CN114874959A

CN114874959A - Genetically engineered bacterium for producing L-theanine by using glucose from head fermentation, method and application

Info

Publication number: CN114874959A
Application number: CN202210448905.XA
Authority: CN
Inventors: 范晓光; 季圆清; 温昊妍; 周宇航; 徐庆阳
Original assignee: Tianjin University of Science and Technology
Current assignee: Tianjin University of Science and Technology
Priority date: 2022-04-27
Filing date: 2022-04-27
Publication date: 2022-08-09
Anticipated expiration: 2042-04-27
Also published as: CN114874959B

Abstract

The invention discloses a genetically engineered strain for producing L-theanine by fermenting from head with glucose, which contains gamma-glutamyl methylamine synthetase for theanine synthesis and a gene for coding the enzyme of the theanine from head synthesis pathway, wherein the enzyme of the theanine from head synthesis pathway comprises phosphoketolase, transaminase, acetaldehyde dehydrogenase and alanine dehydrogenase. The invention constructs a complete anabolism path from glucose to theanine, obtains a genetic engineering strain which does not carry plasmids, does not need to add ethylamine and can stably produce theanine by utilizing glucose, after the strain is fermented for 33 hours, the yield of the theanine can reach 46g/L, the conversion rate can reach 0.16g of theanine/g of glucose, the production intensity can reach 1.4g of theanine/L/h, the strain is the highest yield, the conversion rate and the production intensity of the theanine produced by directly utilizing the glucose through de novo fermentation without adding ethylamine reported at present, and has good industrial application prospect.

Description

Genetically engineered bacterium for producing L-theanine by using glucose from head fermentation, method and application

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a genetic engineering bacterium for producing L-theanine by using glucose from head fermentation, a method and application thereof.

Background

L-theanine (hereinafter referred to as theanine) is a special amino acid existing in tea plant, and has many beneficial effects on human health, such as relieving stress, improving sleep quality, resisting oxidation, regulating neurotransmitter transmission, inhibiting hypertension, resisting tumor, improving memory, etc. Theanine has high market acceptance as a natural sedative and an antidepressant in Japan and America, and forms hundreds of functional foods, beverages and health care products. In 2014, tea theanine (theanine prepared by taking tea as a raw material and performing extraction, filtration, concentration and other processes) is approved as a new food raw material in China, but the tea theanine obtained by a plant extraction method has low yield and high cost, and cannot meet the increasing market demand.

At present, food-grade theanine is obtained by a microbial synthesis method. According to the report, theanine can be prepared by a pure enzyme catalysis method, and the biological synthesis of the theanine can be realized by coupling gamma-glutamyl methylamine synthetase with an ATP regeneration system, wherein the highest yield can reach 600 mM. However, the enzyme catalysis method has many problems, such as complex catalysis system, expensive substrate, stepwise enzyme preparation and enzyme reaction, high equipment occupancy rate, and the like, so the production cost is obviously higher than that of the chemical method. Although the use cost of the enzyme can be reduced by using the immobilization method, the immobilization of an enzyme catalytic system including an ATP regeneration system is difficult and cannot be easily scaled up to an industrial scale. Therefore, compared with an enzyme catalysis method, the microbial fermentation method has the advantages of simple route, low price of culture medium raw materials, low equipment occupancy rate and the like, and is widely used for the industrial production of theanine. According to the report, recombinant Escherichia coli can be used for producing theanine by fermentation, substrates of ethylamine and glucose are added continuously in the culture process, and 75g/L theanine can be accumulated after 20 hours of fermentation.

Although sufficient ethylamine is supplemented in the fermentation process to effectively produce theanine, the ethylamine has cytotoxicity, the boiling point of 16.6 ℃, is not good for human health after gasification and harmful to the external environment, and therefore special equipment is needed for supplementing the ethylamine. In addition, ethylamine which is not completely metabolized is accumulated in a large amount outside cells, so that the growth of thalli is limited, ATP regeneration is weakened, and the synthesis of theanine is inhibited. In order to reduce the danger of ethylamine in the using process, the method for preparing theanine by directly utilizing glucose through de novo fermentation is an effective solution, and how to construct an endogenous synthetic pathway of ethylamine in production bacteria is a technical problem which needs to be solved at present.

By comparison, the following patent publications are found in connection with the present patent application:

1. a genetically engineered bacterium for L-theanine production and construction and application thereof (CN109777763B), in particular to a novel high-efficiency gamma-glutamyl methylamine synthetase, a plasmid-free genetically engineered bacterium for L-theanine production and a construction method and application thereof. The invention provides a gene engineering bacterium without plasmid and for efficiently synthesizing L-theanine by taking cheap carbon sources such as glucose and the like as substrates, which takes escherichia coli as a host and integrates three copies of a gamma-glutamyl methylamine synthetase gene gmas-Mu on the genome; a single copy of the glutamate dehydrogenase gene Cgl 2079; single copy pyruvate carboxylase gene Cgl 0689; a single copy of the citrate synthase gene gltA. After the system metabolism is modified, the engineering bacteria can synthesize the L-theanine by taking glucose as a raw material in a fed-batch ethylamine fermentation mode, the fermentation yield and the sugar-acid conversion rate are the highest values reported in the prior art, the highest yield of the L-theanine in the fermentation of a 5L fermentation tank can reach 60g/L, and the sugar-acid conversion rate can reach 40%.

2. An escherichia coli genetically engineered bacterium and a method (CN113774075A) for producing L-theanine by fermentation thereof, in particular to a method for producing L-theanine by fermentation of the escherichia coli genetically engineered bacterium. The engineering bacteria are obtained by taking a strain obtained by knocking xylR out and knocking sucCD out on a single-copy T7RNAP and double-copy gmas on a genome of Escherichia coli W3110 as a starting strain, integrating xfp, pta, acs, gltA and ppc on the genome, and knocking ackA out. The OD-linked ethylamine supplementation strategy is adopted, cheap carbon sources such as glucose and the like are used as substrates to efficiently synthesize the L-theanine, the saccharic acid conversion rate is high, the production performance is stable, the yield of the L-theanine can reach 75-80g/L after 20-25h, and the saccharic acid conversion rate reaches 52-55%. The fermentation liquor is purified by adopting a membrane separation combined anion-cation resin series technology, the yield of primary crystallization is 72.3 percent, and the purity of the L-theanine finished product reaches 99 percent.

3. A method (CN110564789A) for producing L-theanine by using escherichia coli fermentation is characterized in that in the fermentation culture process, when escherichia coli in a fermentation tank is cultured until OD is 20-30, D-xylose is added into the fermentation tank to enable the concentration of the D-xylose to be 5-20 g/L, and the temperature is adjusted to 28-35 ℃ for induction for 4-5 hours; then, supplementing 40-80% by volume of ethylamine solution at a constant flow rate of 100-300: 1 of the volume ratio of the fermentation liquid to the ethylamine solution, and continuously performing fermentation culture for 20-30h under the conditions of pH 6.5-7.5, temperature 35-40 ℃ and dissolved oxygen content of 10-40% to synthesize the L-theanine. The fermentation period is short, the acid production efficiency is high, and the thallus density is high; the substrate conversion rate is high; and the process is simple, the environmental pollution is low, the production cost of the L-theanine is reduced, and the popularization and the application of industrial production are facilitated.

By contrast, the present patent application is substantially different from the above patent publications.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provides a genetically engineered bacterium for producing L-theanine by fermenting glucose from head, a method and application.

The technical scheme adopted by the invention for solving the technical problems is as follows:

a genetically engineered bacterium for producing L-theanine by fermentation of glucose from the head, the genetically engineered strain containing a gamma-glutamylmethylamine synthase for theanine synthesis and a gene encoding an enzyme of the de novo theanine synthesis pathway including phosphoketolase, transaminase, acetaldehyde dehydrogenase, alanine dehydrogenase.

Further, the genetic engineering strain takes escherichia coli or corynebacterium glutamicum as an initial strain;

alternatively, the gene encoding gamma-glutamyl methylamine synthetase is derived from Paracoccus aminovorans;

or, the genes encoding phosphoketolase, transaminase, acetaldehyde dehydrogenase and alanine dehydrogenase are respectively derived from Bifidobacterium adolescentis, Pseudomonas putida, Escherichia coli E.coli and Bacillus sphaericus;

alternatively, the gene encoding the enzyme of the de novo theanine pathway consists of P _T7 Or P _trc Promoter initiation;

alternatively, the genes encoding the theanine de novo pathway enzymes are integrated into the ycgH, ycnI, fhiA, ygaY gene sites of E.coli, respectively.

Further, the genetic engineering strain takes E.coli ATCC27325 or C.glutamicum ATCC13032 as an initial strain;

the gene for coding gamma-glutamyl methylamine synthetase consists of P _T7 Promoter initiation;

alternatively, the gene encoding gamma-glutamyl methylamine synthetase is integrated into the yeeP gene locus of escherichia coli.

Further, the genetically engineered strain contains the genes of gmas, xfp, spuC, eutE and alD.

Further, the genes gmas, xfp, spuC, eutE and alD are wild-type genes, or are mutants or artificially modified genes encoding corresponding proteins, including substitution, deletion or insertion of one or more amino acid residues at one or more sites, and the proteins encoded by the mutants or the artificially modified genes have corresponding activities and are not functionally deficient.

The construction method of the genetic engineering bacteria comprises the following steps:

(1) integrating a gmas gene in the genome of the starting strain;

in one embodiment, the method of construction further comprises optionally one or more of the following steps:

(2) integrating theanine de novo synthesis pathway enzyme genes including gmas, xfp, spuC, eutE and alD;

in one embodiment, the construction method comprises the steps of:

(1) incorporating the gene gmas coding for gamma-glutamyl methylamine synthetase and consisting of P _T7 Promoter initiation;

(2) integration of Gene xfp encoding phosphoketolase and expression of P _T7 Promoter initiation;

(3) integration of the gene spuC coding for the transaminase and from P _trc Promoter initiation;

(4) integration of the Gene eutE encoding acetaldehyde dehydrogenase and from P _trc Promoter initiation;

(5) the gene alD coding for alanine dehydrogenase was integrated and encoded by P _trc Promoter initiation;

the order of operations of steps (1) to (5) in the above-described construction method is not limited and can be performed in any order that can be implemented by those skilled in the art. It is preferable to adopt a manner in which the steps (1) to (5) are sequentially performed.

Integration of the gene is accomplished by any method known in the art, such as techniques of homologous recombination, overlapping PCR, mutagenic screening, or gene editing.

Further, the construction method comprises gene integration by using CRISPR/Cas9 mediated gene editing technology;

or the construction method comprises the steps of constructing a recombinant fragment and a pGRB plasmid, simultaneously transforming the pGRB plasmid and the recombinant fragment into an electrotransformation competent cell containing pREDCas9, and eliminating the plasmid to obtain the recombinant genetic engineering strain.

