CN107129996A

CN107129996A - One plasmid vector and its construction method and application

Info

Publication number: CN107129996A
Application number: CN201610107520.1A
Authority: CN
Inventors: 王洪凯; 林福呈
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2016-02-26
Filing date: 2016-02-26
Publication date: 2017-09-05
Anticipated expiration: 2036-02-26
Also published as: CN107129996B

Abstract

The invention discloses a plasmid vector and its construction method and application, the plasmid vector is built by pCAMBIA1300 transformations and formed, in pCAMBIA1300 multiple cloning sites insertion grape seat chamber bacterium histone H3 gene promoter, grape seat chamber bacterium transcriptional elongation factor α gene promoters, resistant gene, the resistant gene is located at the downstream of grape seat chamber bacterium transcriptional elongation factor α gene promoters.Grape seat chamber bacterium histone H3 gene and the section of transcriptional elongation factor α gene promoters that the present invention is selected, can efficiently start the gene being connected to below, therefore greatly improve the transformation efficiency of the plasmid vector；The present invention establishes the method using agriculture bacillus mediated exogenous gene high-efficient conversion grape seat chamber bacterium, for the genetic modification of the bacterium, the useful gene of exploitation, separate the drug target gene of disease fungus, study the gene function of the bacterium in terms of research and development feasible scheme is provided.

Description

One plasmid vector and its construction method and application

Technical field

The invention belongs to microbial technology field, and in particular to a plasmid vector and its construction method and application.

Background technology

Grape seat chamber bacterium (Botryosphaeria dothidea) is a kind of important fungi of common distribution on global, with important exploitation Value.What this kind of fungi had can cause woody plant with the saprophytic parasitism on a variety of xylophytas in various rotten woods, having The disease of thing, what is had forms homobium with plant, is the endogenetic fungus of many plants.The grape seat of saprogenesis is sought in rotten wood Chamber bacterium can play an important roll xylophyta Residue decay in the material circulation of the ecosystem and energy circulation；Meanwhile, This kind of fungi can also be developed to produce lignoenzyme and cellulase, with good economic development prospect.And belong to interior life The bacterial strain of fungi can be as bioreactor, and the fungal strain such as separated from Atlas cedar can produce 15 kinds of new chemical combination Thing, wherein there is 3 kinds there is disease-resistant fungal pathogen, anti-oxidation function.

Also there is Development volue as the grape seat chamber bacteria strain of phytopathogen, be important living resources to be developed.Pathogenic Bacterium will successfully infect host plant, just allow for overcoming the defense response of plant, can also pass through the plants such as plant epidermis Physical protection barrier.Therefore, phytopathogen tends to produce extracellular digestive enzymes more more than saprophytic bacteria and other effectors, Decline the defense response of plant, and plant epidermis cell wall constituent is subjected to necessary degraded.

The genomic sequence analysis result of some fungies is also indicated that, compared with saprophytic fungus, is contained in the genome of plant pathogenic fungi There are more cell wall degradation enzyme genes, and the cell wall degradation enzyme gene contained in the genome of endogenetic fungus is minimum.Therefore, Phytopathogen can develop into the living resources of production cell-wall degrading enzyme class, such as degraded crop material or forest residuum, in environment There is good application prospect in terms of protection, biomass energy exploitation.Can be with as the grape seat chamber bacteria strain of phytopathogen Specific functional compounds are produced for bioconversion, such as nootkatone (Nootkatone) is the important raw material of industry, grape seat chamber bacterium Valencia orange alkene can be converted into nootkatone Nootkatone, in diet products, the health product of strengthen immunity and beauty Product.

With the development of modern biotechnology, Protocols in Molecular Biology is combined together with traditional biological technology, is promoted significantly Enter biological study and the development of biological industry, either to the molecular modification of biological cell, or the useful gene of clone, It is required for setting up gene transformation into transformation system, this is the premise that molecular modification and research are carried out to cell.Pin To the grape seat this fungi with Important Economic meaning of chamber bacterium, up to now, the genetic transformation efficiency of the bacterium is than relatively low.

For example, plasmid pKO1-HPH is the carrier commonly used in filamentous fungi genetic transformation, agriculture bacillus mediated method can be used, Genetic transformation is carried out to a variety of sac fungus.Alternatively marked containing the hygromycin controlled by TrPC promoters a gene thereon Note, is also used as report with green fluorescent protein (GFP) gene controlled by rice pyriform spore bacterium histone H3 gene promoter Gene.But this seminar in early-stage Study with this plasmid convert grape seat chamber bacterium when, find transformation efficiency it is low, green it is glimmering Photoprotein expression is very weak.

Therefore, this seminar constructs new selection markers, and it is incorporated on the carrier available for Agrobacterium-mediated Transformation, establishes profit With agriculture bacillus mediated exogenous DNA Efficient Conversion system, it is the genetic modification of such fungi, develops useful gene, separates The drug target gene of disease fungus, the research and development studied in terms of the gene function of the bacterium provide feasible scheme.

The content of the invention

The invention provides a plasmid vector, solve existing plasmid be transformed into grape seat chamber bacterium when, the problem of transformation efficiency is low.

One plasmid vector, is built by pCAMBIA1300 transformations and is formed, Portugal is inserted in pCAMBIA1300 multiple cloning sites Grape seat chamber bacterium histone H3 gene promoter, grape seat chamber bacterium transcriptional elongation factor α gene promoters, resistant gene, it is described Resistant gene is located at the downstream of grape seat chamber bacterium transcriptional elongation factor α gene promoters.

