatggc tgtaaggcct gcaccaacaa tgattgagcg aagctccaaa atgtcctccc 780

cgggttgata ttagatttca taaatatact aaaaatcttg agagtttttc cgttgaaaac 840

taaaaagctg ggaaggtgaa tcgaatttcg gggctttaaa gcaaaaatga acagcttggt 900

ctatagtggc taggtaccct ttttgttttg gacacatgta gggtggccga aacaaagtaa 960

taggacaaca acgctcgacc gcgattattt ttggagaatc ttttactgac atggcaattg 1020

aactgaacgt cggtcgtaag gttaccgtca cggtacctgg atcttctgca aacctcggac 1080

ctggctttga cactttaggt ttggcactgt cggtatacga cactgtcgaa gtggaaatta 1140

ttccatctgg cttggaagtg gaagtttttg gcgaaggcca aggcgaagtc cctcttgatg 1200

gctcccacct ggtggttaaa gctattcgtg ctggcctgaa ggcagctgac gctgaagttc 1260

ctggattgcg agtggtgtgc cacaacaaca ttccgcagtc tcgtggtctt ggctcctctg 1320

ctgcagcggc ggttgctggt gttgctgcag ctaatggttt ggcggatttc ccgctgactc 1380

aagagcagat tgttcagttg tcctctgcct ttgaaggcca cccagataat gctgcggctt 1440

ctgtgctggg tggagcagtg gtgtcgtgga caaatctgtc tatcgacggc aagagccagc 1500

cacagtatgc tgctgtacca cttgaggtgc aggacaatat tcgtgcgact gcgctggttc 1560

ctaatttcca cgcatccacc gaagctgtgc gccgagtcct tcccactgaa gtcactcaca 1620

tcgatgcgcg atttaacgtg tcccgcgttg cagtgatgat cgttgcgttg cagcagcgtc 1680

ctgatttgct gtgggagggt actcgtgacc gtctgcacca gccttatcgt gcagaagtgt 1740

tgcctattac ctctgagtgg gtaaaccgcc tgcgcaaccg tggctacgcg gcataccttt 1800

ccggtgccgg cccaaccgcc atggtgctgt ccactgagcc aattccagac aaggttttgg 1860

aagatgctcg tgagtctggc attaaggtgc ttgagcttga ggttgcggga ccagtcaagg 1920

ttgaagttaa ccaaccttag gcccaacaag gaaggccccc ttcgaatcaa gaagggggcc 1980

ttattagtgc agcaattatt2000

<210>8

<211>2000

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

tcatttcagc agcgggtgga attttttaaa aggagcgttt aaaggctgtg gccgaacaag 60

ttaaattgag cgtggagttg atagcgtgca gttcttttac tccacccgct gatgttgagt 120

ggtcaactga tgttgagggc gcggaagcac tcgtcgagtt tgcgggtcgt gcctgctacg 180

aaacttttga taagccgaac cctcgaactg cttccaatgc tgcgtatctg cgccacatca 240

tggaagtggg gcacactgct ttgcttgagc atgccaatgc cacgatgtat atccgaggca 300

tttctcggtc cgcgacccat gaattggtcc gacaccgcca tttttccttc tctcaactgt 360

ctcagcgttt cgtgcacagc ggagaatcgg aagtagtggt gcccactctc atcgatgaag 420

atccgcagtt gcgtgaactt ttcatgcacg ccatggatga gtctcggttc gctttcaatg 480

agctgcttaa tgcgctggaa gaaaaacttg gcgatgaacc gaatgcactt ttaaggaaaa 540

agcaggctcg tcaagcagct cgcgctgtgc tgcccaacgc tacagagtcc agaatcgtgg 600

tgtctggaaa cttccgcacc tggaggcatt tcattggcat gcgagccagt gaacatgcag 660

acgtcgaaat ccgcgaagta gcggtagaat gtttaagaaa gctgcaggta gcagcgccaa 720

ctgttttcgg tgattttgag attgaaactt tggcagacgg atcgcaaatg gcaacaagcc 780

cgtatgtcat ggacttttaa cgcaaagctc acacccacga gctaaaaatt catatagtta 840

agacaacatt tttggctgta aaagacagcc gtaaaaacct cttgctcgtg tcaattgttc 900

ttatcggaat gtggcttggg cgattgttat gcaaaagttg ttaggttttt tgcggggttg 960

tttaaccccc aaatgaggga agaaggtaac cttgaactct atatgaatga ttcccgaaat 1020

cgcggccgga aggttacccg caaggcgggc ccaccagaag ctggtcagga aaaccatctg 1080

gatacccctg tctttcaggc accagatgct tcctctaacc agagcgctgt aaaagctgag 1140