Further, the construction of the pGRB plasmid includes: designing a target sequence, preparing a DNA fragment containing the target sequence, and recombining the DNA fragment containing the target sequence with the linearized vector fragment; preferably, the target sequence is 5 '-NGG-3'.

The construction recombinant fragment comprises a construction gene integrated recombinant fragment or a construction gene knockout recombinant fragment; wherein the step of constructing a gene-integrated recombinant fragment comprises: the genome of the original strain is taken as a template, upstream and downstream homologous arm primers are designed according to upstream and downstream sequences of a target gene quasi-insertion site, a target gene fragment is amplified according to the target genome design primers, and a recombinant fragment is obtained by a PCR overlapping technology.

The application of the genetically engineered bacteria in the aspect of fermentation production of theanine.

The method for producing theanine by fermentation of the genetically engineered bacteria comprises the following steps: contacting the genetic engineering strain with a fermentation culture medium, and performing fermentation culture to prepare the theanine.

Further, the fermentation culture comprises shake flask fermentation or fermenter fermentation;

when in shake flask fermentation, the inoculum size of the genetic engineering strain is 15-20%, the fermentation condition is 37 ℃, shaking culture is carried out at 220r/min, the pH is maintained at 6.7-7.2 in the fermentation process, the pH is adjusted by supplementing ammonia water, and fermentation is carried out for 26-30h, thus obtaining the product. Glucose solution can be supplemented in the fermentation process to maintain the fermentation, and the glucose solution preferably has a mass volume concentration of 60% (m/v). In the present invention, the amount of the glucose solution to be added is not particularly limited, and the glucose concentration in the fermentation broth can be maintained at 5g/L or less.

The shake flask fermentation was performed in a 500mL Erlenmeyer flask. When the shake flask is used for fermentation for 26-30h, the concentration of the theanine in the fermentation liquor can reach 6-10 g/L.

When a fermentation tank is used for fermentation, the inoculation amount of the genetic engineering strain is 15-20%, the fermentation temperature is 37 ℃, the dissolved oxygen is 35-45%, the pH is controlled to be 7.0-7.2 stably in the fermentation process, and the pH is adjusted by supplementing ammonia water; after the glucose in the culture medium is consumed, feeding a glucose solution with the mass volume concentration of 80% (m/v), maintaining the glucose concentration in the fermentation culture medium below 1g/L, and fermenting for 30-33h to obtain the final product.

The fermentation of the fermentation tank adopts a 5L fermentation tank for fermentation. After fermentation is carried out in a 5L fermentation tank for 30-33h, the yield of theanine reaches 40-46g/L, the conversion rate reaches 0.14-0.16g theanine/g glucose, and the production intensity reaches 1.3-1.4g theanine/L/h.

The present invention can be fermented using an E.coli fermentation medium known in the art.

Or the fermentation medium for shake flask fermentation consists of: 10-40g/L of glucose, 3-4g/L of yeast powder, 4-6g/L of peptone, 1-2g/L of sodium citrate, 3-6g/L of monopotassium phosphate, 1-2g/L of magnesium sulfate, 15-20mg/L of ferrous sulfate, 15-20mg/L of manganese sulfate and VB ₁ 、VB ₃ 、VB ₅ 、VB ₁₂ 、V _H 1-3mg/L of each, the balance of water, and the pH value of 7.0-7.2;

or the fermentation medium during fermentation in the fermentation tank comprises the following components: 10-40g/L of glucose, 2-8g/L of yeast powder, 0.2-2.0g/L of citric acid, 0.5-3.2g/L of monopotassium phosphate, 0.5-2.4g/L of dipotassium phosphate, 0.2-1.2g/L of magnesium sulfate, 0.1-1.0g/L of methionine, 0.2-20mg/L of ferrous sulfate, 1-10mg/L of manganese sulfate, 2-20ml/L of corn steep liquor, and the balance of water and pH 7.0-7.2.

The invention has the advantages and positive effects that:

1. according to the invention, wild type escherichia coli with clear genetic background can be selected as a starting strain, and a complete anabolism path from glucose to theanine is constructed through a reasonable metabolic engineering strategy to obtain a genetic engineering strain which does not carry plasmids, does not need to add ethylamine and can stably produce theanine by utilizing glucose.

2. The present invention uses acetaldehyde dehydrogenase and transaminase to construct acetyl-CoA to ethylamine metabolic pathway. Since transaminases require alanine as an amino donor, alanine recycling is achieved using alanine dehydrogenase (FIG. 1). The successful construction of the ethylamine synthesis way enables the engineering strain to directly utilize glucose for fermentation production of theanine without exogenous addition of ethylamine, avoids the damage of ethylamine to human bodies and the pollution to the environment in the fermentation process, reduces the equipment occupancy rate, simplifies the fermentation process, and saves the raw material cost.

3. acetyl-CoA is a common precursor for formation of ethylamine and glutamic acid, and increasing the supply of acetyl-CoA helps balance metabolic fluxes of ethylamine and glutamic acid, thereby increasing the synthesis of theanine. Pyruvate dehydrogenase in colibacillus catalyzes pyruvic acid to form acetyl coenzyme A and is accompanied by CO ₂ It is produced, a major pathway for acetyl-coa synthesis. The invention uses heterologous phosphoketolase to catalyze the ketolysis reaction of fructose-6-phosphate and xylulose-5-phosphate, promotes the formation of acetyl phosphate, and the acetyl phosphate is further metabolized to form acetyl coenzyme A, thereby constructing another path for synthesizing the acetyl coenzyme A (figure 1), and the path does not have CO ₂ Thereby avoiding carbon loss.

4. After the gene engineering bacteria for producing theanine are fermented for 33 hours in a 5L fermentation tank, the yield of the theanine can reach 46g/L, the conversion rate can reach 0.16g of theanine/g of glucose, the production intensity can reach 1.4g of theanine/L/h, the bacteria are the highest yield, the conversion rate and the production intensity of the theanine produced by directly fermenting glucose from head without adding ethylamine reported at present, and have good industrial application prospect.

Drawings

Fig. 1 is a schematic diagram of a strategy for metabolic engineering of genetically engineered bacterium e.coli E5 according to the present invention;

FIG. 2 is a diagram of construction and validation electrophoresis of the integrated fragment of the gmas gene of the present invention; wherein: m: 1kb DNA marker; 1: an upstream homology arm; 2: a target fragment; 3: a downstream homology arm; 4: overlapping segments; 5: original bacteria control; 6: positive bacteria identification fragments;

FIG. 3 is an electrophoretogram for construction and validation of xfp gene integration fragment in the present invention; wherein: m: 1kb DNA marker; 1: an upstream homology arm; 2: a target fragment; 3: a downstream homology arm; 4: overlapping segments; 5: original bacteria control; 6: positive bacteria identification fragments;

FIG. 4 is a construction and verification electrophoretogram of integrated fragment of spuC gene in the present invention; wherein: m: 1kb DNA marker; 1: an upstream homology arm; 2: a target fragment; 3: a downstream homology arm; 4: overlapping segments; 5: original bacteria control; 6: positive bacteria identification fragments;

FIG. 5 is an electrophoretogram for constructing and verifying an integrated fragment of the eutE gene of the present invention; wherein: m: 1kb DNA marker; 1: an upstream homology arm; 2: a target fragment; 3: a downstream homology arm; 4: overlapping segments; 5: original bacteria control; 6: positive bacteria identification fragments;

FIG. 6 is an electrophoretogram showing construction and confirmation of alD gene integration fragment in the present invention; wherein: m: 1kb DNA marker; 1: an upstream homology arm; 2: a target fragment; 3: a downstream homology arm; 4: overlapping segments; 5: original bacteria control; 6: positive bacteria identification fragments;

fig. 7 is a graph of the fermentation process of the strain e.coli E5 of the present invention fed-batch in a 5L fermenter.

Detailed Description

The following detailed description of the embodiments of the present invention is provided for the purpose of illustration and not limitation, and should not be construed as limiting the scope of the invention.

The raw materials used in the invention are conventional commercial products unless otherwise specified; the methods used in the present invention are conventional in the art unless otherwise specified.

A genetically engineered bacterium for producing L-theanine by fermentation from the head using glucose, said genetically engineered strain containing a gamma-glutamylmethylamine synthase for theanine synthesis and a gene encoding an enzyme of the theanine de novo synthesis pathway including phosphoketolase, transaminase, acetaldehyde dehydrogenase, alanine dehydrogenase.

Preferably, the genetic engineering strain takes escherichia coli or corynebacterium glutamicum as an initial strain;

alternatively, the encoded theanine is synthesized de novoThe genes of pathway-forming enzymes are composed of P _T7 Or P _trc Promoter initiation;

Preferably, the genetic engineering strain takes E.coli ATCC27325 or C.glutamicum ATCC13032 as an initial strain;

Preferably, the genetic engineering strain contains genes of gmas, xfp, spuC, eutE and alD, and the gene sequences are SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5 in sequence.

Preferably, the genes gmas, xfp, spuC, eutE and alD are wild-type genes, or are mutants or artificially modified genes encoding corresponding proteins, including substitution, deletion or insertion of one or more amino acid residues at one or more sites, and the proteins encoded by the mutants or artificially modified genes have corresponding activities and are not functionally deficient.

These genes are registered in GenBank and can be obtained by PCR by those skilled in the art. As an example, the gmas gene is GenBank: SFH87749, the xfp gene is GenBank: MN081868, the spuC gene is GenBank: AAN70747, the eutE gene is GenBank: UJY49218, and the alD gene is GenBank: AAA 22210.

(3) integrating a gmas gene in the genome of the starting strain;

(4) integrating theanine de novo synthesis pathway enzyme genes including gmas, xfp, spuC, eutE and alD;

in one embodiment, the construction method comprises the steps of:

(6) incorporating the gene gmas coding for gamma-glutamyl methylamine synthetase and consisting of P _T7 Promoter initiation;

(7) integration of Gene xfp encoding phosphoketolase and expression of P _T7 Promoter initiation;

(8) integration of the transaminase-encoding gene spuC from P _trc Promoter initiation;

(9) integration of the Gene eutE encoding acetaldehyde dehydrogenase and from P _trc Promoter initiation;

(10) the gene alD coding for alanine dehydrogenase was integrated and encoded by P _trc Promoter initiation;

the order of operations of steps (1) to (5) in the above-described construction method is not limited and can be performed in any order that can be implemented by those skilled in the art. It is preferable to adopt a manner in which the steps (1) to (5) are sequentially performed. As shown in fig. 1.

Preferably, the construction method comprises gene integration by using CRISPR/Cas9 mediated gene editing technology;

Preferably, the construction of the pGRB plasmid comprises: designing a target sequence, preparing a DNA fragment containing the target sequence, and recombining the DNA fragment containing the target sequence with the linearized vector fragment; preferably, the target sequence is 5 '-NGG-3'.

The method for producing theanine by fermentation of the genetically engineered bacteria comprises the following steps: and contacting the genetically engineered strain with a fermentation culture medium, and performing fermentation culture to prepare the theanine.