Plasmid pCAMBIA1300 is used for the Agrobacterium-mediated genetic transformation of various plants earliest, later for agriculture bacillus mediated Genetic transformation many plasmid vectors be also it is built-up on the basis of this carrier, the present invention be also use PCAMBIA1300 is used as initial carrier.

In general eukaryotic cells, histone H3 gene and transcriptional elongation factor α genes are closed in cell division and RNA biologies There is critical function in, the promoter of the two genes is all strong promoter in cell.Present invention selection grape seat chamber bacterium group The strong promoter that albumen H3 gene promoters are expressed as regulation and control foreign gene (such as GFP) height, and grape seat chamber bacterium transcription elongation Factor-alpha gene promoter as conversion grape seat chamber bacterium cell when selection markers strong promoter.

Research of the present invention has shown that the transformation efficiency that the plasmid vector of structure is transformed into grape seat chamber bacterium turns far above conventional at present Change carrier.By taking carrier pKO1-hph conventional at present as an example, under identical conversion condition, obtained using pKO1-hph as carrier When the transformant obtained averagely only has 3,13~20 transformants are resulted in using the plasmid vector of the present invention.

Preferably, the resistant gene is hygromycin gene.Contain hygromycin in initial carrier pCAMBIA1300 Resistant gene, but its promoter is 35S promoter, expression efficiency is very low in fungi, in grape seat chamber bacterium cell almost Do not express.Research is found, is compared with control vector pKO1-hph, hygromycin gene in the plasmid vector that the present invention is built Expression quantity be higher by more than 10 times, it was demonstrated that grape seat chamber bacterium transcriptional elongation factor α Gene Promoter hygromycin genes exist High expression in grape seat chamber bacterium cell, is conducive to the screening of transformant.

Preferably, reporter gene is inserted in the downstream of grape seat chamber bacterium histone H3 gene promoter, can be by reporting base Because demarcating the expression of target gene, the target gene can be GFP genes.

It is of the invention that two plasmids are specifically provided, be specially：

One plasmid vector, is named as pBDH3G-Thy1, and size is 11219bp, wherein grape seat chamber bacterium histone H 3 base Because the nucleotide sequence of promoter is as shown in SEQ ID NO.1, the grape seat chamber bacterium transcriptional elongation factor α gene promoters Nucleotide sequence is as shown in SEQ ID NO.2.

Another plasmid vector, is named as pBDH3G-Thy2, and size is 10217bp, and the difference with pBDH3G-Thy1 exists In, only used grape seat chamber bacterium transcriptional elongation factor α gene promoter DNA fragmentations a part.The grape seat chamber bacterium turns The nucleotide sequence of elongation factor α gene promoters is recorded as shown in SEQ ID NO.3.

Present invention also offers the construction method for building the plasmid vector, comprise the following steps：

(1) amplification is respectively comprising grape seat chamber bacterium histone H3 gene promoter, grape seat chamber bacterium transcriptional elongation factor α The DNA fragmentation of gene promoter and the resistant gene；

(2) DNA fragmentation is inserted into by pCAMBIA1300 carriers by recombining reaction, obtains described plasmid vector.

Particular by design specific primer 5 ' and 3 ' least significant ends of the PCR primer amplified are respectively provided with and adjacent segment The corresponding completely the same sequence of least significant end, in the presence of recombinase, completes directed cloning.

Preferably, GFP genes are inserted in the grape seat chamber bacterium histone H3 gene promoter downstream, the resistant gene is Hygromycin gene, design primer is as follows：

Amplification grape seat chamber bacterium histone H3 gene promoter primer be：

Sense primer：CATTATTATGGAGAAACGGCAGCAGAAAGGGTTGAGAC；

Anti-sense primer：CCTCGCCCTTGCTCACCATGCAGAAGTTGTGTTGGGTCGG；

Amplification GFP genes primer be：

Sense primer：ATGGTGAGCAAGGGCGAGGAG；

Anti-sense primer：TCTAGATTACTTGTACAGCTCGTCCATGCCG；

Amplification grape seat chamber bacterium transcriptional elongation factor α gene promoters primer be：

Sense primer：CTGTACAAGTAATCTAGATCGAGAGTGGAGAGTGGCGAGAAA；

Anti-sense primer：GTGAGTTCAGGCTTTTTCAT TGTAGAGGCTGAGGTGTCTG；

Or

Sense primer：CTGTACAAGTAATCTAGAGGAGTCATACCGTGAACA；

Anti-sense primer：GTGAGTTCAGGCTTTTTCAT TGTAGAGGCTGAGGTGTCTG；

Amplification resistant gene primer be：

Sense primer：ATGAAAAAGCCTGAACTCACCG；

Anti-sense primer：ACGACGGCCAGTGCCACATCTACTCTATTCCTTTGCCC.

Present invention also offers a kind of agriculture bacillus mediated grape seat chamber bacterium gene transformation method, comprise the following steps：

(1) target gene is inserted in the plasmid vector, be transformed into Agrobacterium, obtain the Agrobacterium containing recombinant plasmid；

(2) the grape seat chamber bacterium protoplast after the Agrobacterium containing recombinant plasmid and renewal cultivation is co-cultured, obtains transformant.

Using agriculture bacillus mediated technology, the plasmid vector that the present invention is built can be stablized effectively is incorporated into grape seat by target gene In the genome of chamber bacterium, and target gene is efficiently expressed in grape seat chamber bacterium cell.With expression alien gene GFP Exemplified by, the plasmid vector that the present invention is built makes expression quantity of the GFP genes in transformant higher than 46 times of control pKO1-hph. Technical support is provided for research in terms of the gene functional research of grape seat chamber bacterium, genetic modification, the useful gene of exploitation.