accgccggaa acgacaatcg ggatgctgcg caaggtgctc aaggatccca agattctcag 1200

ggttcccaga acgctcaagg ttcccagaac cgcgagtccg gaaacaacaa ccgcaaccgt 1260

tccaacaaca accgtcgcgg tggtcgtgga cgtcgtggat ccggaaacgc caatgagggc 1320

gcgaacaaca acagcggtaa ccagaaccgt cagggcggaa accgtggcaa ccgcggtggc 1380

ggacgccgaa acgttgttaa gtcgatgcag ggtgcggatc tgacccagcg cctgccagag 1440

ccaccaaagg caccggcaaa cggtctgcgt atttacgcac ttggtggcat ttccgaaatc 1500

ggtcgcaaca tgaccgtgtt tgagtacaac aaccgtctgc tcatcgtgga ctgtggtgtg 1560

ctcttcccat cttcaggtga gccaggcgtt gacctgattc ttcctgactt cggcccaatt 1620

gaggatcacc tgcaccgcgt cgatgcattg gtggttactc acggacacga agaccacatt 1680

ggtgctattc cctggctgct gaagctgcgc aacgatatcc caatcttggc atcccgtttc 1740

accttggctc tgattgcagc taagtgtaag gaacaccgtc agcgtccgaa gctgatcgag 1800

gtcaacgagc agtccaatga ggaccgcgga ccgttcaaca ttcgcttctg ggctgttaac 1860

cactccatcc cagactgcct tggtcttgct atcaagactc ctgctggttt ggtcatccac 1920

accggtgaca tcaagctgga tcagactcct cctgatggac gcccaactga cctgcctgca 1980

ttgtcccgtt tcggtgacga 2000

<210>9

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

ctgcgacgac tggaaaacca 20

<210>10

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

ggctggaccc tagaattcgg 20

<210>11

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

ttaagaagtc gaccgcgtga 20

<210>12

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

aataattgct gcactaataa 20

<210>13

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

tcatttcagc agcgggtgga 20

<210>14

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

tcgtcaccga aacgggacaa 20

<210>15

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

atgaacgcta ccaccgagcc 20

<210>16

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

ttacagtggc ttctggtcgt 20

Claims (10)

1. A recombinant Corynebacterium glutamicum, which uses a wild-type Corynebacterium glutamicum as a starting strain, and which has:

a phosphoenolpyruvate carboxylase, a homoserine dehydrogenase and a dihydropyrimidinedicarboxylic acid synthetase that are expressed at reduced levels compared to the starting strain;

a gene expression cassette for expressing phosphoenolpyruvate carboxylase; and

a gene expression cassette for expressing the enzyme ectoA, the enzyme ectoB and the enzyme ectoC.

2. The recombinant Corynebacterium glutamicum of claim 1, wherein the expression levels of phosphoenolpyruvate carboxylase, homoserine dehydrogenase and dihydropyrimidinedicarboxylate synthase are decreased by knocking out phosphoenolpyruvate carboxylase gene pck, homoserine dehydrogenase gene hom and dihydropyrimidinedicarboxylate synthase gene dapA in the starting strain.

3. The recombinant Corynebacterium glutamicum of claim 1 or 2, wherein the gene expression cassette for expressing phosphoenolpyruvate carboxylase has the phosphoenolpyruvate carboxylase gene ppc represented by SEQ ID No. 2; preferably, the phosphoenolpyruvate carboxylase gene pck in the starting strain is replaced with the phosphoenolpyruvate carboxylase gene ppc.