Preferably, the fermentation culture comprises a shake flask fermentation or a fermentor fermentation;

The shake flask fermentation is performed in a 500mL triangular flask. When the shake flask is used for fermentation for 26-30h, the concentration of the theanine in the fermentation liquor can reach 6-10 g/L.

When the fermentation is carried out in a fermentation tank, the inoculation amount of the genetic engineering strain is 15-20%, the fermentation temperature is 37 ℃, the dissolved oxygen is 35-45%, the pH is controlled to be stable at 7.0-7.2 in the fermentation process, and the pH is adjusted by supplementing ammonia water; after the glucose in the culture medium is consumed, feeding a glucose solution with the mass volume concentration of 80% (m/v), maintaining the glucose concentration in the fermentation culture medium below 1g/L, and fermenting for 30-33h to obtain the final product.

The fermentation of the fermentation tank adopts a 5L fermentation tank for fermentation. After fermentation for 30-33h in a 5L fermentation tank, the yield of theanine reaches 40-46g/L, the conversion rate reaches 0.14-0.16g theanine/g glucose, and the production intensity reaches 1.3-1.4g theanine/L/h.

Or the fermentation medium for shake flask fermentation consists of: glucose 10-40g/L, 3-4g/L of yeast powder, 4-6g/L of peptone, 1-2g/L of sodium citrate, 3-6g/L of monopotassium phosphate, 1-2g/L of magnesium sulfate, 15-20mg/L of ferrous sulfate, 15-20mg/L of manganese sulfate and VB ₁ 、VB ₃ 、VB ₅ 、VB ₁₂ 、V _H 1-3mg/L of each, the balance of water, and the pH value of 7.0-7.2;

or the fermentation medium during fermentation in the fermentation tank comprises the following components: 10-40g/L of glucose, 2-8g/L of yeast powder, 0.2-2.0g/L of citric acid, 0.5-3.2g/L of monopotassium phosphate, 0.5-2.4g/L of dipotassium phosphate, 0.2-1.2g/L of magnesium sulfate, 0.1-1.0g/L of methionine, 0.2-20mg/L of ferrous sulfate, 1-10mg/L of manganese sulfate, 2-20ml/L of corn steep liquor, the balance of water and the pH value of 7.0-7.2.

Specifically, the preparation and detection examples are as follows:

example 1: construction of genetically engineered bacterium E.coli E5

1. Method for gene editing

The invention is carried out by using CRISPR/Cas9 mediated gene editing method reference (Metabolic Engineering,2015,31:13-21.) and the two plasmids used in the method are pGRB and pREDCas9 respectively. Wherein pREDCas9 carries a gRNA plasmid elimination system, a Red recombination system of lambda phage and a Cas9 protein expression system, spectinomycin resistance (working concentration: 100mg/L), and is cultured at 32 ℃; pGRB plasmid, comprising a promoter J23100, a gRNA-Cas9 binding region sequence and a terminator sequence, ampicillin resistance (working concentration: 100mg/L), cultured at 37 ℃ with pUC18 as a backbone.

The method comprises the following specific steps:

1.1 pGRB plasmid construction

The plasmid pGRB is constructed for the purpose of transcribing the corresponding gRNA to form a complex with the Cas9 protein, and recognizing a target site of a target gene through base pairing and PAM, thereby realizing double strand break of the target DNA. pGRB plasmids are constructed by recombination of DNA fragments containing the target sequence with linearized vector fragments.

1.1.1 target sequence design

The target sequence (PAM:5 '-NGG-3') was designed using CRISPR RGEN Tools as follows:

yeeP target sequence: ACTGCAGGACGAGCTGCGCACGG

ycgH target sequence: AGTGTCAGAGGCTATAGCGCAGG

ycnI target sequence: GAACGAAAATGGTGTTGTACTGG

fhiA target sequence: TACTTTCATGGCTGGCGATCTGG

ygaY target sequence: CTCAACTACCCACAGTTGTTGGG

1.1.2 preparation of DNA fragments containing the target sequence

Designing a primer: 5 '-linearized vector end sequence (15bp) -cleavage site-target sequence (excluding PAM sequence) -linearized vector end sequence (15bp) -3' and its reverse complementary primer (pGRB identification primer: pGRB-Test-S: GTCTCATGAGCGGATACATATTTG; pGRB-Test-A: ATGAGAAAGCGCCACGCT), and a DNA fragment containing the target sequence was prepared by annealing of single-stranded DNA. Reaction conditions are as follows: pre-denaturation at 95 deg.C for 5 min; annealing at 50 deg.C for 1 min; keeping the temperature at 4 ℃. The annealing system is as follows in table 1:

TABLE 1 annealing System

1.1.3 preparation of Linear vectors

The linearization of the vector adopts a reverse PCR amplification method.

1.1.4 recombination reactions

The recombination system is shown in Table 2 below. All the recombinases are II One Step Cloning Kit series enzymes, and the recombination conditions are as follows: 30min at 37 ℃.

TABLE 2 recombination System

1.1.5 transformation of plasmids

Adding 20 μ L of the above reaction solution, which is the liquid after plasmid recombination reaction, into 100mLDH5 alpha-transformation competent cells, gently mixing, ice-bathing for 20min, heat-shocking for 42s at 42 deg.C, immediately ice-bathing for 2-3min, adding 900 μ L of SOC, and resuscitating at 37 deg.C for 1 h. The cells were centrifuged at 8000rpm for 2min, and the supernatant was discarded to leave about 200. mu.L, resuspended, and applied to a plate containing 100mg/L ampicillin, and the plate was inverted and incubated overnight at 37 ℃. And (4) after the single bacterium grows out from the plate, carrying out colony PCR identification, and selecting a positive recon.

1.2 preparation of recombinant DNA fragments

The recombination segment for knockout consists of an upstream homology arm and a downstream homology arm of a gene to be knocked out (upstream homology arm-downstream homology arm); the recombinant fragment used for integration consists of the upstream and downstream homology arms of the integration site and the gene fragment to be integrated (upstream homology arm-target gene-downstream homology arm). Designing an upstream and downstream homologous arm primer (the amplification length is about 300-500bp) by using a primer design software Oligo 7 and taking an upstream and downstream sequence of a gene to be knocked out or a site to be integrated as a template; the gene to be integrated is used as a template, and an amplification primer of the integrated gene is designed. Respectively amplifying upstream and downstream homologous arms and target gene fragments by a PCR method, and preparing recombinant fragments by overlapping PCR. The PCR system and method are shown in table 3 below:

TABLE 3 PCR amplification System

The system of overlapping PCR is shown in Table 4 below:

TABLE 4 overlapping PCR amplification System

PCR conditions (Protoid physicians PrimeSTAR HS DNA Polymerase): pre-denaturation (95 ℃) for 5 min; denaturation (98 ℃) for 10s, annealing (60 ℃) for 15s, extension at 72 ℃ and circulation for 30 times; continuing to extend for 10min at 72 ℃; the temperature was maintained (4 ℃).

1.3 transformation of plasmids and recombinant DNA fragments

1.3.1 transformation of pREDCas9

The pREDCas9 plasmid was electroporated into W3110 by electroporation, and after recovery culture, the cells were plated on LB plates containing spectinomycin and cultured overnight at 32 ℃. And (3) growing a single colony on the resistant plate, carrying out colony PCR by using an identification primer, and screening positive recombinants.

1.3.2 electrotransformation-competent preparation of the Strain of interest containing pREDCas9

Culturing at 32 ℃ to OD ₆₀₀ When the concentration is 0.1mM, IPTG is added to the medium to a final concentration of 0.1mM, and the culture is continued until OD is reached ₆₀₀ The competent preparation is carried out at 0.2-0.3. The purpose of the addition of IPTG was to induce expression of the recombinase on the pREDCas9 plasmid. The culture medium required by the competent preparation and the preparation process refer to the conventional standard operation.

1.3.3 transformation of pGRB and recombinant DNA fragments

pGRB and recombinant DNA fragment were simultaneously electrotransformed into electrotransformation competent cells containing pREDCas 9. The cells recovered and cultured after the electrotransformation were plated on LB plates containing 100. mu.g/mL ampicillin and spectinomycin, and cultured overnight at 32 ℃. And (3) carrying out colony PCR verification by using an upstream primer of the upstream homology arm and a downstream primer of the downstream homology arm or designing a special identification primer, screening positive recombinants and preserving bacteria.

1.4 Elimination of plasmids

1.4.1 Elimination of pGRB

The positive recombinants are placed in LB culture medium containing 20mmol/L arabinose for overnight culture, and are coated on LB plates containing 100 mu g/mL spectinomycin resistance after being diluted in a proper amount, and are cultured at 32 ℃ overnight. The single colonies were transferred to LB plates containing 100. mu.g/mL ampicillin and spectinomycin resistance, respectively, and the single colonies which did not grow on the ampicillin plates and grew on the spectinomycin resistance plates were selected for bacterial conservation.

1.4.2 Elimination of pREDCas9 plasmid

Transferring the positive recombinants into a nonresistant LB liquid culture medium, culturing at 42 ℃ overnight, diluting the positive recombinants in a proper amount, coating the diluted positive recombinants on a nonresistant LB plate, and culturing at 37 ℃ overnight. And (3) selecting a single colony which does not grow on the spectinomycin resistant plate and does not grow on the non-resistant plate to preserve the bacteria on the LB plate containing spectinomycin resistance and non-resistance.

2. Coli E5 construction

2.1 treatment of P _T7 Integration of gmas (fragment containing the T7 promoter and the gmas gene) at the yeeP site of the pseudogene

Taking an E.coli ATCC27325 genome as ｃA template, designing upstream homology arm primers UP-yeeP-S (SEQ ID NO.1), UP-yeeP-A (SEQ ID NO.2) and downstream homology arm primers DN-yeeP-S (SEQ ID NO.3) and DN-yeeP-A (SEQ ID NO.4) according to upstream and downstream sequences of the yeeP gene, and amplifying the upstream and downstream homology arms of the yeeP gene; primers gmas-S (SEQ ID NO.5) and gmas-A (SEQ ID NO.6) were designed based on the gmas gene, and a gmas gene fragment was amplified. Promoter P _T7 The primer was designed to be the downstream primer of the upstream homology arm of the yeeP gene and the upstream primer of the gmas gene. The above fragment was subjected to overlap PCR to obtain an integrated fragment of the gmas gene (upstream homology arm-P of yeeP gene) _T7 ｃA downstream homologous arm of the gmas-yeeP gene), constructing ｃA DNA fragment containing ｃA target sequence used by the pGRB-yeeP, preparing the DNA fragment by annealing primers gRNA-yeeP-S (SEQ ID NO.7) and gRNA-yeeP-A (SEQ ID NO.8), and recombining the DNA fragment with ｃA linearized pGRB vector to obtain the recombined pGRB-yeeP. And (3) electrically transforming the integrated fragment and pGRB-yeeP into an escherichia coli starting strain competent cell containing a pREDCas9 vector, coating thalli subjected to recovery culture after the electric transformation on an LB plate containing ampicillin and spectinomycin, performing overnight culture at 32 ℃, verifying a positive recombinant by using PCR (polymerase chain reaction), and eliminating pGRB-yeeP for gene editing to obtain a strain E.coli E1. The positive recombinants verification map is shown in FIG. 2.