The beneficial effect that the present invention possesses：

(1) the grape seat chamber bacterium group that the present invention is sequentially connected by the multiple cloning sites insertion in initial carrier pCAMBIA1300 Albumen H3 gene promoters, grape seat chamber bacterium transcriptional elongation factor α gene promoters, resistant gene, form new plasmid and carry Body；The grape seat chamber bacterium histone H3 gene and the section of transcriptional elongation factor α gene promoters of selection, can efficiently start Gene below is connected to, therefore it is high to greatly improve the transformation efficiency of the plasmid vector.

(2) present invention establishes the method using agriculture bacillus mediated exogenous gene high-efficient conversion grape seat chamber bacterium, for the something lost of the bacterium Pass transformation, the drug target gene developed useful gene, separate disease fungus, study research in terms of the gene function of the bacterium Exploitation provides feasible scheme.

Brief description of the drawings

Fig. 1 is carrier pBDH3G-Thy1 structural representation.

Fig. 2 is the conversion ratio of the conversion grape chamber bacterium of three kinds of carriers.

Fig. 3 is the state in the mycelium of the transformant of three kinds of carriers under the fluorescence visual field and the white light visual field, and wherein A is carrier PBDH3G-Thy1 (A1 is the state under the fluorescence visual field, and A2 is the state under the white light visual field)；B is carrier PBDH3G-Thy2 (B1 is the state under the fluorescence visual field, and B2 is the state under the white light visual field)；C is carrier pKO1-hph (C1 It is the state under the fluorescence visual field, C2 is the state under the white light visual field).

Fig. 4 is in carrier pBDH3G-Thy1 transformant, GFP is in conidium, sprouting, pycnidia cell Expression, wherein A are conidium (A1 is the state under the fluorescence visual field, and A2 is the state under the white light visual field)；B is just In the conidium of sprouting (B1 is the state under the fluorescence visual field, and B2 is the state under the white light visual field)；C is pycnidia (C1 It is the state under the fluorescence visual field, C2 is the state under the white light visual field).

Fig. 5 is the PCR amplifications of random transformant moderate resistance hygromycin gene fragment, and wherein M is molecular weight marker；P is sun Property control；W is wild-type strain；1-12 is transformant.

Fig. 6 is the PCR amplifications of GFP genetic fragments in random transformant, and wherein M is molecular weight marker；P is the positive Control；W is wild-type strain；1-12 is transformant.

Fig. 7 is the relative expression quantity of the transformant moderate resistance hygromycin gene of three kinds of carriers.

Fig. 8 be three kinds of carriers transformant in GFP genes relative expression quantity.

Embodiment

With reference to specific embodiment, the invention will be further described.

Embodiment 1 is used for the plasmid vector pBDH3G-Thy of Efficient Conversion grape seat chamber bacterium structure

Plasmid pEGFP of the present invention is bought from CLONTECH companies；Plasmid pCAMBIA1300 information：Hajdukiewicz P, Svab Z,Maliga P(1994)The small,versatile pPZP family of Agrobacterium binary vectors for plant transformation.Plant Mol Biol 25:989-994.；Plasmid pCB1003 information：Carroll AM,Sweigard JA, Barbara VC(1994)Improved vectors for selecting resistance to hygromycin.Fungal Genetic News, 41:22. above-mentioned 3 plasmids are all stored in agricultural college of Zhejiang University mycobiology laboratory.

Grape seat chamber bacterium genome database (http://genome.jgi.doe.gov/Botdo1/Botdo1.home.html) middle progress Retrieval, finds the histone H3 gene and transcriptional elongation factor α (TEF) gene of grape seat chamber bacterium, respectively by its upstream about 1500bp (promoter containing respective gene) is downloaded, and then designs primer.Again with the hygromycin resistance base on plasmid pCB1003 Because of sequence, design can expand the primer of hygromycin gene by PCR method, with the GFP genes on plasmid pEGFP Sequence, design can be by the primers of PCR method GFP genes.The sequence of each primer is shown in Table 1 (from top to bottom successively such as SEQ Shown in ID NO.4~22).

Primer sequence information used in table 1

(1) grape seat chamber bacterium histone H3 gene promoter (H3 promoter) is obtained by PCR amplifications：

Pcr amplification reaction is carried out in bright base MG96G type PCR instruments, wherein, PCR reaction systems (50 μ L)：Primer HP1 With each 2 μM of BD-H3prd, 200 μM of dNTPs, Mg²⁺1.5mM, 5 × PS PCR buffer 10 μ L, genomic DNA 10ng, PrimeStar archaeal dna polymerases 2U.

PCR reaction conditions：94 DEG C of pre-degeneration 2min, then 35 circulations include：94 DEG C of denaturation 30sec, 59 DEG C of annealing 40sec, 72 DEG C of extension 1.5min.Extend 10min after last 72 DEG C.

(2) grape seat chamber bacterium transcriptional elongation factor α (TEF) gene promoter (TEF promoter) is obtained by PCR amplifications：

Pcr amplification reaction is carried out in bright base MG96G type PCR instruments, wherein, PCR reaction systems (50 μ L)：Primer TP1 (TP4) With each 2 μM of BDtefpdh, 200 μM of dNTPs, Mg²⁺1.5mM, 5 × PS PCR buffer 10 μ L, genomic DNA 10ng, PrimeStar archaeal dna polymerases 2U.

