CN107955814B - Promoter for improving protein expression efficiency - Google Patents
Promoter for improving protein expression efficiency Download PDFInfo
- Publication number
- CN107955814B CN107955814B CN201711376849.9A CN201711376849A CN107955814B CN 107955814 B CN107955814 B CN 107955814B CN 201711376849 A CN201711376849 A CN 201711376849A CN 107955814 B CN107955814 B CN 107955814B
- Authority
- CN
- China
- Prior art keywords
- promoter
- vector
- expression
- mutation
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/67—General methods for enhancing the expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01056—Glucuronosyl-disulfoglucosamine glucuronidase (3.2.1.56), i.e. glycuronidase
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a promoter for improving protein expression efficiency, and belongs to the field of promoter engineering. The promoter P involved in the method of the inventionBH4Is in the promoter PsrfAOn the basis of the gene sequence, the gene is formed by mutational transformation of a core region. In the novel promoter PBH4For expression of Green Fluorescent Protein (GFP) under control of transcription, P was usedBH4The expression amount of (A) is PsrfA3.5 times of that of the case where glucuronidase A (GusA) is expressed, P is usedBH4The enzyme activity is improved from 0.6U/ml to 8.9 plus or minus 0.1U/ml.
Description
Technical Field
The invention relates to a promoter for improving protein expression efficiency, and belongs to the field of promoter engineering.
Background
The Bacillus subtilis expression system is considered as a GRAS-grade organism, can secrete functional protein into a culture medium, has simple separation and purification processes, and is widely used as a host bacterium for expressing heterologous protein at present. The most widely used host bacteria of Bacillus subtilis are Bacillus subtilis 168 strain and mutant strains of Bacillus subtilis 168 series (such as WB600, WB700, WB800, etc.), and the host bacteria selected for use in the present invention are Bacillus subtilis 168.
The gene expression system is a complex process, and the current hay expression system is not mature. In recent years, researchers have made great progress in secretion and expression of foreign proteins by bacillus subtilis, and an effective foreign protein bacillus subtilis expression system has been established. In the process of modifying the vector system, the promoter regulatory element plays a central role, and the selection of a strong promoter can ensure that the cloned gene can be expressed at a high level. Therefore, starting from the promoter, designing a strong promoter element and constructing a mature and efficient hay expression system have very important significance in both theoretical research and actual production.
Disclosure of Invention
The invention aims to provide a mutant bacillus subtilis promoter and a method for efficiently expressing a foreign protein in bacillus subtilis 168 by using the promoter. Because the promoter is an important element of a gene engineering expression vector and has great influence on the expression level of an exogenous gene, the invention obtains a mutant promoter for improving the activity by adopting a mode of performing directed evolution on a core element of a promoter gene on the basis of a strong promoter gene sequence. The new promoter constructed by the method effectively improves the expression amount of heterologous protein in the bacillus subtilis.
The first purpose of the invention is to provide a promoter for improving the secretion expression efficiency of protein, which comprises a nucleotide sequence shown in SEQ ID NO. 1.
The second object of the present invention is to provide a vector containing the promoter for improving the efficiency of secretory expression of a protein.
The third purpose of the invention is to provide a gene engineering bacterium with improved protein expression efficiency, which expresses protein by a vector containing the promoter for improving protein secretion expression efficiency.
In one embodiment of the invention, the protein includes, but is not limited to, an enzyme.
In one embodiment of the invention, the protein comprises an oxidoreductase, transferase, hydrolase, lyase, isomerase, or synthetase.
The fourth purpose of the invention is to provide a construction method of the genetic engineering bacteria, which comprises the following steps: (1) the promoter of claim 1 is linked to a vector or substituted for a promoter of the vector itself to obtain a plasmid containing the novel promoterNovel promoters(ii) a (2) Mixing the plasmidsNovel promotersConnecting with exogenous gene to obtain plasmid containing new promoterNovel promoter-foreign gene(ii) a (3) Mixing the plasmidsNovel promoter-foreign geneTransformed into a bacterial or fungal cell.
The fifth purpose of the invention is to provide a method for improving the secretory expression efficiency of a promoter, which is to perform 3-7 bp mutation on a nucleotide sequence at the upstream of a promoter-10 region.
In one embodiment of the invention, the mutation is a degenerate mutation of 3bp of bases upstream of the-10 region.