2.2 treatment of P _T7 -xfp (fragment containing the T7 promoter and xfp gene) integrated at the ycgH site of the pseudogene

Using E.coli ATCC27325 genome as template, designing upstream homology arm primer UP-ycgH-S (SEQ ID NO.9), UP-ycgH-A (SEQ ID NO.10) and downstream homology arm primer DN-ycgH-S (SEQ ID NO.11) and DN-ycgH-A (SEQ ID NO.12) according to upstream and downstream sequences of ycgH gene, and amplifying upstream and downstream homology arms of ycgH gene; primers xfp-S (SEQ ID NO.13) and xfp-A (SEQ ID NO.14) were designed based on the xfp gene, and a xfp gene fragment was amplified. Promoter P _T7 The downstream primer of the upstream homology arm of the ycgH gene and the upstream primer of the xfp gene were designed. The integrated fragment of xfp gene (ycgH gene upstream homology arm-P) was obtained by overlapping PCR of the above fragments _T7 xfp-ycgH gene downstream homology arm), construction of a DNA fragment containing the target sequence used for pGRB-ycgH by means of the primer gRNA-ycgH-S (SEQ ID NO.15) and gRNA-ycgH-A (SEQ ID NO.16) are annealed to obtain the recombinant pGRB-ycgH after recombination with a linearized pGRB vector. And (3) electrically transforming the integrated fragment and pGRB-ycgH into an E.coli E1 competent cell containing a pREDCas9 vector, coating thalli subjected to recovery culture after the electric transformation on an LB plate containing ampicillin and spectinomycin, performing overnight culture at 32 ℃, verifying positive recombinants by using PCR (polymerase chain reaction), and eliminating pGRB-ycgH for gene editing to obtain a strain E.coli E2. The positive recombinants verification map is shown in FIG. 3.

2.3 treatment of P _trc Integration of the spuC (fragment containing the trc promoter and the spuC gene) at the locus of the pseudogene ycnI

Taking E.coli ATCC27325 genome as a template, designing upstream homology arm primers UP-ycnI-S (SEQ ID NO.17), UP-ycnI-A (SEQ ID NO.18) and downstream homology arm primers DN-ycnI-S (SEQ ID NO.19) and DN-ycnI-A (SEQ ID NO.20) according to upstream and downstream sequences of ycnI gene, and amplifying upstream and downstream homology arms of the ycnI gene; primers, spuC-S (SEQ ID NO.21) and spuC-A (SEQ ID NO.22), were designed based on the spuC gene, and the spuC gene fragment was amplified. Promoter P _trc The downstream primer of the upstream homology arm of the ycnI gene and the upstream primer of the PpTA gene were designed. The integrated fragment of the spuC gene (ycnI gene upstream homology arm-P) was obtained from the above fragment by overlap PCR _trc -spuC-ycnI gene downstream homology arm), constructing a DNA fragment containing a target sequence used by pGRB-ycnI, preparing by annealing primers gRNA-ycnI-S (SEQ ID No.23) and gRNA-ycnI-a (SEQ ID No.24), and recombining with a linearized pGRB vector to obtain recombinant pGRB-ycnI. And (3) electrically transforming the integrated fragment and pGRB-ycnI into an E.coli E2 competent cell containing a pREDCas9 vector, coating thalli subjected to recovery culture after the electric transformation on an LB plate containing ampicillin and spectinomycin, performing overnight culture at 32 ℃, verifying positive recombinants by using PCR (polymerase chain reaction), and eliminating pGRB-ycnI for gene editing to obtain a strain E.coli E3. The positive recombinants verification map is shown in figure 4.

2.4 treatment of P _trc Integration of eutE (fragment containing trc promoter and eutE Gene) at the site of pseudogene fhiA

Coli ATCC27325 genome as template, based on the upper and lower fhiA geneDesigning upstream homology arm primers UP-fhiA-S (SEQ ID NO.25), UP-fhiA-A (SEQ ID NO.26) and downstream homology arm primers DN-fhiA-S (SEQ ID NO.27), DN-fhiA-A (SEQ ID NO.28) from upstream sequences, and amplifying upstream and downstream homology arms of fhiA genes; primers, eutE-S (SEQ ID NO.29) and eutE-A (SEQ ID NO.30), are designed according to the eutE gene, and the eutE gene fragment is amplified. Promoter P _trc The downstream primer of the upstream homology arm of fhiA gene and the upstream primer of eutE gene were designed. The integrated fragment of the eutE gene (upstream homology arm-P of fhiA gene) is obtained by the overlapping PCR method of the above fragments _trc -eutE-fhiA gene downstream homology arm), constructing pGRB-fhiA using DNA fragment containing target sequence prepared by annealing primers gRNA-fhiA-S (SEQ ID NO.31) and gRNA-fhiA-A (SEQ ID NO.32), recombining with linearized pGRB vector to obtain recombinant pGRB-fhiA. And (3) electrically transforming the integrated fragment and pGRB-fhiA into an E.coli E3 competent cell containing a pREDCas9 vector, coating thalli subjected to recovery culture after the electric transformation on an LB plate containing ampicillin and spectinomycin, performing overnight culture at 32 ℃, verifying positive recombinants by using PCR (polymerase chain reaction), and eliminating pGRB-fhiA for gene editing to obtain a strain E.coli E4. The positive recombinants verification map is shown in figure 5.

2.5 treatment of P _trc -alD (fragment containing trc promoter and alD gene) integrated at the ygaY site of pseudogene

Taking E.coli ATCC27325 genome as a template, designing upstream homology arm primers UP-ygaY-S (SEQ ID NO.33), UP-ygaY-A (SEQ ID NO.34) and downstream homology arm primers DN-ygaY-S (SEQ ID NO.35) and DN-ygaY-A (SEQ ID NO.36) according to upstream and downstream sequences of ygaY gene, and amplifying upstream and downstream homology arms of the ygaY gene; primers alD-S (SEQ ID NO.37) and alD-A (SEQ ID NO.38) were designed based on the alD gene, and a alD gene fragment was amplified. Promoter P _trc The downstream primer of the upstream homology arm of the ygaY gene and the upstream primer of the alD gene were designed. The integrated fragment of alD gene (upstream homology arm-P of ygaY gene) was obtained by overlapping PCR of the above fragments _trc -alD-ygaY gene downstream homology arm), DNA fragment containing target sequence used for construction of pGRB-ygaY is prepared by annealing primers gRNA-ygaY-S (SEQ ID NO.39) and gRNA-ygaY-A (SEQ ID NO.40), and is linked with linearized pGRB vectorRecombinant pGRB-ygaY is obtained after recombination. And (3) electrically transforming the integrated fragment and pGRB-ygaY into an E.coli E4 competent cell containing a pREDCas9 vector, coating thalli subjected to recovery culture after the electric transformation on an LB plate containing ampicillin and spectinomycin, performing overnight culture at 32 ℃, verifying positive recombinants by using PCR (polymerase chain reaction), and eliminating pGRB-ygaY for gene editing to obtain a strain E.coli E5. The positive recombinants verification map is shown in figure 6.

3. Coli E5 primers used in the construction of Strain E.Coli E5 are shown in Table 5

Table 5 primers involved in the construction of strain E. coli E5:

example 2: fermentation production of theanine by utilizing genetically engineered bacterium E.coli E5

(1) And (3) shaking flask fermentation:

the fermentation medium for the shake flask fermentation consists of: 10g/L glucose, 3g/L yeast powder, 4g/L peptone, 1g/L sodium citrate, 3g/L potassium dihydrogen phosphate, 1g/L magnesium sulfate, 15mg/L ferrous sulfate, 15mg/L manganese sulfate, VB ₁ 、VB ₃ 、VB ₅ 、VB ₁₂ 、V _H Each 1mg/L, the rest is water, and the pH value is 7.0-7.2.

The fermentation process comprises the following steps: the strain preserved at minus 80 ℃ is streaked and inoculated on an activated inclined plane, cultured for 12h at 37 ℃ and subcultured once. A ring of slant seeds are scraped by an inoculating ring and inoculated in a 500mL triangular flask filled with 30mL seed culture medium, nine layers of gauze are sealed, and the mixture is cultured for 10 hours at 37 ℃ and 220 rpm. Inoculating the seed culture solution into a 500ml triangular flask (the final volume is 30ml) filled with a fermentation culture medium according to the inoculation amount of 15% of the volume of the seed culture solution, sealing by nine layers of gauze, carrying out shaking culture at 37 ℃ at 200r/min, and maintaining the pH value at 6.7-7.2 by adding ammonia water in the fermentation process; adding 60% (m/v) glucose solution to maintain fermentation. After 26h of shake flask fermentation, the yield of the theanine in the fermentation liquor is 6 g/L.

(2) Fermentation in a fermentation tank:

the fermentation medium for fermentation in the fermentation tank comprises the following components: 10g/L glucose, 2g/L yeast powder, 0.2g/L citric acid, 0.5g/L potassium dihydrogen phosphate, 0.5g/L dipotassium hydrogen phosphate, 0.2g/L magnesium sulfate, 0.1g/L methionine, 0.2mg/L ferrous sulfate, 1mg/L manganese sulfate, 2ml/L corn steep liquor, the balance water and the pH value of 7.0-7.2.

The fermentation process comprises the following steps: scraping a ring of strains from a refrigerator bacteria-protecting tube at-80 deg.C, uniformly coating on an activated slant, culturing at 37 deg.C for 10h, and inoculating onto a eggplant-shaped bottle for further culturing for 10 h. Placing a proper amount of sterile water in an eggplant-shaped bottle, inoculating the bacterial suspension into a seed culture medium, stabilizing the pH at about 7.0, keeping the temperature constant at 37 ℃, dissolving oxygen at 30%, and culturing until the dry weight of cells reaches 5 g/L. Inoculating into fresh fermentation culture medium according to 15% inoculum size, starting fermentation, controlling pH to be stabilized at about 7.0, maintaining temperature at 37 deg.C, and dissolving oxygen at 35%; when the glucose in the medium was consumed, 80% (m/v) of the glucose solution was fed in to maintain the glucose concentration in the fermentation medium below 1 g/L. After the culture is carried out in a 5L fermentation tank for 30h, the yield of the theanine reaches 40g/L, the conversion rate reaches 0.14g of theanine/g of glucose, and the production intensity reaches 1.3g of theanine/L/h.