PCR reaction conditions：94 DEG C of pre-degeneration 2min, then 35 circulations include：94 DEG C of denaturation 30sec, 56 DEG C of annealing 40sec, 72 DEG C of extension 1.5min.Extend 10min after last 72 DEG C.

(3) GFP genes (GFP) are obtained by PCR amplifications：

Pcr amplification reaction is carried out in bright base MG96G type PCR instruments, wherein, PCR reaction systems (50 μ L)：Primer EGFPu With each 2 μM of EGFPdxz, 200 μM of dNTPs, Mg²⁺The μ L of 1.5mM, 5 × PS PCR buffer 10, template (plasmid PEGFP) DNA 1ng, PrimeStar archaeal dna polymerase 2U.

PCR reaction conditions：94 DEG C of pre-degeneration 2min, then 35 circulations include：94 DEG C of denaturation 30sec, 55 DEG C of annealing 40sec, 72 DEG C of extension 1min.Extend 10min after last 72 DEG C.

(4) hygromycin gene (hygromycin B) is obtained by PCR amplifications：

Pcr amplification reaction is carried out in bright base MG96G type PCR instruments, wherein, PCR reaction systems (50 μ L)：Primer Hyg2 With each 2 μM of HPH3,200 μM of dNTPs, Mg²⁺The μ L of 1.5mM, 5 × PS PCR buffer 10, template (plasmid PCB1003) DNA 1ng, PrimeStar archaeal dna polymerase 2U.

PCR reaction conditions：94 DEG C of pre-degeneration 2min, then 35 circulations include：94 DEG C of denaturation 30sec, 57 DEG C of annealing 40sec, 72 DEG C of extension 1min.Extend 10min after last 72 DEG C.

(5) structure of carrier：

With restriction enzyme Xho I and the digested plasmid pCAMBIA1300 of Hind III, glue reclaim 6.8kb large fragment.So Afterwards by the PCR fragment of above-mentioned acquisition with after PCR fragment Purification Kit, by one-step cloning method (Vazyme companies CloneExpress Multis kits), new carrier is built by recombining reaction, restructuring system is：5×CE Multis Buffer 4 μ L, pCAMBIA1300 digestion products 50ng, H3promoter, GFP, TEF promoter, hygromycin B are each The μ L of 25ng, Exnase multis enzymes 2, use ddH₂O supplies 20 μ L, 37 DEG C of insulation 30min after mixing.

The carrier recombinated converts bacillus coli DH 5 alpha with conventional method：The reaction solution for taking 20 μ L to cool down, is added to 200 μ L senses Mixed by state cell, flicking under tube wall number, 30min is placed on ice.42 DEG C of heat shocks 45~90 seconds, ice-water bath is incubated 2min. 900 μ L LB culture mediums are added, 37 DEG C are incubated 10min and fully recover.37 DEG C are shaken bacterium 45min.It is then centrifuged for precipitating thalline, 100 μ LLB nutrient solutions are taken to hang again after bacterium solution, on the flat board for being all uniformly coated on the kanamycins containing 50 μ g/mL.Will be flat Plate is inverted, in 37 DEG C of incubated overnights.

By being identification that bacterium colony PCR is cloned.Single bacterium colony is chosen to 20 μ L LB cultures with sterile pipette tips or toothpick Mixed in base, directly take 1 μ L as pcr template.Respectively GFP and hygromycin 1 B genes are expanded with (3) (4) method PCR.Will The remaining bacterium solution of PCR positive bacterium colonies is seeded to overnight incubation in the LB culture mediums of the kanamycins containing 50 μ g/mL, takes 100LB Song Sheng works Bioisystech Co., Ltd carries out sequence verification, then adds glycerine in 2mL bacterium solutions, and it is 25% to make glycerol concentration, It is placed in -80 DEG C of ultra low temperature freezers and saves backup.

The plasmid vector of structure is named as pBDH3G-Thy1, common 11.2Kb (Fig. 1), and we construct pBDH3G-Thy2 simultaneously Carrier, it is the part for only having used TEF promoter that this carrier is distinguished with pBDH3G-Thy1, i.e., in step (2), use TP4 Enter performing PCR instead of TP1, other building process are identical, pBDH3G-Thy2 carriers size is 10.9Kb.

It is prepared by the grape of embodiment 2 seat chamber bacterium protoplast

1st, the preparation of reagent and culture medium

(1) 0.7M sodium chloride solutions：40.95g sodium chloride (NaCl) is dissolved in 1000mL water, rear progress routine after constant volume High-temperature sterilization (1.1 atmospheric pressure, sterilize at 121 DEG C 20min).

(2) 1M Tris-Cl, pH=7.5：Trishydroxymethylaminomethane (Tris (hydroxymethyl) aminomethane, general letter Referred to as Tris) 121.14 it is dissolved in 600mL redistilled waters, pH=7.5 is adjusted with concentrated hydrochloric acid, then 1L is settled to redistilled water, enters The conventional high-temperature sterilization of row (1.1 atmospheric pressure, sterilize at 121 DEG C 20min), it is standby.

(3) cell wall degradation enzyme liquid：100mg driselase (Driselase) and 100mg lywallzyme are weighed on balance (Lysing Enzyme), is dissolved in 10mL 0.7M sodium chloride solutions, and the membrane filtration with a diameter of 0.22 μm is degerming, It is now with the current.