In one embodiment of the invention, the mutation is a degenerate mutation of 3bp bases upstream of the-10 region and a further mutation of 4bp bases upstream of the 3bp bases on the basis of the mutated 3bp bases.
In one embodiment of the invention, the method takes a promoter shown in SEQ ID NO.2 as a parent sequence, degenerates and mutates 3bp bases at the upstream of a-10 region, and mutates 4bp bases adjacent to the upstream of the 3bp bases on the basis of the mutated 3bp bases to obtain a mutant shown in SEQ ID NO. 1.
In one embodiment of the invention, the mutation is a degenerate mutation.
The sixth purpose of the invention is to provide the application of the promoter for improving the protein secretion expression efficiency in the aspect of producing protein-containing products.
In one embodiment of the invention, the use comprises preparing glucuronidase a.
In one embodiment of the invention, the application is that a gene coding for glucuronidase A is connected with a vector containing the promoter for improving the protein secretion expression efficiency, and the gene is transformed into a host cell for fermentation.
In one embodiment of the invention, the gene encoding glucuronidase A contains a nucleotide sequence shown in SEQ ID NO. 3.
In one embodiment of the invention, the host cell is Bacillus subtilis.
In one embodiment of the invention, the host cell is Bacillus subtilis 168.
In one embodiment of the invention, the fermentation is carried out at 35-37 ℃ for 8-52 h.
The novel promoter is PBH4. Is constructed by taking PsrfA as an initial promoter. The plasmid vectors, in the present invention, were pBBH4-GFP and pBBH 4-gusA.
The invention has the beneficial effects that: the invention adopts the directional evolution mode to obtain the mutant promoter P capable of improving the yield of the foreign proteinBH4The promoter can efficiently express exogenous genes in bacillus subtilis. Mutant promoter PBH4The transcription activity is higher than that of the original promoter PsrfAThe expression level of PBH4 is increased by more than 6 times when expressing Green Fluorescent Protein (GFP) by using PsrfA3.5 times of that of the case where glucuronidase A (GusA) is expressed, P is usedBH4The maximum enzyme activity is improved from 0.6U/ml to 8.9 plus or minus 0.1U/ml.
Drawings
FIG. 1: psrfAConstructing a strategy of a promoter mutant library;
FIG. 2: validation of the expression ability of different promoters at shake flask level a: growth curve, b: GFP expression curve, c: comparison of fluorescence intensity for 24h, d: detecting the expression quantity of GFP by SDS-PAGE; wherein WT is a wild-type promoter PsrfAExpressing GFP; BH4 as mutant promoter PBH4Expressing GFP;
FIG. 3: expression of GusA in recombinant Bacillus subtilis; a: growth curve and enzyme activity assay, b: SDS-PAGE detection; wherein BSGUs is wild promoter PsrfAExpression ofGusA; BSBHGuS is mutant promoter PBH4Expressing GusA.
Detailed Description
1. The GFP fluorescence intensity detection method comprises the following steps: centrifuging the sample at 12000 Xg for 2min, collecting thallus, washing with PBS buffer solution for 3 times, diluting the thallus suspension with PBS to a certain concentration, taking 200. mu.L to 96-hole enzyme label plate, and placing the plate into a SynergyTM H4 fluorescence enzyme label instrument to detect fluorescence. Excitation light at 495nm and absorption light at 525nm were detected for fluorescence.
2. The GusA enzyme activity detection method comprises the following steps:
to 50. mu.L of cell lysate was added 0.5 mg/mL in a 96-well plate-1The substrate solution (pH 7.0) of 4-nitrophenyl β -d-glucuronide (PNPG) was reacted at 37 ℃ for 5min, 100. mu.L of Na was added to a final concentration of 1M2CO3The reaction was terminated. The sample is put into a SynergyTM H4 fluorescence microplate reader to detect the light absorption value at 405 nm. And calculating enzyme activity according to a standard curve.
Definition of enzyme activity: at 37 ℃ and pH of 7.0, the enzyme amount required for converting the product p-nitrophenol into 1mmol per minute is 1U of enzyme activity unit.
3. Culture medium: LB Medium (L)-1): 10g of tryptone, 10g of NaCl, 5g of yeast extract and pH 7.0, and 20g of agar powder is added when preparing a solid culture medium.
4. The culture conditions are as follows: the recombinant strain is taken out from a refrigerator at the temperature of-80 ℃, streaked on an LB plate containing corresponding resistance, and a single colony is picked up and placed in a test tube containing 5mL of LB culture medium for 200 r.min-1The cells were cultured overnight at 37 ℃. Then transferred into a 250mL shake flask containing 50mL LB medium at an inoculum size of 2% for cultivation.