4. The recombinant Corynebacterium glutamicum of any one of claims 1 to 3, wherein the gene expression cassette for expressing ectA, ectB, and ectC enzymes comprises a promoter tac, a gene encoding ectA, ectB, and ectC enzymes, and a terminator rrnB; preferably, the gene encoding ectoA, ectoB and ectoC is the gene of ectoABC; further preferably, the ectABC gene is shown by SEQ ID NO. 5.

5. A method of constructing the recombinant Corynebacterium glutamicum of any one of claims 1-4, comprising: the recombinant corynebacterium glutamicum is obtained by taking a wild corynebacterium glutamicum as an initial strain, reducing the expression levels of phosphoenolpyruvate carboxylase, homoserine dehydrogenase and dihydropyrimidinedicarboxylic acid synthase in the wild corynebacterium glutamicum, and introducing a gene expression cassette for expressing the phosphoenolpyruvate carboxylase and a gene expression cassette for expressing ectA enzyme, ectB enzyme and ectC enzyme into the initial strain.

6. The method of claim 5, wherein the expression levels of phosphoenolpyruvate carboxylase, homoserine dehydrogenase and dihydropyrimidinedicarboxylate synthase are reduced by knocking out phosphoenolpyruvate carboxylase gene pck, homoserine dehydrogenase gene hom and dihydropyrimidinedicarboxylate synthase gene dapA in the starting strain.

7. The method of claim 5 or 6, wherein the gene expression cassette for expressing phosphoenolpyruvate carboxylase has the phosphoenolpyruvate carboxylase gene ppc represented by SEQ ID No. 2; preferably, the phosphoenolpyruvate carboxylase gene pck in the starting strain is replaced with the phosphoenolpyruvate carboxylase gene ppc; and/or

The gene expression cassette for expressing the ectA enzyme, the ectB enzyme and the ectC enzyme is provided with a promoter tac, a gene for coding the ectA enzyme, the ectB enzyme and the ectC enzyme and a terminator rrnB; preferably, the gene encoding ectoA, ectoB and ectoC is the gene of ectoABC; it is further preferred that the ectABC gene is represented by SEQ ID No. 5.

8. The method according to any one of claims 5-7, comprising the steps of:

1) connecting a polynucleotide sequence for replacing pck gene with ppc gene to a corynebacterium glutamicum suicide plasmid to obtain a recombinant plasmid, and introducing the recombinant plasmid into the corynebacterium glutamicum to obtain a recombinant bacterium C.glutamcum-delta pck-ppc;

2) connecting a polynucleotide sequence for knocking out the hom gene to a corynebacterium glutamicum suicide plasmid to obtain a recombinant plasmid, and introducing the recombinant plasmid into the recombinant bacterium C.glutamicum-delta pck-ppc obtained in the step 1) to obtain a recombinant bacterium C.glutamicum-delta hom-delta pck-ppc;

3) connecting a polynucleotide sequence for knocking out the dapA gene to a corynebacterium glutamicum suicide plasmid to obtain a recombinant plasmid, and introducing the recombinant plasmid into the recombinant bacterium C.glutamicum-delta hom-delta pck-ppc obtained in the step 2) to obtain the recombinant bacterium C.glutamicum-delta dapA-delta hom-delta pck-ppc; and

4) connecting the optimized polynucleotide sequence for expressing the ectABC gene to an expression plasmid of Corynebacterium glutamicum according to the codon preference of the Corynebacterium glutamicum to obtain a recombinant plasmid, and introducing the recombinant plasmid into the recombinant bacterium C.glutamicum-delta dapA-delta hom-delta pck-ppc obtained in the step 3) to obtain the recombinant Corynebacterium glutamicum C.glutamicum-delta dapA-delta hom-delta pck-ppc-ectABC.

9. Use of the recombinant corynebacterium glutamicum of any one of claims 1 to 4, or constructed by the method of any one of claims 5 to 8, for the production of tetrahydropyrimidine.

10. A method of producing tetrahydropyrimidine, the method comprising: fermenting the recombinant corynebacterium glutamicum of any one of claims 1-4 or constructed by the method of any one of claims 5-8, thereby obtaining tetrahydropyrimidine.

Images