Example 3: fermentation production of theanine by utilizing genetically engineered bacterium E.coli E5

(1) And (3) shaking flask fermentation:

the fermentation medium for the shake flask fermentation consists of: 40g/L glucose, 4g/L yeast powder, 6g/L peptone, 2g/L sodium citrate, 6g/L potassium dihydrogen phosphate, 2g/L magnesium sulfate, 20mg/L ferric sulfate, 20mg/L manganese sulfate, VB ₁ 、VB ₃ 、VB ₅ 、VB ₁₂ 、V _H 3mg/L of each, the balance of water, and the pH value of 7.0-7.2.

The fermentation process comprises the following steps: the strain preserved at minus 80 ℃ is streaked and inoculated on an activated inclined plane, cultured for 12h at 37 ℃ and subcultured once. A ring of slant seeds are scraped by an inoculating ring and inoculated in a 500mL triangular flask filled with 30mL seed culture medium, nine layers of gauze are sealed, and the mixture is cultured for 10 hours at 37 ℃ and 220 rpm. Inoculating the seed culture solution into a 500ml triangular flask (the final volume is 30ml) filled with a fermentation culture medium according to the inoculation amount of 20% of the volume of the seed culture solution, sealing by nine layers of gauze, carrying out shaking culture at 37 ℃ at 220r/min, and maintaining the pH value at 6.7-7.2 by adding ammonia water in the fermentation process; adding 60% (m/v) glucose solution to maintain fermentation. After 30h of shake flask fermentation, the yield of the theanine in the fermentation liquor is 10 g/L.

(2) Fermentation in a fermentation tank:

the fermentation medium for fermentation in the fermentation tank comprises the following components: 40g/L of glucose, 8g/L of yeast powder, 2.0g/L of citric acid, 3.2g/L of monopotassium phosphate, 2.4g/L of dipotassium phosphate, 1.2g/L of magnesium sulfate, 1.0g/L of methionine, 20mg/L of ferrous sulfate, 10mg/L of manganese sulfate, 20ml/L of corn steep liquor and the balance of water, wherein the pH value is 7.0-7.2.

The fermentation process comprises the following steps: scraping a ring of strains from a refrigerator bacteria-protecting tube at-80 deg.C, uniformly coating on an activated slant, culturing at 37 deg.C for 10h, and inoculating onto a eggplant-shaped bottle for further culturing for 10 h. Placing a proper amount of sterile water in an eggplant-shaped bottle, inoculating the bacterial suspension into a seed culture medium, stabilizing the pH at about 7.0, keeping the temperature constant at 37 ℃, dissolving oxygen at 30%, and culturing until the dry weight of cells reaches 5 g/L. Inoculating into fresh fermentation culture medium according to 20% inoculum size, starting fermentation, controlling pH to be stabilized at about 7.0, maintaining temperature at 37 deg.C, and dissolving oxygen at 45%; when the glucose in the medium was consumed, 80% (m/v) of the glucose solution was fed in to maintain the glucose concentration in the fermentation medium below 1 g/L. After the culture is carried out for 33 hours in a 5L fermentation tank, the yield of the theanine reaches 46g/L, the conversion rate reaches 0.16g theanine/g glucose, and the production intensity reaches 1.4g theanine/L/h. The fermentation progress is shown in FIG. 7.

The sequences used in the present invention are as follows:

SEQ ID NO.1 gamma-glutamyl methylamine synthetase gene gmas:

atgaccgatctggccgaatttgcccgcgaaaaaggcgtgaaatattttatggtgagctataccgatttagtgggcgcccagcgcgcaaaactggttccgacctacatgatcaacaacgttgtgagcggcggcgccggttttgccggctttgctggtggctttgttttaaccccggcacatccggatatgttaggtatgccggatgccgataccgttatccaactgccgtggaaaccggaagttgcatgggtggcagccaacccggcaatgtatgatagcccgctgccgcaagctccgcgtaatgtgctgcgtaatgtgattgcagagatggaaaaggaaggtttacgcatcaaaaccggcgttgaaccggagttcttctttctgactccggaaggcgatcgtattgccgatacccgcgataccgccgccaaaccgtgctacgatcagcaagctattatgcgtcgttacgatgtgatcagcgaggtgagcgactacatgattgaactgggctgggaaccgtatcagagtgaccatgaagacgccaacggtcagttcgagatgaactggaagtatgatgattctttagcaaccgccgataagctggccttttttaaatttatgatgaaaagcgttgccgaaaagcatggtctgcgcgtgaccttcatgccgaaaccgttcttagagctgaccggtagcggcatgcatgcccacattagcggctggagtctggatggcaaaaccaacgccttctacgatggcaacgatgagctgggtctgagcgaagtgggtcaccattttctgggcggcattatgaagcatgccagcgcactggccgccattaccaatccgaccatcaatagctataaacgcattaacgcaccgcgtagcagtagcggtgcaacttgggccccgaatagcgtgacttggagcggcgacaaccgcacccatctggtgcgtgttccgggcaagggtcgtattgaactgcgtttaccggatggtgccagcaacccgtatctgttacacgccgtgatcatggccgctggtctggatggtattcgccacaagtgtgatccgggcaagcgtctggacattgatatgtacgccgacggccatatggtgaaagatgccccgaagctgccgctgaatttactggatgccattcgtgcctttgatcagaacaccgagctgaaagccgctttaggtgaagaatttagcgccagcttcatcgagatgaaaatgaaagagtggaatgcctacgcaagccatctgacccagtgggaacgcgatcacactttagatatttaa

SEQ ID No.2 phosphoketolase gene xfp:

atgacctctccggttatcggtaccccgtggaaaaaactgaacgcgccggtttctgaagaagcgatcgaaggtgttgacaaatactggcgtgcggcgaactacctgtctatcggtcagatctacctgcgttctaacccgctgatgaaagaaccgttcacccgtgaagacgttagacaccgtctggttggtcactggggtaccaccccgggtctgaacttcctgatcggtcacatcaaccgtctgatcgcggaccaccagcagaacaccgttatcatcatgggtccgggtcacggtggtccggcgggtaccgcgcagtcttacctggacggtacctacaccgaatacttcccgaacatcaccaaagacgaagcgggtctgcagaaattcttccgtcagttctcttacccgggtggtatcccgtctcactacgcgccggaaaccccgggttctatccacgaaggtggtgaactgggttacgcgctgtctcacgcgtacggtgcggttatgaacaacccgtctctgttcgttccggcgatcgttggtgacggtgaagcggaaaccggtccgctggcgaccggttggcagtctaacaaactgatcaacccgcgtaccgacggtatcgttctgccgatcctgcacctgaacggttacaaaatcgcgaacccgaccatcctgtctcgtatctctgacgaagaactgcacgagttcttccacggtatgggttacgaaccgtacgagttcgttgcgggtttcgacaacgaagaccacctgtctatccaccgtcgtttcgcggaactgttcgaaaccgttttcgacgaaatctgcgacatcaaagcggcggcgcagaccgacgacatgacccgtccgttctacccgatgatcatcttccgtaccccgaaaggttggacctgcccgaaattcatcgacggtaaaaaaaccgaaggttcttggcgttctcaccaggttccgctggcgtctgcgcgtgacaccgaagcgcacttcgaagttctgaaaaactggctggaatcttacaaaccggaaaaactgttcgacgaaaacggtgcggttaaaccggaagttaccgcgttcatgccgaccggtgaactgcgtatcggtgaaaacccgaacgcgaacggtggtcgtatccgtgaagaactgaaactgccgaaactggaagactacgaagttaaagaagttgcggaatacggtcacggttggggtcagctggaagcgacccgtcgtctgggtgtttacacccgtgacatcatcaaaaacaacccggactctttccgtatcttcggtccggacgaaaccgcgtctaaccgtctgcaggcggcgtacgacgttaccaacaaacagtgggacgcgggttacctgtctgcgcaggttgacgaacacatggcggttaccggtcaggttaccgaacagctgtctgaacaccagatggaaggtttcctggaaggttacctgctgaccggtcgtcacggtatctggtcttcttacgaatctttcgttcacgttatcgactctatgctgaaccagcacgcgaaatggctggaagcgaccgttcgtgaaatcccgtggcgtaaaccgatctcttctatgaacctgctggtttcttctcacgtttggcgtcaggaccacaacggtttctctcaccaggacccgggtgttacctctgttctgctgaacaaatgcttcaacaacgaccacgttatcggtatctacttcccggttgactctaacatgctgctggcggttgcggaaaaatgctacaaatctaccaacaaaatcaacgcgatcatcgcgggtaaacagccggcggcgacctggctgaccctggacgaagcgcgtgcggaactggaaaaaggtgcggcggaatggaaatgggcgtctaacgttaaatctaacgacgaagcgcagatcgttctggcggcgaccggtgacgttccgacccaggaaatcatggcggcggcggacaaactggacgcgatgggtatcaaattcaaagttgttaacgttgttgacctggttaaactgcagtctgcgaaagaaaacaacgaagcgctgtctgacgaagagttcgcggaactgttcaccgaagacaaaccggttctgttcgcgtaccactcttacgcgcgtgacgttcgtggtctgatctacgaccgtccgaaccacgacaacttcaacgttcacggttacgaagaacagggttctaccaccaccccgtacgacatggttcgtgttaacaacatcgaccgttacgaactgcaggcggaagcgctgcgtatgatcgacgcggacaaatacgcggacaaaatcaacgaactggaagcgttccgtcaggaagcgttccagttcgcggttgacaacggttacgaccacccggactacaccgactgggtttactctggtgttaacaccaacaaacagggtgcgatctctgcgaccgcggcgaccgcgggtgacaacgaatga

the transaminase gene spuC of SEQ ID NO. 3:

atgagcgtcaacaacccgcaaacccgtgaatggcaaaccctgagcggggagcatcacctcgcacctttcagtgactacaagcagctgaaggagaaggggccgcgcatcatcaccaaggcccagggtgtgcatttgtgggatagcgaggggcacaagatcctcgacggcatggccggtctatggtgcgtggcggtcggctacggacgtgaagagctggtgcaggcggcggaaaaacagatgcgcgagctgccgtactacaacctgttcttccagaccgctcacccgcctgcgctcgagctggccaaggcgatcaccgacgtggcgccgaaaggtatgacccatgtgttcttcaccggctccggctccgaaggcaacgacactgtgctgcgcatggtgcgtcactactgggcgctgaagggcaaaccgcacaagcagaccatcatcggccgcatcaacggttaccacggctccaccttcgccggtgcatgcctgggcggtatgagcggcatgcacgagcagggtggcctgccgatcccgggcatcgtgcacatccctcagccgtactggttcggcgagggaggcgacatgacccctgacgaattcggtgtctgggccgccgagcagttggagaagaagatcctcgaagtcggcgaagacaacgtcgcggccttcatcgccgagccgatccagggcgctggtggcgtgatcatcccgccggaaacctactggccgaaggtgaaggagatcctcgccaggtacgacatcctgttcgtcgccgacgaggtgatctgcggcttcggccgtaccggcgagtggttcggctcggactactacgacctcaagcccgacctgatgaccatcgcgaaaggcctgacctccggttacatccccatgggcggtgtgatcgtgcgtgacaccgtggccaaggtgatcagcgaaggcggcgacttcaaccacggtttcacctactccggccacccggtggcggccgcggtgggcctggaaaacctgcgcattctgcgtgacgagaaaattgtcgagaaggcgcgcacggaagcggcaccgtatttgcaaaagcgtttgcgcgagctgcaagaccatccactggtgggtgaagtgcgcggcctgggcatgctgggagcgatcgagctggtcaaggacaaggcaacccgcagccgttacgagggcaagggcgttggcatgatctgtcgcaccttctgcttcgagaacggcctgatcatgcgtgcggtgggtgacaccatgatcatcgcgccgccgctggtaatcagccatgcggagatcgacgaactggtggaaaaggcgcgcaagtgcctggacctgacccttgaggcgattcaataa