5. Transformation method of Bacillus subtilis 168: selecting a single colony BS168, inoculating the single colony BS168 into 2mL of SPI culture medium, and carrying out shake cultivation at 37 ℃ overnight; mu.L of the overnight culture was inoculated into 5mL of SPI medium and shaken at 37 ℃ for 4-5h before OD measurement600. When OD is reached600About 1.0, 200. mu.L of the suspension was transferred to 2mL of SPII medium at 37 ℃ and 100 r.min-1Shaking for 1.5 hr, adding 20 μ L l00 XEGTA (ethylene glycol bis (α -aminoethyl ether) tetraacetic acid) solution into the tube, and incubating at 37 deg.C for 100r min-1Culturing in a shaking table for 10min, and subpackaging 500 mu L per l.5mL centrifuge tube; adding proper amount of plasmid verified to be correct by sequencing into the tube, blowing, sucking, mixing uniformly, and placing at 37 deg.C for 100r min-1Culturing for 2h in a shaking table; after the culture, about 200. mu.L of the culture solution was aspirated and uniformly applied to the corresponding selective plate, and cultured overnight at 37 ℃.
Example 1: psrfAPromoter mutant library construction strategy
With PsrfA-3bp-1 and PsrfA-3bp-2 (Table 1) as a primer, and pBSG03 (disclosed in C.guan, W.cui, J.Cheng, L.Zhou, J.Guo, X.Hu, G.Xiao, Z.Zhou, Construction and maintenance of an auto-regulatory gene expression system in Bacillus subtilis, Microb.cell Fact.14(2015)) as a template, for P.Guan, W.Cui, J.Cheng.L.Zhou, J.Guo, X.Hu, G.Xiao, Z.Zhou, P.srfAPromoter (SEQID NO.1) sigmaAThe degenerate mutation was carried out 3bp upstream of the "-10 region" recognition core region (FIG. 1). And is based on a 3bp mutation with PsrfA-4bp-1 and PsrfA-4bp-2 (Table 1) as primer, 3bp mutated plasmid as template, for PsrfAPromoter sigmaAIdentifying 4bp upstream of "-10" of the core region, carrying out degenerate mutation to obtain PsrfAMutant, designated PBH4。
TABLE 1 primers
Example 2: promoter PBH4Verification of shaking flask experiment
P obtained by screeningBH4The promoter was used for shake flask experimental validation. Will PBH4The promoter was ligated with vector pBSG03 and GFP gene encoding green fluorescent protein to obtain pBBH 4-GFP. The pBBH4-GFP plasmid was transformed into B.subtilis 168 competent cells and these transformants were verified for GFP expression in a 250ml shake flask system, and the wild type strain (as unmutated P) cultured under the same conditions was usedsrfAPromoters expressing the same gene, the vector and host remaining identical) as a control.
The results show that the mutant promoter P is containedBH4Growth curve of plasmid expression GFP and wild type strain baseThis is consistent (FIG. 2-a), and both wild type and mutant promoters rapidly increased in activity in the middle and late stages of logarithmic cell growth (FIG. 2-b), consistent with PsrfAThe promoter is activated by quorum sensing signals. Screening obtained mutant promoter PBH4The activity of the promoter is greatly improved compared with that of a wild promoter, and after 24 hours, the expression fluorescence intensity is that of the wild promoter PsrfA3.5 times of the total weight of the powder. The SDS-PAGE results were consistent with the GFP fluorescence (FIG. 2-d) to contain mutant promoter PBH4The expression quantity of the plasmid expression GFP is obviously higher than that of the wild promoter PsrfAThe expression level of (3).