(4) 100mL STC solution：Weigh 21.8604g sorbierite (Sorbitol), 0.735g calcium chloride adds water about 60mL After dissolving, 1M Tris-Cl (pH=7.5) 1mL prepared is added, 100mL is then settled to.

(5) potato dextrose agar (potato dextrose agar, PDA)：It is cut into small pieces in potato 200g, adds water 15min is boiled, then after 2 layers of filtered through gauze, potato ball is discarded, glucose 20g, agar 20g are added in filtered fluid In plus distilled water be settled to 1000mL；Then conventional high-temperature sterilization (1.1 atmospheric pressure, sterilize at 121 DEG C 20min) is carried out.

(6) potato dextrose broth (potato dextrose broth, PDB)：It is cut into small pieces in potato 200g, plus Water boils 15min, then after 2 layers of filtered through gauze, discards potato ball, and glucose 20g, plus distillation are added in filtered fluid Water is settled to 1000mL；Then conventional high-temperature sterilization (1.1 atmospheric pressure, sterilize at 121 DEG C 20min) is carried out.

2nd, the preparation of grape seat chamber bacterium protoplast

(1) the grape seat chamber bacteria strain FY-31 preserved this laboratory is inoculated on PDA plate, after 25 DEG C are cultivated 5 days, is used Choose pin picking 5-8 blocks about 3 × 3mm²Mycelia block, be inoculated into 100mL PDB fluid nutrient mediums, 25 DEG C cultivate 2 days.

(2) in superclean bench, with four layers of filtered through gauze mycelia, then mycelia is rinsed 3 times with 0.7M NaCl, with sterilizing Filter paper and blotting paper be filtered dry moisture, weigh 1g mycelia and be placed in 50mL sterile centrifugation tubes, add the cell membranes that prepare of 10mL Degraded enzyme liquid, is digested 3.5 hours on 28 DEG C of shaking table with 80 turns/min rotating speed.

(3) with two layers of lens wiping paper filtering enzymolysis liquid of sterilizing, then the protoplast remained on lens wiping paper is rinsed with 0.7M NaCl Twice, 10mL is used every time.Residue is removed, filtered fluid is transferred in 50ml centrifuge tubes, is placed in a centrifuge, in 4 DEG C of bars Under part, 10min is centrifuged with 3000rpm.

(4) supernatant is carefully abandoned, 10-20mL STC is added, gently rocks centrifuge tube with the precipitation that suspends.

(5) 50ml centrifuge tubes are placed in a centrifuge, under the conditions of 4 DEG C, 10min is centrifuged with 3000rpm.

(6) supernatant is carefully abandoned, 1mL STC is added, gently rocks centrifuge tube with the precipitation that suspends.

(7) protoplast is counted with blood counting chamber, according to count results, adds appropriate STC solution, adjust protoplast Concentration be 10⁶Individual/mL.

(8) protoplast of acquisition is dispensed into sterilized 1.5mL centrifuge tubes, often pipe 100ul, -80 DEG C save backup.

The agriculture bacillus mediated grape seat chamber bacterium DNA conversions of embodiment 3

1st, grape seat chamber bacteria strain FY-31 preparation：

The grape seat chamber bacteria strain FY-31 that this laboratory is preserved is inoculated on PDA plate, and 25 DEG C are cultivated 5 days, standby.

2nd, the preparation of plasmid

The pBDH3G-Thy1 and pBDH3G-Thy2 in embodiment 1, and the PKO1-HPH plasmids for control are extracted, The concentration of plasmid is adjusted to 0.25 μ g/ μ L.

3rd, plasmid vector is transformed into Agrobacterium with freeze-thaw method

(1) LB solid cultures based formulas is as follows：Tryptone (Trypone) 10g, yeast extract (Yeast extract) 5g, chlorine Change sodium (NaCl) 10g, agar 15g, water 1000mL, pH=7.0.Conventional high-temperature sterilization (1.1 atmospheric pressure, at 121 DEG C Sterilize 20min).

LB fluid nutrient mediums：Agar is not added with LB solid mediums, other are identical.

(2) agrobacterium strains AGL1 is activated in the flat lining outs of LB, 28 DEG C are cultivated 2 days.Then 1 single bacterium colony is gone to 28 DEG C of shaken cultivations are stayed overnight in 5mL LB fluid nutrient mediums.

(3) 2mL nutrient solutions are transferred in the triangular flask of the LB fluid nutrient mediums equipped with 50mL, 28 DEG C of shaken cultivations 6 are small When, its absorbance is determined, works as OD₆₀₀Stop culture when=0.5~1.0.

(4) cultured bacterium solution is put on ice for, be then transferred into 50mL centrifuge tubes, 3000g is used under the conditions of 4 DEG C Centrifuge 5min.

(5) abandoning supernatant, the 20mM CaCl of precipitation 1mL precoolings₂Solution suspension, is dispensed into the 1.5mL centrifugations of precooling Guan Zhong, often pipe 0.1mL.

(6) the μ L of three kinds of plasmids 4 for taking concentration to be adjusted to 0.25 μ g/ μ L be added separately to the 1.5mL containing 0.1mL Agrobacteriums from In heart pipe, lid is covered, is gently mixed, be then put into rapidly in liquid nitrogen and freeze.

(7) 1.5mL centrifuge tubes are taken out, is placed in 37 DEG C of water-baths and is incubated 5min defrostings.

(8) 1mL LB nutrient solutions are added in 1.5mL centrifuge tubes, 2~4h of 100rpm jog cultures is pressed at 28 DEG C.

