CN113667688A - Trichoderma longibrachiatum plasmid vector and construction method and application thereof - Google Patents
Trichoderma longibrachiatum plasmid vector and construction method and application thereof Download PDFInfo
- Publication number
- CN113667688A CN113667688A CN202111102594.3A CN202111102594A CN113667688A CN 113667688 A CN113667688 A CN 113667688A CN 202111102594 A CN202111102594 A CN 202111102594A CN 113667688 A CN113667688 A CN 113667688A
- Authority
- CN
- China
- Prior art keywords
- gene
- trichoderma longibrachiatum
- plasmid vector
- promoter
- resistance gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Mycology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the field of plasmid vector construction, and provides a plasmid vector and a construction method and application thereof. The plasmid vector is formed by modifying and constructing pAN7-1, and the plasmid vector is inserted into a promoter gene and a resistance gene of Trichoderma longibrachiatum at a multiple cloning site pAN7-1, wherein the resistance gene is positioned at the downstream of the promoter gene of Trichoderma longibrachiatum. The section of the trichoderma longibrachiatum promoter gene selected by the invention can efficiently start the gene connected to the rear part, thereby greatly improving the transformation efficiency of the plasmid vector. The invention establishes a method for efficiently transforming the trichoderma longibrachiatum by using the exogenous gene mediated by agrobacterium, and can provide help in the aspects of genetic modification of the trichoderma longibrachiatum, development of useful genes, separation of drug target genes and the like.
Description
Technical Field
The invention belongs to the technical field of plasmid vector construction, and particularly relates to a Trichoderma longibrachiatum plasmid vector pANH3G-Hyg constructed based on pAN7-1 and application thereof.
Background
Trichoderma longibrachiatum belongs to Deuteromycota, and some of the fungi can be saprophytic on various saprophytic wood, some of the fungi can be parasitic on various woody plants, and some of the fungi can form symbiont with the plants and are endophytic fungi of many plants. Trichoderma longibrachiatum living on saprophytic wood can decompose woody plant residues and has important effects in material circulation and energy circulation of an ecological system. Meanwhile, the fungus can be developed to produce Trichoderma longibrachiatum cellulase, Trichoderma longibrachiatum endoglucanase and Trichoderma longibrachiatum beta-glucosidase, and has good economic development prospect.
Trichoderma longibrachiatum, which is a plant pathogenic bacterium, also has development value and is an important biological resource to be developed. In order for phytopathogens to successfully infect a host plant, they must be able to overcome the defense response of the plant and also be able to cross the plant's physical protective barriers, such as the plant's epidermis. Thus, phytopathogens tend to produce more extracellular degrading enzymes and other effectors than saprophytic bacteria, reducing the defense response of the plant and subjecting the epidermal cell wall components of the plant to the necessary degradation.
With the development of modern biotechnology, molecular biology technology has been combined with traditional biology technology, which greatly promotes the development of biological research and biological industry, and no matter the molecular modification of biological cells or the cloning of useful genes, a transformation system for transforming exogenous genes into cells needs to be established, which is a prerequisite for molecular modification and research of cells. Aiming at the fungus of trichoderma longibrachiatum, the gene transformation efficiency of the fungus is low at present.
Plasmid pAN7-1 is an expression vector commonly used in filamentous fungal gene transformation and can be genetically transformed by Agrobacterium-mediated methods. The gene chip contains a plurality of multiple cloning sites and restriction enzyme cutting sites, a promoter is GPD, a terminator is TRPC, and the size is 6756 bp. It contains an ampicillin gene as a selection marker. However, in the subject group, when Trichoderma longibrachiatum was transformed with this plasmid in the previous study, it was found that the transformation efficiency was low.
Therefore, the subject group constructs a new screening marker, integrates the new screening marker into a vector capable of being used for agrobacterium transformation, establishes a method for efficiently transforming the trichoderma longipedunculatum by using agrobacterium-mediated exogenous genes, and can provide help in the aspects of genetic modification of the trichoderma longipedunculatum, development of useful genes, separation of drug target genes and the like.