SEQ ID No.4 acetaldehyde dehydrogenase gene eutE:

atgaatcaacaggatattgaacaggtggtgaaagcggtactgctgaaaatgcaaagcagtgacacgccgtccgccgccgttcatgagatgggcgttttcgcgtccctggatgacgccgttgcggcagccaaagtcgcccagcaagggttaaaaagcgtggcaatgcgccagttagccattgctgccattcgtgaagcaggcgaaaaacacgccagagatttagcggaacttgccgtcagtgaaaccggcatggggcgcgttgaagataaatttgcaaaaaacgtcgctcaggcgcgcggcacaccaggcgttgagtgcctctctccgcaagtgctgactggcgacaacggcctgaccctaattgaaaacgcaccctggggcgtggtggcttcggtgacgccttccactaacccggcggcaaccgtaattaacaacgccatcagcctgattgccgcgggcaacagcgtcatttttgccccgcatccggcggcgaaaaaagtctcccagcgggcgattacgctgctcaaccaggcgattgttgccgcaggtgggccggaaaacttactggttactgtggcaaatccggatatcgaaaccgcgcaacgcttgttcaagtttccgggtatcggcctgctggtggtaaccggcggcgaagcggtagtagaagcggcgcgtaaacacaccaataaacgtctgattgccgcaggcgctggcaacccgccggtagtggtggatgaaaccgccgacctcgcccgtgccgctcagtccatcgtcaaaggcgcttctttcgataacaacatcatttgtgccgacgaaaaggtactgattgttgttgatagcgtagccgatgaactgatgcgtctgatggaaggccagcacgcggtgaaactgaccgcagaacaggcgcagcagctgcaaccggtgttgctgaaaaatatcgacgagcgcggaaaaggcaccgtcagccgtgactgggttggtcgcgacgcaggcaaaatcgcggcggcaatcggccttaaagttccgcaagaaacgcgcctgctgtttgtggaaaccaccgcagaacatccgtttgccgtgactgaactgatgatgccggtgttgcccgtcgtgcgcgtcgccaacgtggcggatgccattgcgctagcggtgaaactggaaggcggttgccaccacacggcggcaatgcactcgcgcaacatcgaaaacatgaaccagatggcgaatgctattgataccagcattttcgttaagaacggaccgtgcattgccgggctggggctgggcggggaaggctggaccaccatgaccatcaccacgccaaccggtgaaggggtaaccagcgcgcgtacgtttgtccgtctgcgtcgctgtgtattagtcgatgcgtttcgcattgtttaa

SEQ ID No.5 alanine dehydrogenase gene alD:

gtgtacattgaaactggagcaggcttaggatcaagctttacggatgctgattatattgcagctggtgctcatattgtgaatactgctaaggaagcttggtcacaagagatgattatgaaggtgaaagagcctgtagcttctgagtataattacttttatgaaggtcaaatcctattcacttacttacacttagcgccagaagttgaattgactcaggcacttttaaataaaaaagttgtagggattgcctacgaaaccgttcaattagcaaatggttcactaccgttattaacaccaatgagtgaagtagcaggtaaaatggctacacaaattggtgcacagttcttagagagaaatcatgctggtaaagggattttacttggcggtgtatcaggtgtacaacgcggtaaagtgacagtcatcggtggtggtatcgcgggaacgaacgctgcgaaaatcgctgttggcatgggagcagacgtaacagttatcgatttaagtcctgagcgtttacgccaattagaagatatgtttggccgtgatgttcaaactttgatttctaatccttataatattgcagaatctgtgaaaacttccgatttagtaattggtgccgtgttaattccaggcgcaaaagcaccgaagcttgtgtctgaagaaatgattcaatcaatgcaagctggctctgtagtagtggatatcgctattgaccaaggtggtatttttgcttcttcagatcgtgtcacaacacatgatgatccaacttacgtaaaacacggcgttgtccattatgcagttgcgaatatgccgggagctgtaccacgtacatcaacaattgctttaacaaataatacaattccttacgcacttcaaattgcaaataaaggctataaacaagcttgcctagacaatgctgcactaaaaaaaggtgtgaatacattagatggacaactagtatataaagctgtagcagattcacaaggaattccatatgtcaatgtggatgagcttattcaataa

although the embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that: various substitutions, changes and modifications are possible without departing from the spirit and scope of the invention and the appended claims, and therefore the scope of the invention is not limited to the embodiments disclosed.

Sequence listing

<110> Tianjin science and technology university

<120> genetically engineered bacterium for producing L-theanine by using glucose from head fermentation, method and application

<160> 52

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1305

<212> DNA

<213> gamma-glutamylmethylamine synthase gene gmas (Unknown)

<400> 1

atgaccgatc tggccgaatt tgcccgcgaa aaaggcgtga aatattttat ggtgagctat 60

accgatttag tgggcgccca gcgcgcaaaa ctggttccga cctacatgat caacaacgtt 120

gtgagcggcg gcgccggttt tgccggcttt gctggtggct ttgttttaac cccggcacat 180

ccggatatgt taggtatgcc ggatgccgat accgttatcc aactgccgtg gaaaccggaa 240

gttgcatggg tggcagccaa cccggcaatg tatgatagcc cgctgccgca agctccgcgt 300

aatgtgctgc gtaatgtgat tgcagagatg gaaaaggaag gtttacgcat caaaaccggc 360

gttgaaccgg agttcttctt tctgactccg gaaggcgatc gtattgccga tacccgcgat 420

accgccgcca aaccgtgcta cgatcagcaa gctattatgc gtcgttacga tgtgatcagc 480

gaggtgagcg actacatgat tgaactgggc tgggaaccgt atcagagtga ccatgaagac 540

gccaacggtc agttcgagat gaactggaag tatgatgatt ctttagcaac cgccgataag 600

ctggcctttt ttaaatttat gatgaaaagc gttgccgaaa agcatggtct gcgcgtgacc 660

ttcatgccga aaccgttctt agagctgacc ggtagcggca tgcatgccca cattagcggc 720

tggagtctgg atggcaaaac caacgccttc tacgatggca acgatgagct gggtctgagc 780

gaagtgggtc accattttct gggcggcatt atgaagcatg ccagcgcact ggccgccatt 840

accaatccga ccatcaatag ctataaacgc attaacgcac cgcgtagcag tagcggtgca 900

acttgggccc cgaatagcgt gacttggagc ggcgacaacc gcacccatct ggtgcgtgtt 960

ccgggcaagg gtcgtattga actgcgttta ccggatggtg ccagcaaccc gtatctgtta 1020

cacgccgtga tcatggccgc tggtctggat ggtattcgcc acaagtgtga tccgggcaag 1080

cgtctggaca ttgatatgta cgccgacggc catatggtga aagatgcccc gaagctgccg 1140

ctgaatttac tggatgccat tcgtgccttt gatcagaaca ccgagctgaa agccgcttta 1200

ggtgaagaat ttagcgccag cttcatcgag atgaaaatga aagagtggaa tgcctacgca 1260

agccatctga cccagtggga acgcgatcac actttagata tttaa 1305

<210> 2

<211> 2478

<212> DNA

<213> phosphoketolase gene xfp (Unknown)