Example 3: expression of glucuronidase A in recombinant bacillus subtilis
The mutant promoter P of example 2BH4Respectively used for the expression of glucuronidase A (GusA) (the sequence is shown as SEQ ID NO. 3), the implementation process mainly replaces the gene GFP in the original vector with GusA, and the primer PgusA-i1，PgusA-i2 for use in amplification of the glucuronidase A gene, P, from Escherichia coli JM109 genomegusA-v1，PgusA-v2 for amplification of plasmids containing the wild type promoter PsrfA and the mutant promoter P from pBSG03 and pBBH4-GFPBH4The vector constructs of (1), finally constructing plasmids pBS-gusA and pBBH 4-gusA. The two plasmids are transformed into bacillus subtilis cells, cultured and the expression effect is measured. As shown in FIG. 3, after 8h of culture, the expression level of GusA was increased from 0.17. + -. 0.03U/ml to 3.31. + -. 0.04U/ml; after 12h of culture, the GusA expression level is increased from 0.30 plus or minus 0.04U/ml to 7.75 plus or minus 0.04U/ml; after 28h of culture, the GusA expression level is increased from 0.43 + -0.03U/ml to 8.9 + -0.1U/ml.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of south of the Yangtze river
<120> a promoter for improving protein expression efficiency
<160>3
<170>PatentIn version 3.3
<210>1
<211>607
<212>DNA
<213> Artificial sequence
<400>1
atcgacaaaa atgtcatgaa agaatcgttg taagacgctc ttcgcaaggg tgtctttttt 60
tgcctttttt tcggtttttg cgcggtacac atagtcatgt aaagattgta aattgcattc 120
agcaataaaa aaagattgaa cgcagcagtt tggtttaaaa atttttattt ttctgtaaat 180
aatgtttagt ggaaatgatt gcggcatccc gcaaaaaata ttgctgtaaa taaactggaa 240
tctttcggca tcccgcatga aacttttcac ccatttttcg gtgataaaaa catttttttg 300
tggtaaactg aacggtagaa agataaaaaa tattgaaaac aatgaataaa tagccaaaat 360
tggtttctta ttagggtggg gtcttgcggt ctttatccgc ttatgttaaa cgccgcaatg 420
ctgactgacg gcagcctgct ttaatagcgg ccatctgttt tttgattgga agcactgctt 480
tttaagtgta gtactttggg ctatttcggc tgttagttca taagaattaa aagctgatat 540
ggataagaaa gagaaaatgc gttgcacatg ttcactgctt ataaagatta ggggaggtat 600
gacaatg 607
<210>2
<211>607
<212>DNA
<213> Artificial sequence
<400>2
atcgacaaaa atgtcatgaa agaatcgttg taagacgctc ttcgcaaggg tgtctttttt 60
tgcctttttt tcggtttttg cgcggtacac atagtcatgt aaagattgta aattgcattc 120
agcaataaaa aaagattgaa cgcagcagtt tggtttaaaa atttttattt ttctgtaaat 180
aatgtttagt ggaaatgatt gcggcatccc gcaaaaaata ttgctgtaaa taaactggaa 240
tctttcggca tcccgcatga aacttttcac ccatttttcg gtgataaaaa catttttttc 300
atttaaactg aacggtagaa agataaaaaa tattgaaaac aatgaataaa tagccaaaat 360
tggtttctta ttagggtggg gtcttgcggt ctttatccgc ttatgttaaa cgccgcaatg 420
ctgactgacg gcagcctgct ttaatagcgg ccatctgttt tttgattgga agcactgctt 480
tttaagtgta gtactttggg ctatttcggc tgttagttca taagaattaa aagctgatat 540
ggataagaaa gagaaaatgc gttgcacatg ttcactgctt ataaagattaggggaggtat 600
gacaatg 607
<210>3
<211>1806
<212>DNA
<213> Artificial sequence
<400>3
ttacgtcctg tagaaacccc aacccgtgaa atcaaaaaac tcgacggcct gtgggcattc 60
agtctggatc gcgaaaactg tggaattgat cagcgttggt gggaaagcgc gttacaagaa 120
agccgggcaa ttgctgtgcc aggcagtttt aacgatcagt tcgccgatgc agatattcgt 180
aattatgcgg gcaacgtctg gtatcagcgc gaagtcttta taccgaaagg ttgggcaggc 240
cagcgtatcg tgctgcgttt cgatgcggtc actcattacg gcaaagtgtg ggtcaataat 300