Disclosure of Invention
The invention aims to provide a brand-new plasmid vector, which solves the problem of low transformation efficiency when the existing plasmid is transformed into trichoderma longibrachiatum.
Specifically, the invention provides a plasmid vector pANH3G-Hyg, and the nucleotide sequence is shown in SEQ ID NO. 1. The plasmid vector is formed by modifying and constructing pAN7-1 (the nucleotide sequence is shown as SEQ ID NO: 2), and a Trichoderma longibrachiatum promoter gene (the nucleotide sequence is shown as SEQ ID NO: 3) and a resistance gene are inserted into a pAN7-1 multiple cloning site, wherein the resistance gene is a hygromycin resistance gene (the nucleotide sequence is shown as SEQ ID NO: 4), and the resistance gene is positioned at the downstream of the Trichoderma longibrachiatum promoter gene.
Plasmid pAN7-1 is an expression vector commonly used in filamentous fungal gene transformation and can be genetically transformed by Agrobacterium-mediated methods. It contains several multiple cloning sites and restriction endonuclease cutting sites, and the present invention also adopts pAN7-1 as original vector.
The invention selects the trichoderma longibrachiatum promoter gene as a strong promoter for regulating the high expression of exogenous genes (such as GFP), and the transformation efficiency of the constructed plasmid vector transformed into the trichoderma longibrachiatum is far higher than that of the current commonly used transformation vector. Taking the currently commonly used vector pAN7-1 as an example, when the average number of transformants obtained by taking pAN7-1 as a vector is only 4 under the same transformation conditions, 12-18 transformants can be obtained by using the plasmid vector of the invention.
Further, the resistance gene is a hygromycin resistance gene. The original vector pAN7-1 contains an ampicillin resistance gene, but the promoter is a 35S promoter, the expression efficiency in fungi is very low, and the ampicillin resistance gene is hardly expressed in Trichoderma longibrachiatum. Research shows that compared with a control vector pAN7-1, the expression level of the hygromycin resistance gene in the plasmid vector constructed by the invention is higher than 10 times, and the result proves that the Trichoderma longibrachiatum promoter gene can obviously regulate and control the high expression of the hygromycin resistance gene in Trichoderma longibrachiatum, and is favorable for screening transformants.
Furthermore, a reporter gene is inserted into the downstream of the Trichoderma longibrachiatum promoter gene, and the expression of the target gene can be calibrated through the reporter gene, wherein the reporter gene is a GFP gene (the nucleotide sequence is shown as SEQ ID NO: 5).
The invention also provides a construction method for constructing the plasmid vector, which comprises the following steps. (1) Amplifying DNA fragments respectively containing the trichoderma longibrachiatum promoter gene, the hygromycin resistance gene and the GFP reporter gene. (2) The DNA fragment is inserted into the multiple cloning site of pAN7-1 vector by recombination reaction to obtain the plasmid vector.
Specifically, the specific primers are designed so that the 5 'and 3' extreme ends of the amplified PCR product respectively have completely identical sequences corresponding to the extreme ends of adjacent fragments, and the directional cloning is completed under the action of recombinase.
Further, primers of the trichoderma longibrachiatum promoter gene, the hygromycin resistance gene and the GFP reporter gene are designed as follows.
(1) The primers for amplifying the trichoderma longibrachiatum promoter gene are as follows:
an upstream primer: CATTGAAGCAGAAAGAAACGGCGGATTATGGTTGAGAC, respectively;
a downstream primer: CCTTCCGCCCTCAGAATGCACATGTTGGGCTGTTGGTCGG are provided.
(2) The primers for amplifying the GFP gene are as follows:
an upstream primer: ATGGTGAGCAGCGAGGAGGAG, respectively;
a downstream primer: TCTAGAGTACAGTTACTTCTCGTCCATGCCG are provided.
(3) The primers for amplifying the hygromycin resistance gene are as follows:
an upstream primer: ATGAAAAGAAAGCCTCTCACCG, respectively;
a downstream primer: ACGACGGCCAGTTCTACGCCACATCTATTCCTTTGCCC are provided.