<400> 2

atgacctctc cggttatcgg taccccgtgg aaaaaactga acgcgccggt ttctgaagaa 60

gcgatcgaag gtgttgacaa atactggcgt gcggcgaact acctgtctat cggtcagatc 120

tacctgcgtt ctaacccgct gatgaaagaa ccgttcaccc gtgaagacgt tagacaccgt 180

ctggttggtc actggggtac caccccgggt ctgaacttcc tgatcggtca catcaaccgt 240

ctgatcgcgg accaccagca gaacaccgtt atcatcatgg gtccgggtca cggtggtccg 300

gcgggtaccg cgcagtctta cctggacggt acctacaccg aatacttccc gaacatcacc 360

aaagacgaag cgggtctgca gaaattcttc cgtcagttct cttacccggg tggtatcccg 420

tctcactacg cgccggaaac cccgggttct atccacgaag gtggtgaact gggttacgcg 480

ctgtctcacg cgtacggtgc ggttatgaac aacccgtctc tgttcgttcc ggcgatcgtt 540

ggtgacggtg aagcggaaac cggtccgctg gcgaccggtt ggcagtctaa caaactgatc 600

aacccgcgta ccgacggtat cgttctgccg atcctgcacc tgaacggtta caaaatcgcg 660

aacccgacca tcctgtctcg tatctctgac gaagaactgc acgagttctt ccacggtatg 720

ggttacgaac cgtacgagtt cgttgcgggt ttcgacaacg aagaccacct gtctatccac 780

cgtcgtttcg cggaactgtt cgaaaccgtt ttcgacgaaa tctgcgacat caaagcggcg 840

gcgcagaccg acgacatgac ccgtccgttc tacccgatga tcatcttccg taccccgaaa 900

ggttggacct gcccgaaatt catcgacggt aaaaaaaccg aaggttcttg gcgttctcac 960

caggttccgc tggcgtctgc gcgtgacacc gaagcgcact tcgaagttct gaaaaactgg 1020

ctggaatctt acaaaccgga aaaactgttc gacgaaaacg gtgcggttaa accggaagtt 1080

accgcgttca tgccgaccgg tgaactgcgt atcggtgaaa acccgaacgc gaacggtggt 1140

cgtatccgtg aagaactgaa actgccgaaa ctggaagact acgaagttaa agaagttgcg 1200

gaatacggtc acggttgggg tcagctggaa gcgacccgtc gtctgggtgt ttacacccgt 1260

gacatcatca aaaacaaccc ggactctttc cgtatcttcg gtccggacga aaccgcgtct 1320

aaccgtctgc aggcggcgta cgacgttacc aacaaacagt gggacgcggg ttacctgtct 1380

gcgcaggttg acgaacacat ggcggttacc ggtcaggtta ccgaacagct gtctgaacac 1440

cagatggaag gtttcctgga aggttacctg ctgaccggtc gtcacggtat ctggtcttct 1500

tacgaatctt tcgttcacgt tatcgactct atgctgaacc agcacgcgaa atggctggaa 1560

gcgaccgttc gtgaaatccc gtggcgtaaa ccgatctctt ctatgaacct gctggtttct 1620

tctcacgttt ggcgtcagga ccacaacggt ttctctcacc aggacccggg tgttacctct 1680

gttctgctga acaaatgctt caacaacgac cacgttatcg gtatctactt cccggttgac 1740

tctaacatgc tgctggcggt tgcggaaaaa tgctacaaat ctaccaacaa aatcaacgcg 1800

atcatcgcgg gtaaacagcc ggcggcgacc tggctgaccc tggacgaagc gcgtgcggaa 1860

ctggaaaaag gtgcggcgga atggaaatgg gcgtctaacg ttaaatctaa cgacgaagcg 1920

cagatcgttc tggcggcgac cggtgacgtt ccgacccagg aaatcatggc ggcggcggac 1980

aaactggacg cgatgggtat caaattcaaa gttgttaacg ttgttgacct ggttaaactg 2040

cagtctgcga aagaaaacaa cgaagcgctg tctgacgaag agttcgcgga actgttcacc 2100

gaagacaaac cggttctgtt cgcgtaccac tcttacgcgc gtgacgttcg tggtctgatc 2160

tacgaccgtc cgaaccacga caacttcaac gttcacggtt acgaagaaca gggttctacc 2220

accaccccgt acgacatggt tcgtgttaac aacatcgacc gttacgaact gcaggcggaa 2280

gcgctgcgta tgatcgacgc ggacaaatac gcggacaaaa tcaacgaact ggaagcgttc 2340

cgtcaggaag cgttccagtt cgcggttgac aacggttacg accacccgga ctacaccgac 2400

tgggtttact ctggtgttaa caccaacaaa cagggtgcga tctctgcgac cgcggcgacc 2460

gcgggtgaca acgaatga 2478

<210> 3

<211> 1362

<212> DNA

<213> transaminase gene spuC (Unknown)

<400> 3

atgagcgtca acaacccgca aacccgtgaa tggcaaaccc tgagcgggga gcatcacctc 60

gcacctttca gtgactacaa gcagctgaag gagaaggggc cgcgcatcat caccaaggcc 120

cagggtgtgc atttgtggga tagcgagggg cacaagatcc tcgacggcat ggccggtcta 180

tggtgcgtgg cggtcggcta cggacgtgaa gagctggtgc aggcggcgga aaaacagatg 240

cgcgagctgc cgtactacaa cctgttcttc cagaccgctc acccgcctgc gctcgagctg 300

gccaaggcga tcaccgacgt ggcgccgaaa ggtatgaccc atgtgttctt caccggctcc 360

ggctccgaag gcaacgacac tgtgctgcgc atggtgcgtc actactgggc gctgaagggc 420

aaaccgcaca agcagaccat catcggccgc atcaacggtt accacggctc caccttcgcc 480

ggtgcatgcc tgggcggtat gagcggcatg cacgagcagg gtggcctgcc gatcccgggc 540

atcgtgcaca tccctcagcc gtactggttc ggcgagggag gcgacatgac ccctgacgaa 600

ttcggtgtct gggccgccga gcagttggag aagaagatcc tcgaagtcgg cgaagacaac 660

gtcgcggcct tcatcgccga gccgatccag ggcgctggtg gcgtgatcat cccgccggaa 720

acctactggc cgaaggtgaa ggagatcctc gccaggtacg acatcctgtt cgtcgccgac 780

gaggtgatct gcggcttcgg ccgtaccggc gagtggttcg gctcggacta ctacgacctc 840

aagcccgacc tgatgaccat cgcgaaaggc ctgacctccg gttacatccc catgggcggt 900

gtgatcgtgc gtgacaccgt ggccaaggtg atcagcgaag gcggcgactt caaccacggt 960

ttcacctact ccggccaccc ggtggcggcc gcggtgggcc tggaaaacct gcgcattctg 1020

cgtgacgaga aaattgtcga gaaggcgcgc acggaagcgg caccgtattt gcaaaagcgt 1080

ttgcgcgagc tgcaagacca tccactggtg ggtgaagtgc gcggcctggg catgctggga 1140

gcgatcgagc tggtcaagga caaggcaacc cgcagccgtt acgagggcaa gggcgttggc 1200

atgatctgtc gcaccttctg cttcgagaac ggcctgatca tgcgtgcggt gggtgacacc 1260

atgatcatcg cgccgccgct ggtaatcagc catgcggaga tcgacgaact ggtggaaaag 1320

gcgcgcaagt gcctggacct gacccttgag gcgattcaat aa 1362

<210> 4

<211> 1404

<212> DNA

<213> acetaldehyde dehydrogenase Gene eutE (Unknown)

<400> 4

atgaatcaac aggatattga acaggtggtg aaagcggtac tgctgaaaat gcaaagcagt 60

gacacgccgt ccgccgccgt tcatgagatg ggcgttttcg cgtccctgga tgacgccgtt 120

gcggcagcca aagtcgccca gcaagggtta aaaagcgtgg caatgcgcca gttagccatt 180

gctgccattc gtgaagcagg cgaaaaacac gccagagatt tagcggaact tgccgtcagt 240

gaaaccggca tggggcgcgt tgaagataaa tttgcaaaaa acgtcgctca ggcgcgcggc 300

acaccaggcg ttgagtgcct ctctccgcaa gtgctgactg gcgacaacgg cctgacccta 360

attgaaaacg caccctgggg cgtggtggct tcggtgacgc cttccactaa cccggcggca 420

accgtaatta acaacgccat cagcctgatt gccgcgggca acagcgtcat ttttgccccg 480

catccggcgg cgaaaaaagt ctcccagcgg gcgattacgc tgctcaacca ggcgattgtt 540

gccgcaggtg ggccggaaaa cttactggtt actgtggcaa atccggatat cgaaaccgcg 600

caacgcttgt tcaagtttcc gggtatcggc ctgctggtgg taaccggcgg cgaagcggta 660

gtagaagcgg cgcgtaaaca caccaataaa cgtctgattg ccgcaggcgc tggcaacccg 720

ccggtagtgg tggatgaaac cgccgacctc gcccgtgccg ctcagtccat cgtcaaaggc 780

gcttctttcg ataacaacat catttgtgcc gacgaaaagg tactgattgt tgttgatagc 840

gtagccgatg aactgatgcg tctgatggaa ggccagcacg cggtgaaact gaccgcagaa 900

caggcgcagc agctgcaacc ggtgttgctg aaaaatatcg acgagcgcgg aaaaggcacc 960

gtcagccgtg actgggttgg tcgcgacgca ggcaaaatcg cggcggcaat cggccttaaa 1020

gttccgcaag aaacgcgcct gctgtttgtg gaaaccaccg cagaacatcc gtttgccgtg 1080

actgaactga tgatgccggt gttgcccgtc gtgcgcgtcg ccaacgtggc ggatgccatt 1140

gcgctagcgg tgaaactgga aggcggttgc caccacacgg cggcaatgca ctcgcgcaac 1200

atcgaaaaca tgaaccagat ggcgaatgct attgatacca gcattttcgt taagaacgga 1260

ccgtgcattg ccgggctggg gctgggcggg gaaggctgga ccaccatgac catcaccacg 1320

ccaaccggtg aaggggtaac cagcgcgcgt acgtttgtcc gtctgcgtcg ctgtgtatta 1380

gtcgatgcgt ttcgcattgt ttaa 1404

<210> 5

<211> 1020

<212> DNA

<213> alanine dehydrogenase Gene ald (Unknown)

<400> 5

gtgtacattg aaactggagc aggcttagga tcaagcttta cggatgctga ttatattgca 60

gctggtgctc atattgtgaa tactgctaag gaagcttggt cacaagagat gattatgaag 120

gtgaaagagc ctgtagcttc tgagtataat tacttttatg aaggtcaaat cctattcact 180

tacttacact tagcgccaga agttgaattg actcaggcac ttttaaataa aaaagttgta 240

gggattgcct acgaaaccgt tcaattagca aatggttcac taccgttatt aacaccaatg 300

agtgaagtag caggtaaaat ggctacacaa attggtgcac agttcttaga gagaaatcat 360

gctggtaaag ggattttact tggcggtgta tcaggtgtac aacgcggtaa agtgacagtc 420

atcggtggtg gtatcgcggg aacgaacgct gcgaaaatcg ctgttggcat gggagcagac 480

gtaacagtta tcgatttaag tcctgagcgt ttacgccaat tagaagatat gtttggccgt 540

gatgttcaaa ctttgatttc taatccttat aatattgcag aatctgtgaa aacttccgat 600

ttagtaattg gtgccgtgtt aattccaggc gcaaaagcac cgaagcttgt gtctgaagaa 660

atgattcaat caatgcaagc tggctctgta gtagtggata tcgctattga ccaaggtggt 720

atttttgctt cttcagatcg tgtcacaaca catgatgatc caacttacgt aaaacacggc 780

gttgtccatt atgcagttgc gaatatgccg ggagctgtac cacgtacatc aacaattgct 840

ttaacaaata atacaattcc ttacgcactt caaattgcaa ataaaggcta taaacaagct 900

tgcctagaca atgctgcact aaaaaaaggt gtgaatacat tagatggaca actagtatat 960

aaagctgtag cagattcaca aggaattcca tatgtcaatg tggatgagct tattcaataa 1020

<210> 6

<211> 23

<212> DNA

<213> yeeP target sequence (Unknown)

<400> 6

actgcaggac gagctgcgca cgg 23

<210> 7

<211> 23

<212> DNA

<213> ycgH target sequence (Unknown)

<400> 7

agtgtcagag gctatagcgc agg 23

<210> 8

<211> 23

<212> DNA

<213> ycnI target sequence (Unknown)

<400> 8

gaacgaaaat ggtgttgtac tgg 23

<210> 9

<211> 23

<212> DNA

<213> fhiA target sequence (Unknown)

<400> 9

tactttcatg gctggcgatc tgg 23

<210> 10

<211> 23

<212> DNA

<213> ygaY target sequence (Unknown)

<400> 10

ctcaactacc cacagttgtt ggg 23

<210> 11

<211> 24

<212> DNA

<213> pGRB-Test-S(Unknown)

<400> 11

gtctcatgag cggatacata tttg 24

<210> 12

<211> 18

<212> DNA

<213> pGRB-Test-A(Unknown)

<400> 12

atgagaaagc gccacgct 18

<210> 13

<211> 21

<212> DNA

<213> UP-yeeP-S(Unknown)

<400> 13

gctggagcgt gttgaggtag t 21

<210> 14

<211> 67

<212> DNA

<213> UP-yeeP-A(Unknown)

<400> 14

taaagttaaa caaaattatt tctagaccct atagtgagtc gtattactga ccagcgtatc 60

cagttcc 67

<210> 15

<211> 53

<212> DNA

<213> DN-yeeP-S(Unknown)

<400> 15

tggggcctct aaacgggtct tgaggggttt tttgagcgtc tgtattgcct ctg 53

<210> 16

<211> 24

<212> DNA

<213> DN-yeeP-A(Unknown)

<400> 16

gttctgttgt tccctgaatg tctt 24

<210> 17

<211> 65

<212> DNA

<213> gmas-S(Unknown)

<400> 17

tagggtctag aaataatttt gtttaacttt aagaaggaga tataccatga ccgatctggc 60

cgaat 65

<210> 18

<211> 60

<212> DNA

<213> gmas-A(Unknown)

<400> 18

agacccgttt agaggcccca aggggttatg ctagttaaat atctaaagtg tgatcgcgtt 60

<210> 19

<211> 23

<212> DNA

<213> gRNA-yeeP-S(Unknown)

<400> 19

actgcaggac gagctgcgca cgg 23

<210> 20

<211> 23

<212> DNA

<213> gRNA-yeeP-A(Unknown)

<400> 20

ccgtgcgcag ctcgtcctgc agt 23

<210> 21

<211> 20

<212> DNA

<213> UP-ycgH-S(Unknown)

<400> 21

taaactcgtc agcggcacaa 20

<210> 22

<211> 67

<212> DNA

<213> UP-ycgH-A(Unknown)

<400> 22

taaagttaaa caaaattatt tctagaccct atagtgagtc gtattagggt aggcgtttct 60

gttgatt 67

<210> 23

<211> 56

<212> DNA

<213> DN-ycgH-S(Unknown)

<400> 23

tggggcctct aaacgggtct tgaggggttt tttgccctga ataaatcctt tggtct 56

<210> 24

<211> 21

<212> DNA

<213> DN-ycgH-A(Unknown)

<400> 24

gattcaggtt gccatttacg c 21

<210> 25

<211> 69

<212> DNA

<213> xfp-S(Unknown)

<400> 25

tagggtctag aaataatttt gtttaacttt aagaaggaga tataccatgg cgagtcctgt 60

tactggcac 69

<210> 26

<211> 56

<212> DNA

<213> xfp-A(Unknown)

<400> 26

agacccgttt agaggcccca aggggttatg ctagtcactc gttatcgcca gcggtt 56

<210> 27

<211> 56

<212> DNA

<213> gRNA-ycgH-S(Unknown)

<400> 27

agtcctaggt ataatactag tagtgtcaga ggctatagcg cgttttagag ctagaa 56

<210> 28

<211> 56

<212> DNA

<213> gRNA-ycgH-A(Unknown)

<400> 28

ttctagctct aaaacgcgct atagcctctg acactactag tattatacct aggact 56

<210> 29

<211> 21

<212> DNA

<213> UP-ycnI-S(Unknown)

<400> 29

gggcaactct tcgggttaga t 21

<210> 30

<211> 80

<212> DNA

<213> UP-ycnI-A(Unknown)

<400> 30

aattgttatc cgctcacaat tccacacatt atacgagccg gatgattaat tgtcaatgta 60

ggcgttaaag caaagatgaa 80

<210> 31

<211> 89

<212> DNA

<213> DN-ycnI-S(Unknown)

<400> 31

aaagactggg cctttcgttt tatctgttgt ttgtcggtga acgctctcct gagtaggaca 60

aatttgggtg ttagatgtaa aaatgaatg 89

<210> 32

<211> 25

<212> DNA

<213> DN-ycnI-A(Unknown)

<400> 32

gcaatgacgt ctttatcatc tgaag 25

<210> 33

<211> 79

<212> DNA

<213> spuC-S(Unknown)

<400> 33

tccggctcgt ataatgtgtg gaattgtgag cggataacaa tttcacacag gaaacagacc 60

atgagcgtca acaacccgc 79

<210> 34

<211> 84

<212> DNA

<213> spuC-A(Unknown)

<400> 34

caccgacaaa caacagataa aacgaaaggc ccagtctttc gactgagcct ttcgttttat 60

ttgttattga atcgcctcaa gggt 84

<210> 35

<211> 56

<212> DNA

<213> gRNA-ycnI-S(Unknown)

<400> 35

agtcctaggt ataatactag tgaacgaaaa tggtgttgta cgttttagag ctagaa 56

<210> 36

<211> 56

<212> DNA

<213> gRNA-ycnI-A(Unknown)

<400> 36

ttctagctct aaaacgtaca acaccatttt cgttcactag tattatacct aggact 56

<210> 37

<211> 21

<212> DNA

<213> UP-fhiA-S(Unknown)

<400> 37

gggcaatggt gttgatactg g 21

<210> 38

<211> 76

<212> DNA

<213> UP-fhiA-A(Unknown)

<400> 38

aattgttatc cgctcacaat tccacacatt atacgagccg gatgattaat tgtcaaatcg 60

ccagaatcat catccc 76

<210> 39

<211> 83

<212> DNA

<213> DN-fhiA-S(Unknown)

<400> 39

aaagactggg cctttcgttt tatctgttgt ttgtcggtga acgctctcct gagtaggaca 60

aatcaagcag gagctgacgg tgt 83

<210> 40

<211> 23

<212> DNA

<213> DN-fhiA-A(Unknown)

<400> 40

tgcaccaatg ctggatactt aca 23

<210> 41

<211> 85

<212> DNA

<213> eutE-S(Unknown)

<400> 41

tccggctcgt ataatgtgtg gaattgtgag cggataacaa tttcacacag gaaacagacc 60

atgaatcaac aggatattga acagg 85

<210> 42

<211> 84

<212> DNA

<213> eutE-A(Unknown)

<400> 42

caccgacaaa caacagataa aacgaaaggc ccagtctttc gactgagcct ttcgttttat 60

ttgttaaaca atgcgaaacg catc 84

<210> 43

<211> 56

<212> DNA

<213> gRNA-fhiA-S(Unknown)

<400> 43

agtcctaggt ataatactag tgtaggtttc gctggagggc agttttagag ctagaa 56

<210> 44

<211> 56

<212> DNA

<213> gRNA-fhiA-A(Unknown)

<400> 44

ttctagctct aaaactgccc tccagcgaaa cctacactag tattatacct aggact 56

<210> 45

<211> 21

<212> DNA

<213> UP-ygaY-S(Unknown)

<400> 45

cctacaaacc acatcgcaca t 21

<210> 46

<211> 74

<212> DNA

<213> UP-ygaY-A(Unknown)

<400> 46

aattgttatc cgctcacaat tccacacatt atacgagccg gatgattaat tgtcaacacc 60

gaagcaaccc aaaa 74

<210> 47

<211> 86

<212> DNA

<213> DN-ygaY-S(Unknown)

<400> 47

aaagactggg cctttcgttt tatctgttgt ttgtcggtga acgctctcct gagtaggaca 60

aatttttaac tacagcgatg gtgtca 86

<210> 48

<211> 23

<212> DNA

<213> DN-ygaY-A(Unknown)

<400> 48

ggagtagggc tttccataga gtg 23

<210> 49

<211> 85

<212> DNA

<213> alD-S(Unknown)

<400> 49

tccggctcgt ataatgtgtg gaattgtgag cggataacaa tttcacacag gaaacagacc 60

atgaagattg gtattccaaa ggaaa 85

<210> 50

<211> 90

<212> DNA

<213> alD-A(Unknown)

<400> 50

caccgacaaa caacagataa aacgaaaggc ccagtctttc gactgagcct ttcgttttat 60

ttgttattgg attaattcat ccacattcac 90

<210> 51

<211> 56

<212> DNA

<213> gRNA-ygaY-S(Unknown)

<400> 51

agtcctaggt ataatactag taaacggaac ccaacaactg tgttttagag ctagaa 56

<210> 52

<211> 56

<212> DNA

<213> gRNA-ygaY-A(Unknown)

<400> 52

ttctagctct aaaacacagt tgttgggttc cgtttactag tattatacct aggact 56

Claims

1. A genetically engineered bacterium for producing L-theanine by fermentation of glucose from the head is characterized in that: the genetically engineered strain contains gamma-glutamyl methylamine synthetase for theanine synthesis and genes encoding theanine de novo pathway enzymes including phosphoketolase, transaminase, acetaldehyde dehydrogenase, and alanine dehydrogenase.

2. The genetically engineered bacterium for producing L-theanine by fermentation from the head using glucose according to claim 1, wherein: the genetic engineering strain takes escherichia coli or corynebacterium glutamicum as an initial strain;

3. The genetically engineered bacterium for producing L-theanine by fermentation from the head using glucose according to claim 2, wherein: the genetic engineering strain takes E.coli ATCC27325 or C.glutamicum ATCC13032 as an initial strain;

4. The genetically engineered bacterium for producing L-theanine by fermentation from the head using glucose according to any one of claims 1 to 3, wherein: the genetic engineering strain contains genes of gmas, xfp, spuC, eutE and alD, and the gene sequences are SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5 in sequence.

5. The genetically engineered bacterium for producing L-theanine by fermentation with glucose from the head according to claim 4, wherein: the genes of the gmas, xfp, spuC, eutE and alD are wild genes, or are mutants of coding corresponding proteins or artificially modified genes, and comprise one or more amino acid residues which are substituted, deleted or inserted at one or more sites, and the proteins coded by the mutants or the artificially modified genes have corresponding activities and do not have functional defects.

6. The method for constructing a genetically engineered bacterium according to claim 4 or 5, wherein: the method comprises the following steps:

(3) integration of the transaminase-encoding gene spuC from P _trc Promoter initiation;

the order of operations of steps (1) to (5) in the above-described construction method is not limited, and can be performed in any order that can be implemented.

7. The construction method according to claim 6, wherein: the construction method comprises the steps of carrying out gene integration by using a CRISPR/Cas9 mediated gene editing technology;

or the construction method comprises the steps of constructing a recombinant fragment and a pGRB plasmid, simultaneously transforming the pGRB plasmid and the recombinant fragment into an electrotransfer competent cell containing pREDCas9, and eliminating the plasmid to obtain the recombinant genetic engineering strain.

8. The construction method according to claim 7, wherein: the construction of the pGRB plasmid comprises: designing a target sequence, preparing a DNA fragment containing the target sequence, and recombining the DNA fragment containing the target sequence with the linearized vector fragment;

9. Use of the genetically engineered bacterium of any one of claims 1 to 5 for fermentative production of theanine.

10. A method for producing theanine by fermentation of the genetically engineered bacterium according to any one of claims 1 to 5, wherein: the method comprises the following steps: contacting the genetic engineering strain with a fermentation culture medium, and performing fermentation culture to prepare theanine;

the fermentation culture comprises shake flask fermentation or fermentation tank fermentation;

when in shake flask fermentation, the inoculum size of the genetic engineering strain is 15-20%, the fermentation condition is 37 ℃, shaking culture is carried out at 220r/min, the pH is maintained at 6.7-7.2 in the fermentation process, the pH is adjusted by supplementing ammonia water, glucose solution is supplemented to maintain fermentation, and the fermentation is carried out for 26-30h, thus obtaining the strain;