caggaagtga tggagcatca gggcggctat acgccatttg aagccgatgt cacgccgtat 360
gttattgccg ggaaaagtgt acgtatcacc gtttgtgtga acaacgaact gaactggcag 420
actatcccgc cgggaatggt gattaccgac gaaaacggca agaaaaagca gtcttacttc 480
catgatttct ttaactatgc cgggatccat cgcagcgtaa tgctctacac cacgccgaac 540
acctgggtgg acgatatcac cgtggtgacg catgtcgcgc aagactgtaa ccacgcgtct 600
gttgactggc aggtggtggc caatggtgat gttagcgttg aactgcgtga tgcggatcaa 660
caggtggttg caactggaca aggcactagc gggactttgc aagtggtgaa tccgcacctc 720
tggcaaccgg gtgaaggtta tctctatgaa ctgtgcgtca cagccaaaag ccagacagag 780
tgtgatatct acccgcttcg cgtcggcatc cggtcagtgg cagtgaaggg cgaacagttc 840
ctgattaacc acaaaccgtt ctactttact ggctttggtc gtcatgaaga tgcggacttg 900
cgtggcaaag gattcgataa cgtgctgatg gtgcacgacc acgcattaat ggactggatt 960
ggggccaact cctaccgtac ctcgcattac ccttacgctg aagagatgct cgactgggca 1020
gatgaacatg gcatcgtggt gattgatgaa actgctgctg tcggctttaa cctctcttta 1080
ggcattggtt tcgaagcggg caacaagccg aaagaactgt acagcgaaga ggcagtcaac 1140
ggggaaactc agcaagcgca cttacaggcg attaaagagc tgatagcgcg tgacaaaaac 1200
cacccaagcg tggtgatgtg gagtattgcc aacgaaccgg atacccgtcc gcaaggtgca 1260
cgggaatatt tcgcgccact ggcggaagca acgcgtaaac tcgacccgac gcgtccgatc 1320
acctgcgtca atgtaatgtt ctgcgacgct cacaccgata ccatcagcga tctctttgat 1380
gtgctgtgcc tgaaccgtta ttacggatgg tatgtccaaa gcggcgattt ggaaacggca 1440
gagaaggtac tggaaaaaga acttctggcc tggcaggaga aactgcatca gccgattatc 1500
atcaccgaat acggcgtgga tacgttagcc gggctgcact caatgtacac cgacatgtgg 1560
agtgaagagt atcagtgtgc atggctggat atgtatcacc gcgtctttga tcgcgtcagc 1620
gccgtcgtcg gtgaacaggt atggaatttc gccgattttg cgacctcgca aggcatattg 1680
cgcgttggcg gtaacaagaa agggatcttc actcgcgacc gcaaaccgaa gtcggcggct 1740
tttctgctgc aaaaacgctg gactggcatg aacttcggtg aaaaaccgca gcagggaggc 1800
aaacaa 1806
Claims (9)
1. A promoter is characterized in that the nucleotide sequence is shown as SEQ ID NO. 1.
2. A vector comprising the promoter of claim 1.
3. A genetically engineered bacterium comprising the vector of claim 2, wherein the vector expresses a protein.
4. The genetically engineered bacterium of claim 3, wherein the protein comprises an enzyme.
5. The method for constructing the genetically engineered bacterium of claim 3, comprising the steps of: (1) the promoter of claim 1 is linked to a vector or substituted for a promoter of the vector itself to obtain a plasmid containing the novel promoterNovel promoters(ii) a (2) Mixing the plasmidsNovel promotersConnecting with exogenous gene to obtain plasmid containing new promoterNovel promoter-foreign gene(ii) a (3) Mixing the plasmidsNovel promoter-foreign geneTransformed into a bacterial or fungal cell.
6. A method for improving the secretory expression efficiency of a promoter is characterized in that the promoter shown in SEQ ID No.2 is used as a parent starting sequence, and 3-7 bp mutation is carried out on a nucleotide sequence at the upstream of a promoter-10 region to obtain the nucleotide sequence shown in SEQ ID No. 1.
7. The method of claim 6, wherein the mutation is a degenerate mutation to 3bp of bases upstream of the-10 region; or carrying out degenerate mutation on the 3bp base at the upstream of the-10 region, and carrying out mutation on the 4bp base at the upstream of the 3bp base on the basis of the mutated 3bp base.