Further, the invention also provides an application of the plasmid vector and an agrobacterium-mediated trichoderma longibrachiatum gene transformation method, which is characterized by comprising the following steps: (1) inserting the target gene into the constructed plasmid vector, and transforming into agrobacterium to obtain agrobacterium containing recombinant plasmid. (2) And co-culturing agrobacterium containing the recombinant plasmid and trichoderma longibrachiatum to obtain a transformant.
The invention has the beneficial effects that: the plasmid vector constructed by the invention can stably and effectively integrate the target gene into the genome of the trichoderma longibrachiatum and enable the target gene to be efficiently expressed in the trichoderma longibrachiatum by utilizing an agrobacterium-mediated technology, and can provide help in the aspects of genetic modification of the trichoderma longibrachiatum, development of useful genes, separation of drug target genes and the like.
Additional features and advantages of the invention will be set forth in the detailed description which follows.
Drawings
The above and other objects, features and advantages of the present invention will become more apparent by describing in more detail exemplary embodiments thereof with reference to the attached drawings.
FIG. 1 is a map of a plasmid vector pANH 3G-Hyg.
FIG. 2 is a map of plasmid vector pAN 7-1.
FIG. 3 shows the transformation ratio of two vectors for transforming Trichoderma longibrachiatum.
Detailed Description
Preferred embodiments of the present invention will be described in more detail below. While the following describes preferred embodiments of the present invention, it should be understood that the present invention may be embodied in various forms and should not be limited by the embodiments set forth herein.
The examples, in which the specific conditions are not specified, were conducted under the conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
Example 1 construction of Trichoderma longibrachiatum plasmid vector pANH 3G-Hyg.
1. Purchase of plasmid pAN 7-1: the plasmid pAN7-1 of the present invention was purchased from Koehlete Biotech, Inc., Shanghai. The gene chip contains a plurality of multiple cloning sites and restriction enzyme cutting sites, a promoter is GPD, a terminator is TRPC, and the size is 6756 bp. It contains an ampicillin gene as a selection marker.
2. Designing a primer: searching in a trichoderma longibrachiatum genome database to find a trichoderma longibrachiatum promoter gene, and designing a primer capable of obtaining the trichoderma longibrachiatum promoter gene by a PCR method. Based on the sequence of the hygromycin resistance gene on plasmid pCB1003, primers were designed that can amplify the hygromycin resistance gene by PCR. Based on the GFP gene sequence on the plasmid pEGFP, primers for obtaining the GFP gene by the PCR method were designed.
The sequences of the primers were as follows: the primers for amplifying the trichoderma longibrachiatum promoter gene are as follows:
an upstream primer: CATTGAAGCAGAAAGAAACGGCGGATTATGGTTGAGAC, respectively;
a downstream primer: CCTTCCGCCCTCAGAATGCACATGTTGGGCTGTTGGTCGG are provided.
The primers for amplifying the GFP gene are as follows:
an upstream primer: ATGGTGAGCAGCGAGGAGGAG, respectively;
a downstream primer: TCTAGAGTACAGTTACTTCTCGTCCATGCCG are provided.
The primers for amplifying the hygromycin resistance gene are as follows:
an upstream primer: ATGAAAAGAAAGCCTCTCACCG, respectively;
a downstream primer: ACGACGGCCAGTTCTACGCCACATCTATTCCTTTGCCC are provided.
3. And carrying out PCR amplification to obtain the target gene.
(1) Gene amplification of Trichoderma longibrachiatum promoter
Table 1: specific conditions of PCR reaction of trichoderma longibrachiatum promoter gene
The reaction procedure is as follows: 5min at 94 ℃; 30s at 94 ℃, 30s at 56 ℃, 4.5min at 72 ℃ and 35 cycles; extending for 10min at 72 ℃; storing at 4 ℃.
(2) Amplification of GFP Gene
Table 2: specific conditions for GFP gene PCR reaction
The reaction procedure is as follows: 5min at 94 ℃; 30s at 94 ℃, 30s at 57 ℃, 4.5min at 72 ℃ and 35 cycles; extending for 10min at 72 ℃; storing at 4 ℃.
(3) Amplification of hygromycin resistance genes
Table 3: PCR reaction specific conditions for hygromycin resistance gene
The reaction procedure is as follows: 5min at 94 ℃; 30s at 94 ℃, 30s at 55 ℃, 4.5min at 72 ℃ and 35 cycles; extending for 10min at 72 ℃; storing at 4 ℃.
4. Construction of the vector: plasmid pAN7-1 was digested with restriction enzymes Xho I and Hind III and the large fragment was recovered from the gel. The PCR fragment obtained above was purified using a PCR fragment purification kit, and a new vector was constructed by a one-step cloning method using Cloneexpress Multis kit from Vazyme. The recombinant is:
table 4: PCR fragment and vector pAN7-1 recombinant system
Example 2 trichoderma longibrachiatum protoplast preparation.
1. Preparation of reagents and culture media
(1) 0.7M sodium chloride solution: 40.95g of sodium chloride is dissolved in 1000mL of redistilled water, and the normal high-temperature sterilization is carried out after the volume is fixed;
(2) 1M Tris-Cl: dissolving the trihydroxymethyl aminomethane 121.14 in 600mL of redistilled water, adjusting the pH value to 7.5 by using concentrated hydrochloric acid, then fixing the volume to 1L by using the redistilled water, and performing conventional high-temperature sterilization for later use;
(3) cell wall degrading enzyme solution: weighing 100mg of collapse enzyme and 100mg of lywallzyme on a balance, dissolving in 10mL of 0.7M sodium chloride solution, and filtering and sterilizing with a filter membrane with the diameter of 0.22 mu M to obtain the product for use;
(4) STC solution: 21.8604g of sorbitol and 0.735g of calcium chloride are weighed, added with about 60mL of water for dissolution, added with 1mL of prepared 1M Tris-Cl, and then the volume is determined to be 100 mL;
(5) potato dextrose agar medium (PDA): cutting 200g of potatoes into small pieces, adding water, boiling for 15min, filtering by 2 layers of gauze, removing the potato pieces, adding 20g of glucose and 20g of agar into filtrate, adding distilled water to a constant volume of 1000mL, and performing conventional high-temperature sterilization;
(6) potato dextrose liquid medium (PDB): cutting 200g of potatoes into small pieces, adding water, boiling for 15min, filtering by 2 layers of gauze, discarding the potato pieces, adding 20g of glucose into filtrate, adding distilled water to reach the constant volume of 1000mL, and performing conventional high-temperature sterilization.
2. Preparation of protoplasts
(1) Inoculating the Trichoderma longibrachiatum strain stored in the laboratory on a PDA (personal digital Assistant) plate, culturing for 5 days at 25 ℃, picking 5-8 blocks by using a picking needle, inoculating into 100mL of PDB liquid culture medium, and culturing for 2 days at 25 ℃;
(2) filtering hyphae with four layers of gauze in an ultraclean workbench, washing the hyphae with 0.7M NaCl for 3 times, draining water with sterilized filter paper and absorbent paper, weighing 1g of hyphae, placing the hyphae in a 50mL sterilized centrifuge tube, adding 10mL of prepared cell wall degrading enzyme solution, and performing enzymolysis for 3.5 hours on a shaking table at the temperature of 28 ℃ at the rotating speed of 80 rpm;
(3) the enzymatic hydrolysate was filtered through two layers of sterilized paper, and the protoplasts remaining on the paper were washed twice with 10mL of 0.7M NaCl each time. Removing residues, transferring the filtrate into a 50ml centrifuge tube, placing in a centrifuge, and centrifuging at 4 deg.C and 5000rpm for 10 min;
(4) carefully discarding the supernatant, adding 15mL of STC, and gently shaking the centrifuge tube to suspend the precipitate;
(5) placing 50ml of centrifuge tube in a centrifuge, and centrifuging for 10min at 4 ℃ and 3000 rpm;
(6) carefully discarding the supernatant, adding 1mL of STC, and gently shaking the centrifuge tube to suspend the precipitate;
(7) counting the protoplast with a blood counting plate, adding STC solution to adjust the protoplast concentration to 106Per mL;
(8) the obtained protoplasts were dispensed into sterilized 1.5mL centrifuge tubes, 100. mu.L of each tube was stored at-80 ℃ for further use
Example 3 Agrobacterium-mediated transformation of Trichoderma longibrachiatum DNA.
1. Preparation of Trichoderma longibrachiatum strains
The Trichoderma longibrachiatum strain stored in the laboratory is inoculated on a PDA plate and cultured for 5 days at 25 ℃ for later use.
2. Preparation of plasmids
The pANH3G-Hyg plasmid of example 1 was extracted to prepare a control plasmid pAN 7-1. The concentration of the plasmid was adjusted to 0.25. mu.g/. mu.L.
3. Transformation of plasmid vectors into Agrobacterium
(1) Preparation of LB medium: LB solid medium: 10g of tryptone, 5g of yeast extract, 10g of sodium chloride, 15g of agar and 1000mL of water, wherein the pH value is 7.0, and the mixture is subjected to conventional high-temperature sterilization. LB liquid medium: agar is not added into the LB solid culture medium, and the rest are the same;
(2) agrobacterium strain AGL1 was streaked on LB plate and activated, and cultured at 28 ℃ for 2 days. Then transferring 1 single colony to 5mL LB liquid culture medium to shake culture at 28 ℃ overnight;
(3) transferring 2mL of the culture solution into a triangular flask containing 50mL of LB liquid medium, culturing at 28 ℃ for 6 hours with shaking, measuring the absorbance, OD600Stopping culturing when the culture medium is 0.5-1.0 percent;
(4) placing the cultured bacterial liquid on ice, transferring the bacterial liquid into a 50mL centrifuge tube, and centrifuging the bacterial liquid for 5min at the temperature of 4 ℃ and at the rpm of 5000;
(5) the supernatant was discarded and the pellet was treated with 1mL of pre-cooled 20mM CaCl2Suspending the solution, and subpackaging into precooled 1.5mL centrifuge tubes, wherein each tube contains 0.1 mL;
(6) adding 4 mu L of two plasmids with the concentration adjusted to 0.25 mu g/mu L into a 1.5mL centrifuge tube containing 0.1mL agrobacterium respectively, covering a cover, slightly mixing uniformly, and then quickly putting into liquid nitrogen for freezing;
(7) taking out 1.5mL of centrifuge tube, placing in a water bath at 37 ℃ and preserving heat for 5min for thawing;
(8) adding 1mL of LB culture solution into a 1.5mL centrifuge tube, and culturing for 2-4 h at 28 ℃ by gentle shaking at 100 rpm;
(9) and (3) putting the centrifuge tube into a centrifuge, centrifuging for 5min at 10000rpm, discarding the supernatant, suspending the precipitate, coating the precipitate on an LB (Langmuir-Blodgett) plate, standing for 30min on the front side, inverting the culture dish after the bacterial liquid is completely absorbed by the culture medium, and culturing for 2-4 days at 28 ℃.
4. Transformation of Trichoderma longibrachiatum by Agrobacterium
(1) Solution preparation: agrobacterium culture Medium IM: 0.8mL of K-phospholate-buffer, 20mL of MN-buffer, 1mL of 1% CaCl2·2H2O，10mL 0.01％FeSO4，5mL spore elements，2.5mL 20％NH4NO310mL of 50% glycerol, 40mL of 1M MES and 10mL of 20% glucose, adding water to 1L, and adding 1.5% agar powder into a solid culture medium;
100mM acetosyringone stock solution (AS): 1.962g of acetosyringone is dissolved in dimethyl sulfoxide (DMSO), the volume is fixed to 100mL, and the solution is filtered and sterilized by a microporous filter membrane with the pore diameter of 0.22 μm;
agrobacterium induction medium AIM: adding 200 mu L of acetosyringone stock solution into 100mL of IM culture medium to make the final concentration of acetosyringone 200 mu M;
recovery medium YPS: 5g of peptone, 3.5g of yeast extract, 10g of glucose, 342.3g of sucrose and 1000mL of water, wherein the pH value is 7.0. Conventional high-temperature high-pressure sterilization;
(2) selecting an agrobacterium tumefaciens single colony from a freshly cultured LB plate, inoculating the agrobacterium tumefaciens single colony into 5mL of LB liquid culture medium, and culturing at 200 rpm and 28 ℃ overnight;
(3) the next day, 400. mu.L of the culture broth was transferred to 5mL of induced liquid Medium (AIM) and cultured at 28 ℃ for 5-6 hours with OD value of about 0.15 to adjust OD of the bacterial solution6000.5 to 0.6;
(4) activation of Trichoderma longibrachiatum transformation material: adding 500 mu L of recovery culture medium into a 1.5mL centrifuge tube containing 100 mu L of protoplast, and performing recovery culture at 28 ℃ for 5-6 hours;
(5) melting 100mL IM solid culture medium, cooling to 50 deg.C at room temperature, gently shaking, mixing, pouring into 6cm disposable plastic culture dish, and making into induction plate. After the culture medium in the culture dish is solidified, covering a sterilized cellulose membrane with the diameter of 5cm on the surface of the culture medium;
(6) mixing 100 mu L of cultured Trichoderma longibrachiatum (containing a carrier) bacterial liquid with 200 mu L of transformation material, uniformly coating the mixed liquid on the surface of a nitrocellulose membrane on an induction plate, and co-culturing for 48h at 22 ℃;
(7) melting 100mL PDA solid culture medium, cooling to 50 deg.C at room temperature, shaking gently, mixing, pouring into 6cm disposable plastic culture dish, and making into screening plate. Cutting the nitrocellulose membrane on the induction plate into strips with the length of about 0.5cm, transferring the strips to a screening plate, wherein the distance between the strips is about 0.5cm, and placing the strips on a culture medium which is cultured at 28 ℃ for 7 days, so that the hyphae can grow to the positions between the cellulose nitrate membrane strips;
(8) the grown mycelia were picked, transferred to a PDA plate containing 10. mu.g/mL hygromycin, and cultured at 28 ℃ for 5 days to confirm whether the transformation was successful. If growth is possible, the transformation is confirmed to be successful.
Example 4 detection of transformants.
1. Transformant stability testing
From the transformants obtained, 10 transformants were randomly selected, and were subcultured 5 times at 28 ℃ on PDA medium plates, and then subcultured on PDA plates containing 10. mu.g/mL hygromycin for 5 days at 28 ℃. As a result, all 10 transformants can grow, which indicates that the transformants have good stability and the transferred resistance gene stably exists.
2. Green fluorescence detection of transformants
The transformants obtained were randomly selected and inoculated on PDA plates and cultured at 28 ℃ for 5 days. Picking a small amount of hyphae with a picking needle, placing on a glass slide, making into an observation slide, and placing on a microscope stage. Turning on ultraviolet light (450-490 nm) and observing green fluorescence. The results show that the mycelium of the transformant of the vector pANH3G-Hyg constructed by the invention can emit stronger fluorescence, while the transformant of the pAN7-1 used as a control emits weaker fluorescence.
3. Transformant PCR detection
Extracting a small amount of Trichoderma longibrachiatum genome DNA, carrying out PCR amplification on the hygromycin resistance gene and the GFP gene in the transformant by adopting the PCR method, and after the PCR reaction is finished, detecting the PCR product by 1% agarose gel electrophoresis, and finding that 10 transformants have electrophoresis strips of the hygromycin resistance gene of about 1100bp and GFP gene of about 650bp, so that the hygromycin resistance gene and the GFP gene are stably integrated into the genome of Trichoderma longibrachiatum.
Having described embodiments of the present invention, the foregoing description is intended to be exemplary, not exhaustive, and not limited to the embodiments disclosed. Many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments.
Claims (6)
1. A Trichoderma longibrachiatum plasmid vector and a construction method and application thereof are characterized in that the nucleotide sequence of the plasmid vector pANH3G-Hyg is shown in SEQ ID NO. 1.
2. The plasmid vector of claim 1, wherein the plasmid vector is constructed by modifying pAN7-1, and a Trichoderma longibrachiatum promoter gene and a resistance gene are inserted into the pAN7-1 multiple cloning site, wherein the resistance gene is a hygromycin resistance gene, and the resistance gene is positioned at the downstream of the Trichoderma longibrachiatum promoter gene.
3. The plasmid vector according to claim 1, wherein a reporter gene is inserted downstream of the Trichoderma longibrachiatum promoter gene, and the reporter gene is a GFP gene.
4. The method of constructing a plasmid vector according to claim 1, comprising the steps of:
(1) amplifying DNA fragments respectively containing the trichoderma longibrachiatum promoter gene, the hygromycin resistance gene and the GFP reporter gene.
(2) The DNA fragment is inserted into the multiple cloning site of pAN7-1 vector by recombination reaction to obtain the plasmid vector.
5. The method according to claim 4, wherein the Trichoderma longibrachiatum promoter gene, hygromycin resistance gene, and GFP reporter gene are designed with the following primers:
(1) the primers for amplifying the trichoderma longibrachiatum promoter gene are as follows:
an upstream primer: CATTGAAGCAGAAAGAAACGGCGGATTATGGTTGAGAC
A downstream primer: CCTTCCGCCCTCAGAATGCACATGTTGGGCTGTTGGTCGG
(2) The primers for amplifying the GFP gene are as follows:
an upstream primer: ATGGTGAGCAGCGAGGAGGAG
A downstream primer: TCTAGAGTACAGTTACTTCTCGTCCATGCCG
(3) The primers for amplifying the hygromycin resistance gene are as follows:
an upstream primer: ATGAAAAGAAAGCCTCTCACCG
A downstream primer: ACGACGGCCAGTTCTACGCCACATCTATTCCTTTGCCC are provided.
6. The use of the plasmid vector according to claim 1 in a method for Agrobacterium-mediated transformation of a Trichoderma longibrachiatum gene comprising the steps of:
(1) inserting a target gene into the plasmid vector of claim 1, and transforming into Agrobacterium to obtain Agrobacterium containing the recombinant plasmid.
(2) And co-culturing agrobacterium containing the recombinant plasmid and trichoderma longibrachiatum to obtain a transformant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111102594.3A CN113667688A (en) | 2021-09-21 | 2021-09-21 | Trichoderma longibrachiatum plasmid vector and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111102594.3A CN113667688A (en) | 2021-09-21 | 2021-09-21 | Trichoderma longibrachiatum plasmid vector and construction method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113667688A true CN113667688A (en) | 2021-11-19 |
Family
ID=78549793
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111102594.3A Pending CN113667688A (en) | 2021-09-21 | 2021-09-21 | Trichoderma longibrachiatum plasmid vector and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113667688A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113201555A (en) * | 2021-04-01 | 2021-08-03 | 云南师范大学 | Construction method of binary vector containing eGFP marker and hygromycin resistance |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101429520A (en) * | 2008-11-10 | 2009-05-13 | 天津科技大学 | Epiphyte genome conformity plasmid pUNFIN without selection mark, construction method and uses thereof |
| US20110158970A1 (en) * | 2009-12-31 | 2011-06-30 | Kaohsiung District Agricultural Research And Extension Station, Coa, Ey | Fungi transformant for melanin production and uses thereof |
| WO2021032180A1 (en) * | 2019-08-21 | 2021-02-25 | 江南大学 | Visualized screening method for multiple-targeted editing of recombinant aspergillus strains |
| CN113201555A (en) * | 2021-04-01 | 2021-08-03 | 云南师范大学 | Construction method of binary vector containing eGFP marker and hygromycin resistance |
-
2021
- 2021-09-21 CN CN202111102594.3A patent/CN113667688A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101429520A (en) * | 2008-11-10 | 2009-05-13 | 天津科技大学 | Epiphyte genome conformity plasmid pUNFIN without selection mark, construction method and uses thereof |
| US20110158970A1 (en) * | 2009-12-31 | 2011-06-30 | Kaohsiung District Agricultural Research And Extension Station, Coa, Ey | Fungi transformant for melanin production and uses thereof |
| WO2021032180A1 (en) * | 2019-08-21 | 2021-02-25 | 江南大学 | Visualized screening method for multiple-targeted editing of recombinant aspergillus strains |
| CN113201555A (en) * | 2021-04-01 | 2021-08-03 | 云南师范大学 | Construction method of binary vector containing eGFP marker and hygromycin resistance |
Non-Patent Citations (2)
| Title |
|---|
| CAMILLE SILVAFLORENCIO: "Genetic manipulation of Fonsecaea pedrosoi using particles bombardment and Agrobacterium mediated transformation", 《MICROBIOLOGICAL RESEARCH》 * |
| 刘刚 等: "红色荧光蛋白在丝状真菌里氏木霉中的表达", 《生物技术》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113201555A (en) * | 2021-04-01 | 2021-08-03 | 云南师范大学 | Construction method of binary vector containing eGFP marker and hygromycin resistance |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111424022B (en) | Verticillium dahliae VdEG target gene fragment for pathogen-resistant bacteria, interference vector and application thereof | |
| CN114736915B (en) | Verticillium dahliae VdNRPS2 gene antipathogen target gene fragment and interference vector and application thereof | |
| CN103865948A (en) | Genetic transformation method for PEG-medicated fusarium oxysporum sesame special type protoplast | |
| CN111057654B (en) | Cas9 gene knockout vector applicable to morinda officinalis endophytic fungus A761 and construction method and application thereof | |
| CN116103334A (en) | Instant transformation system special for screening anti-ulcer disease gene functions of kiwi fruits | |
| CN102676510B (en) | Method for enhancing black streaked dwarf resistance of paddy rice by using artificial microRNA (micro Ribonucleic Acid) and special double chain RNA thereof | |
| CN107828816A (en) | One primary yeast Agrobacterium shuttle vector and construction method and application | |
| CN113667688A (en) | Trichoderma longibrachiatum plasmid vector and construction method and application thereof | |
| CN108070609B (en) | Method for expressing recombinant protein by using trichoderma reesei as host | |
| CN105087640A (en) | Gene for regulating seed development of plants and application of gene | |
| CN103114089B (en) | Strong promoter from trichoderma reesei as well as expression vector and application thereof | |
| CN110004070B (en) | Xylanase-producing Aspergillus niger genetically engineered bacterium and construction method and application thereof | |
| CN110016519B (en) | Banana fusarium wilt bacterium No. 4 physiological race DCL gene deletion mutant and small RNA thereof | |
| CN105039345B (en) | The clone of miRNA for enhancing mulberry tree salt resistance ability a kind of and its application | |
| CN107815459B (en) | Pleurotus ostreatus manganese peroxidase gene and application thereof | |
| CN114107327B (en) | Trichoderma viride high-temperature stress response key enzyme gene TvHSP70, recombinant expression vector, engineering bacteria and application thereof | |
| CN105837672A (en) | Stress-resistance associated protein RtHKT1 as well as coding gene thereof and application thereof | |
| CN115975996A (en) | Application of FpOPSB gene and protein in preventing banana crown rot | |
| CN101781654B (en) | Novel cotton fungal disease-resistant gene GhMPK7 and application thereof | |
| CN114426995A (en) | Method for improving yield of cordyceps militaris extracellular polysaccharide by over-expression of hexokinase gene HK | |
| CN107129996B (en) | Plasmid vector and construction method and application thereof | |
| CN109679988B (en) | In-vitro verification method for banana fusarium oxysporum low-abundance milRNAs | |
| CN102140446A (en) | Application of rape iMyAP gene over-expression in sclerotinia sclerotiorum resistance of rape | |
| CN105274131A (en) | PEG-mediated colletotrichum gloeosporioides protoplast genetic transformation method | |
| CN116445532A (en) | Rhizopus stolonifer plasmid vector |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20211119 |
|
| WD01 | Invention patent application deemed withdrawn after publication |