(9) centrifuge tube is put into centrifuge, 12000rpm centrifugation 2min discard 1mL nutrient solutions, then precipitation suspends, It is coated on the LB flat boards containing kanamycins, 30min is placed in front, after bacterium solution is cultured base absorption completely, is inverted culture Ware, 28 DEG C are cultivated 2~4 days.

4th, Agrobacterium-mediated Transformation fungi grape seat chamber bacteria strain FY-31 is utilized

Agrobacterium culture medium IM is formulated：The K-Phosphate-buffer pH 4.8 of 0.8mL 1.25 (use KH₂PO₄And K₂HPO₄Match somebody with somebody System)；20mL MN-buffer(30g/L MgSO₄·7H₂O, 15g/L NaCl)；1mL 1%CaCl₂·2H₂O(w/v)；10mL 0.01%FeSO₄(w/v)；5mL spore elements(100mg/L ZnSO₄7H2O, 100mg/L CuSO₄·H₂O, 100 mg/L H₃BO₃, 100mg/L Na₂MoO₄·2H₂O) (filtration sterilization)；2.5mL 20%NH₄NO₃(w/v)；10mL 50% glycerol(v/v)；40mL 1M MES pH 5.5 (adjust pH value) with NaOH；In 20%glucose (w/v), fluid nutrient medium Plus 10mL, solid medium adds 5mL；1L is added water to, solid medium adds 1.5% agar powder.

100mM acetosyringones storing solution (Acetosyringone, AS)：1.962g acetosyringones are with dimethyl sulfoxide (DMSO) (DMSO) Dissolving, constant volume to 100mL is degerming for 0.22 μm of filtering with microporous membrane with aperture.

Agrobacterium inducing culture AIM is formulated：The μ L of acetosyringone storing solution 200 are added in 100mL IM culture mediums, Make final concentration of 200 μM of acetosyringone.

Recovery media YPS (Yeast extract Peptone Sucrose)：Peptone (Peptone) 5g, yeast extract (Yeast Extract) 3.5g, glucose (Glucose) 10g, sucrose (Sucrose) 342.3g, water 1000mL, pH=7.0.Conventional high temperature Sterilizing (1.1 atmospheric pressure, sterilize at 121 DEG C 20min).

Card receives mycin storing solution (50mg/mL)：1g chloramphenicol is dissolved in standby in 20mL absolute ethyl alcohol.

Streptomysin storing solution (10mg/mL)：100mg streptomysins are dissolved in standby in 10mL aqua sterilisa.

Cephalosporin storing solution (400mg/mL)：2g cephalosporins are dissolved in standby in 5mL aqua sterilisa

Hygromycin storing solution：50mg/mL, is bought by Sheng Gong Bioisystech Co., Ltd.

Step of converting：

(1) select an Agrobacterium single bacterium colony from the LB flat boards (containing 50 μ g/mL kanamycins) of fresh cultured and be inoculated in 5mL LB In fluid nutrient medium (containing 50 μ g/mL kanamycins), 200rpm/min, 28 DEG C of incubated overnights.

(2) second days, 400 μ L nutrient solutions are transferred to the induced fluid culture medium (AIM) of 5mL kanamycins containing 50g/mL In, OD values about 0.15, make the OD600 of bacterium solution reach 0.5~0.6 at 28 DEG C of 5~6 hours of culture.

(3) optimization of grape seat chamber bacteria strain FY-31 converting materials：In the 1.5mL centrifuge tubes containing 100 μ L protoplasts Add 500 μ L recovery media, 28 DEG C of renewal cultivations 5~6 hours.

(4) after melting in 100mL IM solid mediums, 50 DEG C are cooled in room temperature, acetosyringone storage is then added Standby liquid 200 μ L, the μ L of cephalosporin storing solution 100, the μ L of streptomysin storing solution 100, the μ L of kanamycins storing solution 100, gently Shake after mixing, pour into 6cm disposable plastic culture dishes, induction flat board is made.After after the culture medium solidifying in culture dish, The plain film of one diameter 5cm sterilization fibre is covered in media surface.

(5) the cultured Agrobacterium AGL-1 of 100 μ L (containing carrier) bacterium solution and the mixing of 200 μ L converting materials are taken, mixed liquor is uniform It is applied to the nitrocellulose filter surface on induction flat board, 22 DEG C of co-cultivation 48h.

(6) after melting in 100mL PDA solid mediums, 50 DEG C is cooled in room temperature, acetosyringone is then added The μ L of storing solution 200, the μ L of cephalosporin storing solution 100, the μ L of streptomysin storing solution 100, the μ L of kanamycins storing solution 100, tide The μ L of mycin storing solution 20, gently shake after mixing, pour into 6cm disposable plastic culture dishes, screening flat board is made.It will lure Nitrocellulose filter on flat guiding plate is cut into about 0.5cm band, is transferred in screening flat board, and about 0.5cm is separated by between band, It is placed at 28 DEG C to cultivate 7 days, mycelia can be seen and grown on the culture medium between nitrocellulose filter band.

(7) mycelia that picking is grown, is transferred on the PDA plate containing 10 μ g/mL hygromycin, and 28 DEG C are cultivated 5 days, are confirmed Whether conversion is successful.If can grow, it can confirm to convert successfully.

Conversion results are as shown in Figure 2：The averagely each culture mediums of carrier pBDH3G-Thy1 can be obtained more than 20 transformants PBDH3G-Thy2 can be obtained more than 13 transformants, and compareed the averagely each culture dishes of PKO1-HPH and only obtained about 3 Transformant.As a result show that the carrier transformation efficiency that the present invention is built is greatly improved than the transformation efficiency of other carriers.

The detection of the transformant of embodiment 4

1st, the Detection of Stability of grape seat chamber bacterium transformant

12 transformants are picked at random from the transformant obtained, 28 DEG C of switchings are cultivated 5 times on PDA culture medium flat board, Then transfer again on the PDA plate containing 10 μ g/mL hygromycin, 28 DEG C are cultivated 5 days.

As a result this 12 transformants can grow, and illustrate that the stability of transformant is good, the resistant gene being transferred to is stabilized.

2nd, the green fluorescence detection of grape seat chamber bacterium transformant

The grape seat chamber bacterium transformant of three carrier conversions of random selection is on PDA plate, and 28 DEG C are cultivated 5 days.With choosing pin picking A small amount of mycelia, is placed on slide, observation slide is made, be put on microscopical objective table.Ultraviolet light (450~490nm) is opened, Observe green fluorescence.

As a result as shown in figure 3, the mycelium of carrier pBDH3G-Thy1 and pBDH3G-Thy2 that the present invention is built transformant Stronger fluorescence can also be sent, and very weak fluorescence is sent as the pKO1-HPH of control transformant only small part mycelia. As shown in figure 4, the transformant for the carrier that the present invention is built is in conidium, spore germination, mycelium and pycnidia It can be expressed in cell, illustrate that the carrier that the present invention is built can be such that foreign gene is efficiently expressed in grape seat chamber bacterium cell.

3rd, the PCR detections of grape seat chamber bacterium transformant.

(1) a small amount of extractions of fungal genomic DNA

Extraction buffer：Contain 1M KCl, 100mM Tris-HCl, 10mM EDTA, pH=8.0.

(2) extracting method：

1. by select at random 12 transformant bacterial strains on PDA plate 25 DEG C growth 7 days after, with toothpick scrape flat board on Mycelia, is put into sterilized containing in 300 μ L Extraction buffer 1.5mL centrifuge tubes；2. the mycelia of picking is ground with electrical grinding machine, Then 300 μ L Extraction buffers are added, 2min is acutely shaken；

3. 10000rpm centrifuges 10min；

4. supernatant is drawn into another centrifuge tube, abandons precipitation；

5. isometric isopropanol (analysis is pure) is added, precipitate nucleic acids are gently overturned after mixing for several times, 12000rpm centrifugations 10min；

6. supernatant is gently removed, moisture is drained on blotting paper；

7. the ethanol of 300 μ L 70% is added, is gently overturned after mixing for several times, 12000rpm centrifugations 2min；

8. supernatant is gently removed, moisture is drained on blotting paper, 15min at 37 DEG C is placed in, ethanol is fully volatilized；

9. it is resuspended and is precipitated with 50 μ L ddH2O, obtains genomic DNA, concentration reaches 30ng/ μ L.

(3) the PCR amplifications of transformant moderate resistance hygromycin gene and GFP genes

Entered using 50 μ L reaction systems and contained in performing PCR amplification, system：Each 2 μM of upstream and downstream primer, 200 μM of dNTPs, Mg²⁺1.5mM, 10 × PCR buffer 5 μ L, masterplate DNA 2 μ L, Taq enzyme 2U.

The sense primer Hph-F sequences of hygromycin gene are 5 '-TCGTTATGTTTATCGGCACT-3 ', anti-sense primer Hph-R sequences are 5 '-GTTCGGTCGGCATCTACT-3 '.

The sense primer GFP1 sequences of GFP genes are 5 '-GGCGAGGGCGAGGGCGATGC-3 ', anti-sense primer GFP2 Sequence is 5 '-AGTTCACCTTGATGCCGTTC-3 '.

Pcr amplification reaction is carried out in bright base MG96G type PCR instruments.Reaction condition：94 DEG C of pre-degeneration 2min, then 35 circulations include：94 DEG C of denaturation 30sec, 57 DEG C of annealing 40sec, 72 DEG C of extension 1.5min.Extend after last 72 DEG C 10min。

(4) detection of PCR primer

After PCR reactions terminate, PCR primer is detected through 1% agarose gel electrophoresis, is as a result found in this 12 transformants all The electrophoretic band (Fig. 5) of about 850bp hygromycin gene is occurred in that, the electrophoresis of about 400bp GFP genes is have also appeared Band (Fig. 6), illustrates hygromycin gene and GFP genes all stable integrations into the genome of grape seat chamber bacterium.

(5) expression quantity of quantitative PCR detection transformed gene

1. the extraction of transformant total serum IgE

Mycelial cultural method be the same as Example 2, the total serum IgE in sample is extracted with RNAiso PLus, is comprised the following steps that：

1) 0.5g mycelial samples are placed in the mortar of precooling, the grind into powder in liquid nitrogen.

2) 1mL RNAiso PLus are added, room temperature places 5min, it is fully cracked.

3) 8500rpm centrifuges 5min, abandons precipitation.

4) chloroform is added in the ratio of every milliliter of μ L chloroform of RNAiso PLus 200, mixes 15s, room temperature places 15min, 4 DEG C 8500rpm centrifuges 15min.

5) upper strata aqueous phase is drawn, into another centrifuge tube, by 1:1 volume adds isopropyl acetone and mixed, and room temperature places 10min, 4 DEG C 8500rpm centrifuges 10min, abandons supernatant, RNA is sunken to ttom of pipe.

6) 75% ethanol is added in the ratio of every milliliter of ethanol of RNAiso PLus 1mL 75%, gently vibrates centrifuge tube, suspended 4 DEG C of precipitation, 6500rpm centrifugation 5min, abandons supernatant, 15min is dried on ice.

7) H of RNase is removed with 100 μ L₂O, dissolves RNA sample.

8) the quantitative RNA concentration of OD, -70 DEG C of preservations are surveyed.

2. the synthesis of first chain of cDNA

With reverse transcription reagent box Prime Script RT reagent kit with gDNA Eraser, ((TaKaRa, Dalian China) is synthesized First chain.

1) in total serum IgE contaminating genomic DNA remove dereaction

Remove reaction to complete on ice, prepared according to table 2 and remove mixed liquor, after low-speed centrifugal is mixed, 42 DEG C of reaction 2min, in 4 DEG C save backup.

The genomic DNA of table 2 removes the preparation of reaction mixture

2) reverse transcription reaction

RNA reverse transcriptions are concretely comprised the following steps into cDNA with Takara reverse transcriptions box：Reverse transcription reaction mixing is completed on ice The preparation of liquid (table 3), after low-speed centrifugal is mixed, 37 DEG C of reactions 15min, 85 DEG C of reaction 5s, 4 DEG C of preservations；Use ddH₂O will be anti- Mixed liquor is answered to be diluted to 200 μ L, -20 DEG C of preservations.

The preparation of the Overturn ratio reaction mixture of table 3

3. quantitative fluorescent PCR

Quantitative PCR reaction primer is shown in Table 1

1) using Tubulin genes as internal reference, the primer pair of detection Tubulin genes is Bd-Tubu/Bd-Tubd, detects moisture resistance The primer pair of mycin gene is q-HPH-F/q-HPH-R, and the primer pair of detection GFP genes is GFP-F-RT/GFP-R-RT. Primer synthesis is completed by Shanghai Sheng Gong bioengineering Co., Ltd.

2) RT-PCR reaction systems (25 μ L)

Prepared according to table 4 on ice after RT-PCR reaction mixtures, low-speed centrifugal, carry out RT-PCR reactions.

It is prepared by the qRT-PCR reaction mixtures system of table 4

QRT-PCR reaction conditions

QRT-PCR reactions are carried out on ICyceler iQ quantitative real time PCR Instruments (Bio-rad, USA), and reaction uses two-step method, Reaction condition is set to：95 DEG C of pre-degeneration 30s；Into circulation, 95 DEG C of denaturation 3s, 55 DEG C of annealing 31s, totally 40 circulations.

The relative expression quantity of foreign gene formula E=2^CTt-CTgCalculate, wherein E is the relative expression quantity for detecting gene, CTt is The CT values of tubulin gene expressions, CTg is the CT values of cls gene to be checked.

Carrier pBDH3G-Thy1 and pBDH3G-Thy2 that the present invention is built, and turn for the PKO1-HPH plasmids of control Change after grape seat chamber bacterium, foreign gene GFP and hygromycin gene hygromycin B (HPH) are expressed, what the present invention was built The expression quantity of carrier, is far longer than control vector PKO1-HPH expression quantity.Wherein hygromycin gene is in pBDH3G-Thy2 Transformant in expression quantity be higher than 11 times of PKO1-HPH, and in pBDH3G-Thy1 then more than 108 times (Fig. 7). 46 times (figures of expression quantity of the GFP genes in pBDH3G-Thy1 and pBDH3G-Thy2 transformant higher than PKO1-HPH 8)。

Finally, in addition it is also necessary to it is noted that listed above is only several specific embodiments of the invention.Obviously, the present invention not It is limited to above example, there can also be many deformations.One of ordinary skill in the art can directly lead from present disclosure All deformations for going out or associating, are considered as protection scope of the present invention.

Claims

1. a plasmid vector, is built by pCAMBIA1300 transformations and is formed, it is characterised in that be many in pCAMBIA1300 Cloning site insertion grape seat chamber bacterium histone H3 gene promoter, grape seat chamber bacterium transcriptional elongation factor α gene promoters, Resistant gene, the resistant gene is located at the downstream of grape seat chamber bacterium transcriptional elongation factor α gene promoters.

2. plasmid vector as claimed in claim 1, it is characterised in that the resistant gene is hygromycin gene.

3. plasmid vector as claimed in claim 1, it is characterised in that the grape seat chamber bacterium histone H3 gene promoter Reporter gene is inserted in downstream.

4. plasmid vector as claimed in claim 3, it is characterised in that the reporter gene is GFP genes.

5. plasmid vector as claimed in claim 1, it is characterised in that the grape seat chamber bacterium histone H3 gene promoter Nucleotide sequence as shown in SEQ ID NO.1.

6. plasmid vector as claimed in claim 1, it is characterised in that the grape seat chamber bacterium transcriptional elongation factor α genes are opened The nucleotide sequence of mover is as shown in SEQ ID NO.2.

7. plasmid vector as claimed in claim 1, it is characterised in that the grape seat chamber bacterium transcriptional elongation factor α genes are opened The nucleotide sequence of mover is as shown in SEQ ID NO.3.

8. the construction method of plasmid vector as claimed in claim 1, it is characterised in that comprise the following steps：

(2) DNA fragmentation is inserted into the multiple cloning sites of pCAMBIA1300 carriers by recombining reaction, obtains described Plasmid vector.

9. construction method as claimed in claim 8, it is characterised in that the grape seat chamber bacterium histone H3 gene promoter GFP genes are inserted in downstream, and the resistant gene is hygromycin gene, and design primer is as follows：