8. Use of the promoter of claim 1 for the production of a protein-containing product.
9. Use of the promoter of claim 1 for the fermentative production of glucuronidase a.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711376849.9A CN107955814B (en) | 2017-12-19 | 2017-12-19 | Promoter for improving protein expression efficiency |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711376849.9A CN107955814B (en) | 2017-12-19 | 2017-12-19 | Promoter for improving protein expression efficiency |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107955814A CN107955814A (en) | 2018-04-24 |
| CN107955814B true CN107955814B (en) | 2020-02-07 |
Family
ID=61959391
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711376849.9A Active CN107955814B (en) | 2017-12-19 | 2017-12-19 | Promoter for improving protein expression efficiency |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107955814B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1240482A (en) * | 1996-11-18 | 2000-01-05 | 诺沃诺尔迪斯克生物技术有限公司 | Methods for producing polypeptides in surfaction mutants of bacillus cells |
| CN106916819A (en) * | 2017-04-28 | 2017-07-04 | 江南大学 | Bacillus subtilis promoter and its build and application that a kind of activity is improved |
-
2017
- 2017-12-19 CN CN201711376849.9A patent/CN107955814B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1240482A (en) * | 1996-11-18 | 2000-01-05 | 诺沃诺尔迪斯克生物技术有限公司 | Methods for producing polypeptides in surfaction mutants of bacillus cells |
| CN106916819A (en) * | 2017-04-28 | 2017-07-04 | 江南大学 | Bacillus subtilis promoter and its build and application that a kind of activity is improved |
Non-Patent Citations (3)
| Title |
|---|
| 《Development of a novel strategy for robust synthetic bacterial promoters based on a stepwise evolution targeting the spacer region of the core promoter in Bacillus subtilis》;Han Laichuang等;《MICROBIAL CELL FACTORIES》;20190529;第18卷;第1-14页 * |
| 《Enhancement of a high efficient autoinducible expression system in Bacillus subtilis by promoter engineering》;Cheng Jintao等;《PROTEIN EXPRESSION AND PURIFICATION》;20160715;第127卷;第 81-87页 * |
| 《Fabrication and characterization of a robust and strong bacterial promoter from a semi-rationally engineered promoter library in Bacillus subtilis》;Han Laichuang等;《PROCESS BIOCHEMISTRY》;20170701;第61卷;第56-62页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107955814A (en) | 2018-04-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106148265B (en) | It is a kind of produce chondroitinase recombined bacillus subtilis and its application | |
| CN106754466A (en) | It is a kind of for efficient exogenous protein expression and the bacillus subtilis of High Density Cultivation | |
| CN110157654B (en) | Bacillus natto recombinant strain and construction method and application thereof | |
| CN103937830B (en) | A kind of recombinant bacterium of efficient secretory expression Nattokinase | |
| CN104004760B (en) | A kind of expression equipment and its aspergillus oryzae genetic engineering bacterium being used in Aspergillus oryzae cell secreting, expressing foreign protein | |
| CN107955814B (en) | Promoter for improving protein expression efficiency | |
| CN108102934B (en) | Aspergillus niger strain capable of producing pectin lyase at high yield | |
| AU2020204574B2 (en) | B.licheniformis engineering bacteria for inhibiting bacterial autolysis, construction method and application thereof | |
| CN115717135A (en) | Heat-resistant xylosidase mutant and preparation thereof | |
| CN110819609B (en) | Mutant lipase with improved thermal stability as well as preparation method and application thereof | |
| CN110878293B (en) | Application of bacillus licheniformis with deletion of yceD gene in production of heterologous protein | |
| CN114644987A (en) | Aspergillus niger strain for improving L-malic acid production level and fermentation intensity, method and application | |
| CN109852650B (en) | Artificial aptamer enzyme regulated and controlled by theophylline and application | |
| CN114058606A (en) | Application of bacillus licheniformis with deleted xpt gene in production of heterologous protein | |
| CN108949579B (en) | Thermoascus thermophilus gene expression system | |
| CN113564064A (en) | Genetic engineering improvement method for improving carbon source conversion rate of pichia pastoris | |
| CN116622702A (en) | Novel artificially designed bacillus subtilis terminator and application thereof | |
| CN114540397B (en) | Method for enhancing regulatory protein expression to increase glutamine transaminase fermentation level | |
| WO2024109169A1 (en) | Mature polypeptide sequences for synthesizing hmos and use thereof | |
| CN113755474B (en) | Carboxypeptidase, and coding gene and application thereof | |
| CN117701487B (en) | Bacillus licheniformis engineering bacteria for efficiently expressing amylase genes and application thereof | |
| WO2024103825A1 (en) | Mature polypeptide sequence for synthesizing oligosaccharide and use | |
| WO2024103822A1 (en) | Mature polypeptide for synthesizing oligosaccharides | |
| CN106635942B (en) | Engineering bacterium for stably displaying trehalose synthase on surface of spore and construction method thereof | |
| CN116814628A (en) | Myceliophthora thermophila small molecule heat shock protein constitutive strong promoter Phsp and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |