CN107129996B

CN107129996B - Plasmid vector and construction method and application thereof

Info

Publication number: CN107129996B
Application number: CN201610107520.1A
Authority: CN
Inventors: 王洪凯; 林福呈
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2016-02-26
Filing date: 2016-02-26
Publication date: 2020-05-12
Anticipated expiration: 2036-02-26
Also published as: CN107129996A

Abstract

The invention discloses a plasmid vector and a construction method and application thereof, wherein the plasmid vector is formed by modifying and constructing pCAMBIA1300, and a gluconobacter wallichiana histone H3 gene promoter, a gluconobacter wallichiana transcription elongation factor α gene promoter and a resistance gene are inserted into a multiple cloning site of the pCAMBIA1300, and the resistance gene is positioned at the downstream of the gluconobacter wallichiana transcription elongation factor α gene promoter.

Description

Plasmid vector and construction method and application thereof

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to a plasmid vector and a construction method and application thereof.

Background

The botrytis dothidea (Botryosphaeria dothidea) is a common important fungus distributed globally and has important development and utilization values. Some of the fungi can be saprophytic on various saprophytic wood, some of the fungi can be parasitic on various woody plants to cause diseases of the woody plants, and some of the fungi can form symbiont with the plants and are endophytic fungi of a plurality of plants. The grapevine cavity bacteria which are used for the saprophytic life on the saprophytic wood can decompose the woody plant residues and play an important role in the material circulation and the energy circulation of an ecological system; meanwhile, the fungi can be developed to produce ligninase and cellulase, and have good economic development prospect. The strain belonging to endophytic fungi can be used as a bioreactor, for example, a strain separated from Cedrus deodara can produce 15 new compounds, wherein 3 of the compounds have the functions of resisting pathogenic fungi and resisting oxidation.

The strain of the staphylococcus aureus as a plant pathogenic bacterium also has development value and is an important biological resource to be developed. In order for phytopathogens to successfully infect a host plant, they must be able to overcome the defense response of the plant and also be able to cross the plant's physical protective barriers, such as the plant's epidermis. Thus, phytopathogens tend to produce more extracellular degrading enzymes and other effectors than saprophytic bacteria, reducing the defense response of the plant and subjecting the epidermal cell wall components of the plant to the necessary degradation.

The results of genome sequence analysis of some fungi also indicate that the genome of plant pathogenic fungi contains more cell wall degrading enzyme genes than saprophytic fungi, while the genome of endophytic fungi contains the least cell wall degrading enzyme genes. Therefore, the plant pathogenic bacteria can be developed into biological resources for producing cell wall degrading enzymes, such as crop straws or forest tree residues, and has good application prospects in the aspects of environmental protection and biomass energy development. The strain of gluconobacter vinifera which is a plant pathogenic bacterium can also be used for producing specific functional compounds through biotransformation, such as Nootkatone (Nootkatone) which is an important industrial raw material, and the gluconobacter vinifera can convert valencia cirrhosa into Nootkatone, and can be used in weight-reducing products, health-care products for enhancing immunity and beauty products.

With the development of modern biotechnology, molecular biology technology has been combined with traditional biology technology, which greatly promotes the development of biological research and biological industry, and no matter the molecular modification of biological cells or the cloning of useful genes, a transformation system for transforming exogenous genes into cells needs to be established, which is a prerequisite for molecular modification and research of cells. Aiming at the fungus which is the gluconobacter and has important economic significance, at present, the gene transformation efficiency of the fungus is lower.

For example, the plasmid pKO1-HPH is a commonly used vector for filamentous fungal gene transformation, and can be used for genetic transformation of various ascomycetes by Agrobacterium-mediated methods. It contains one hygromycin-resistant gene controlled by TrPC promoter as selective marker and one Green Fluorescent Protein (GFP) gene controlled by H3 gene promoter of Pyricularia oryzae as reporter gene. However, when the plasmid was used to transform the Staphylococus in the previous study, the transformation efficiency was low and the green fluorescent protein expression was very weak.

Therefore, the subject group constructs a new screening marker, integrates the new screening marker into a vector which can be used for agrobacterium transformation, establishes an agrobacterium-mediated exogenous DNA high-efficiency transformation system, and provides a feasible scheme for the genetic modification of the fungi, the research and the development of useful genes, the separation of drug target genes of pathogenic fungi, the research of the gene function of the fungi and the like.

Disclosure of Invention

The invention provides a plasmid vector, which solves the problem of low transformation efficiency when the existing plasmid is transformed into a staphylococcus lumen.

A plasmid vector is formed by modifying and constructing pCAMBIA1300, and a gluconobacter wallichiana histone H3 gene promoter, a gluconobacter wallichiana transcription elongation factor α gene promoter and a resistance gene are inserted into a multiple cloning site of the pCAMBIA1300, wherein the resistance gene is positioned at the downstream of the gluconobacter wallichiana transcription elongation factor α gene promoter.

The pCAMBIA1300 was originally used for Agrobacterium-mediated genetic transformation of various plants, and various plasmid vectors, which were later used for Agrobacterium-mediated genetic transformation, were constructed on the basis of this vector, and the present invention also uses pCAMBIA1300 as the original vector.

In general eukaryotic cells, histone H3 gene and transcription elongation factor α gene have important functions in cell division and RNA biosynthesis, and the promoters of the two genes are strong promoters in the cells.

The research of the invention proves that the transformation efficiency of the constructed plasmid vector to the gluconobacter vinifera is far higher than that of the transformation vector commonly used at present. Taking the currently commonly used vector pKO1-hph as an example, when the average number of transformants obtained by taking pKO1-hph as the vector is only 3 under the same transformation conditions, 13-20 transformants can be obtained by using the plasmid vector of the invention.

The original vector pCAMBIA1300 contains the hygromycin resistance gene, but the promoter is a 35S promoter, the expression efficiency in fungi is very low, and the hygromycin resistance gene is hardly expressed in the plasmopara viticola cells.

Preferably, a reporter gene is inserted downstream of the histone H3 gene promoter of the gluconobacter and the expression of the target gene, which may be a GFP gene, can be targeted by the reporter gene.

The invention specifically provides two plasmids, specifically:

a plasmid vector is named as pBDH3G-Thy1 and has the size of 11219bp, wherein the nucleotide sequence of a plasmodiophora viticola histone H3 gene promoter is shown as SEQ ID No.1, and the nucleotide sequence of a plasmodiophora transcription elongation factor α gene promoter is shown as SEQ ID No. 2.

Another plasmid vector is named pBDH3G-Thy2, has the size of 10217bp and is different from pBDH3G-Thy1 in that only a part of DNA fragment of a gene promoter of the gluconobacter wallichiana transcription elongation factor α is used, and the nucleotide sequence of the gene promoter of the gluconobacter wallichiana transcription elongation factor α is shown in SEQ ID NO. 3.

The invention also provides a construction method for constructing the plasmid vector, which comprises the following steps:

(1) amplifying DNA fragments respectively comprising the plasmodiophora viticola histone H3 gene promoter, the plasmodiophora viticola transcription elongation factor α gene promoter and the resistance gene;

(2) and inserting the DNA fragment into a pCAMBIA1300 vector through a recombination reaction to obtain the plasmid vector.

Specifically, the specific primers are designed so that the 5 'and 3' extreme ends of the amplified PCR product respectively have completely identical sequences corresponding to the extreme ends of adjacent fragments, and the directional cloning is completed under the action of recombinase.

Preferably, the GFP gene is inserted into the downstream of the histone H3 gene promoter of the staphylococcus, the resistance gene is a hygromycin resistance gene, and primers are designed as follows:

the primers for amplifying the gene promoter of the histone H3 gene of the staphylococcus are as follows:

an upstream primer: CATTATTATGGAGAAACGGCAGCAGAAAGGGTTGAGAC, respectively;

a downstream primer: CCTCGCCCTTGCTCACCATGCAGAAGTTGTGTTGGGTCGG, respectively;

the primers for amplifying the GFP gene are as follows:

an upstream primer: ATGGTGAGCAAGGGCGAGGAG, respectively;

a downstream primer: TCTAGATTACTTGTACAGCTCGTCCATGCCG, respectively;

the primers for amplifying the gene promoter of the gluconobacter transcription elongation factor α are as follows:

an upstream primer: CTGTACAAGTAATCTAGATCGAGAGTGGAGAGTGGCGAGAAA, respectively;

a downstream primer: GTGAGTTCAGGCTTTTTCAT TGTAGAGGCTGAGGTGTCTG, respectively;

or

An upstream primer: CTGTACAAGTAATCTAGAGGAGTCATACCGTGAACA, respectively;

a downstream primer: GTGAGTTCAGGCTTTTTCAT TGTAGAGGCTGAGGTGTCTG, respectively;

the primers for amplifying the resistance gene are as follows:

an upstream primer: ATGAAAAAGCCTGAACTCACCG, respectively;

a downstream primer: ACGACGGCCAGTGCCACATCTACTCTATTCCTTTGCCC are provided.

The invention also provides an agrobacterium-mediated gene transformation method of the gluconobacter rosenbergii, which comprises the following steps:

(1) inserting a target gene into the plasmid vector, and transforming the target gene into agrobacterium to obtain agrobacterium containing recombinant plasmid;

(2) and co-culturing the agrobacterium containing the recombinant plasmid and the restored and cultured plasmodiophora viticola protoplast to obtain a transformant.

By utilizing an agrobacterium-mediated technology, the plasmid vector constructed by the invention can stably and effectively integrate the target gene into the genome of the plasmodiophora vinifera, and the target gene can be efficiently expressed in the plasmodiophora vinifera cells. Taking the expression of exogenous gene GFP as an example, the plasmid vector constructed by the invention enables the expression amount of the GFP gene in a transformant to be 46 times higher than that of a control pKO 1-hph. Provides technical support for the research of gene function research, genetic modification, development of useful genes and the like of the staphylococcus aureus.

The invention has the following beneficial effects:

(1) the novel plasmid vector is formed by inserting a plasmodiophora viticola histone H3 gene promoter, a plasmodiophora viticola transcription elongation factor α gene promoter and a resistance gene which are sequentially connected into a multiple cloning site of an original vector pCAMBIA1300, and the sections of the selected plasmodiophora viticola histone H3 gene and the transcription elongation factor α gene promoter can efficiently start the genes connected behind, so that the transformation efficiency of the plasmid vector is greatly improved.

(2) The invention establishes a method for efficiently transforming the staphylococcus lumen by utilizing the exogenous gene mediated by the agrobacterium, and provides a feasible scheme for the genetic modification of the staphylococcus lumen, the research and development of developing useful genes, separating drug target genes of pathogenic fungi, researching the gene function of the staphylococcus lumen and the like.

Drawings

FIG. 1 is a schematic structural diagram of vector pBDH3G-Thy 1.

FIG. 2 shows the transformation ratio of three vectors for transforming P.vinifera.

FIG. 3 is a view showing the states in fluorescent field and white light field of mycelia of transformants with three vectors, wherein A is the vector pBDH3G-Thy1(A1 is the state in fluorescent field and A2 is the state in white light field); b is vector pBDH3G-Thy2(B1 is in fluorescent view, B2 is in white light view); c is the vector pKO1-hph (C1 is the state under fluorescent view and C2 is the state under white light view).

FIG. 4 shows the expression of GFP in conidia, germination and conidiophores cells in transformants of the vector pBDH3G-Thy1, in which A is conidia (A1 is in a state under a fluorescent field and A2 is in a state under a white light field); b is germinating conidia (B1 is in fluorescent view, B2 is in white light view); c is conidiophore (C1 is under fluorescent view, C2 is under white light view).

FIG. 5 shows the PCR amplification result of the hygromycin-resistant gene fragment in random transformants, wherein M is a molecular weight marker; p is a positive control; w is a wild type strain; 1-12 are transformants.

FIG. 6 shows the result of PCR amplification of GFP gene fragments in random transformants, where M is a molecular weight marker; p is a positive control; w is a wild type strain; 1-12 are transformants.

FIG. 7 shows the relative expression levels of the hygromycin-resistant gene in the transformants with the three vectors.

FIG. 8 shows the relative expression amounts of GFP genes in transformants with the three vectors.

Detailed Description

The present invention will be further described with reference to the following specific examples.

EXAMPLE 1 construction of plasmid vector pBDH3G-Thy for efficient transformation of Staphylococcus aureus

The plasmid pEGFP of the invention was purchased from CLONTECH; plasmid pCAMBIA1300 information: hajdukiewicz P, Svab Z, Malega P (1994) The small, versatile pPZP family of Agrobacterium binding vectors for plant transformation. plant Mol Biol 25: 989-; plasmid pCB1003 information: carroll AM, Sweigard JA, Barbara VC (1994) Improved vectors for selecting resistance to hygromycin. fungal genetics News,41:22 all 3 plasmids described above were stored at the agri-institute of Zhejiang university, fungi biology laboratory.

In the genomic database of Staphylococus (http://genome.jgi.doe.gov/Botdo1/ Botdo1.home.html) The method comprises the steps of searching, finding a histone H3 gene and a transcription elongation factor α (TEF) gene of the gluconobacter vinifera, respectively downloading about 1500bp (containing promoters of respective genes) of upstream genes of the genes, designing primers, designing a hygromycin resistance gene sequence on a plasmid pCB1003, designing the primers capable of amplifying the hygromycin resistance gene by a PCR method, and using a plasmid pEGFPThe GFP gene sequence above was designed as a primer for the GFP gene by the PCR method. The sequences of the primers are shown in Table 1 (shown as SEQ ID NO. 4-22 in sequence from top to bottom).

Primer sequence information used in Table 1

(1) Obtaining the gene promoter of the histone H3 of the staphylococcus through PCR amplification (H3 promoter):

the PCR amplification reaction was carried out on a Langzy MG96G type PCR instrument, in which the PCR reaction system (50. mu.L): primers HP1 and BD-H3prd were 2. mu.M each, dNTPs 200. mu.M, Mg²⁺1.5mM, 5 XPS PCR buffer 10. mu.L, genomic DNA10ng, PrimeStar DNA polymerase 2U.

And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 2min, followed by 35 cycles comprising: denaturation at 94 ℃ for 30sec, annealing at 59 ℃ for 40sec, and extension at 72 ℃ for 1.5 min. Finally, extension is carried out for 10min after 72 ℃.

(2) Obtaining the gene promoter (TEFpromoter) of the gluconobacter transcription elongation factor α (TEF) by PCR amplification:

the PCR amplification reaction was carried out on a Langzy MG96G type PCR instrument, in which the PCR reaction system (50. mu.L): primers TP1(TP4) and BDtefpdh 2. mu.M each, dNTPs 200. mu.M, Mg²⁺1.5mM, 5 XPS PCR buffer 10. mu.L, genomic DNA10ng, PrimeStar DNA polymerase 2U.

And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 2min, followed by 35 cycles comprising: denaturation at 94 ℃ for 30sec, annealing at 56 ℃ for 40sec, and extension at 72 ℃ for 1.5 min. Finally, extension is carried out for 10min after 72 ℃.

(3) The GFP Gene (GFP) was obtained by PCR amplification:

the PCR amplification reaction was carried out on a Langzy MG96G type PCR instrument, in which the PCR reaction system (50. mu.L): primers EGFPU and EGFPdxz are each 2. mu.M, dNTPs 200. mu.M, Mg²⁺1.5mM, 5 XPS PCR buffer 10. mu.L, template (plasmid pEGFP) DNA1ng, PrimeStar DNA polymerase 2U.

And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 2min, followed by 35 cycles comprising: denaturation at 94 ℃ for 30sec, annealing at 55 ℃ for 40sec, and extension at 72 ℃ for 1 min. Finally, extension is carried out for 10min after 72 ℃.

(4) Obtaining a hygromycin resistance gene (hygromycin B) by PCR amplification:

the PCR amplification reaction was carried out on a Langzy MG96G type PCR instrument, in which the PCR reaction system (50. mu.L): primers Hyg2 and HPH3 each 2. mu.M, dNTPs 200. mu.M, Mg²⁺1.5mM, 5 XPS PCR buffer 10. mu.L, template (plasmid pCB1003) DNA1ng, PrimeStar DNA polymerase 2U.

And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 2min, followed by 35 cycles comprising: denaturation at 94 ℃ for 30sec, annealing at 57 ℃ for 40sec, and extension at 72 ℃ for 1 min. Finally, extension is carried out for 10min after 72 ℃.

(5) Construction of the vector:

the plasmid pCAMBIA1300 was digested with restriction enzymes XhoI and Hind III, and a large 6.8kb fragment was recovered from the gel. Then, the PCR fragment obtained above was purified by a PCR fragment purification kit, and a new vector was constructed by a one-step cloning method (Cloneexpress Multis kit by Vazyme) through a recombination reaction, the recombinant system being: 5 XCE MultisBuffer 4. mu.L, pCAMBIA1300 digestion product 50ng, H3promoter, GFP, TEF promoter, hygromycin B each 25ng, Exnase Multis enzyme 2. mu.L, using ddH₂And supplementing 20 mu L of O, uniformly mixing, and keeping the temperature at 37 ℃ for 30 min.

The recombinant vector is transformed into Escherichia coli DH5 α by conventional method, which comprises adding 20 μ L of cooled reaction solution into 200 μ L of competent cells, flicking the tube wall, mixing, placing on ice for 30min, thermally shocking at 42 deg.C for 45-90 s, incubating in ice water bath for 2min, adding 900 μ L of LB culture medium, incubating at 37 deg.C for 10min for recovery, shaking at 37 deg.C for 45min, centrifuging to precipitate thallus, re-suspending 100 μ LLB culture solution, spreading on a plate containing 50 μ g/mL kanamycin, inverting the plate, and culturing at 37 deg.C overnight.

The clones were identified by colony PCR. Single colony was picked up to 20. mu.L LB medium with a sterile tip or toothpick and mixed well, and 1. mu.L was taken directly as PCR template. The GFP and hygromycin B genes were PCR-amplified by the methods (3) and (4), respectively. Inoculating the residual bacterial liquid of the PCR positive bacterial colony to an LB culture medium containing 50 mu g/mL of kanamycin for overnight culture, taking 100LB to a biotechnology limited company for sequencing verification, adding glycerol into 2mL of bacterial liquid to enable the concentration of the glycerol to be 25%, and storing the bacterial liquid in an ultra-low temperature refrigerator at minus 80 ℃ for later use.

The plasmid vector is named pBDH3G-Thy1 and has 11.2Kb (figure 1), and the pBDH3G-Thy2 vector is constructed, and the vector is different from pBDH3G-Thy1 in that only a part of TEF promoter is used, namely in the step (2), TP4 is used for replacing TP1 for PCR, and other construction processes are the same, and the size of the pBDH3G-Thy2 vector is 10.9 Kb.

Example 2 preparation of Proteobacteria protoplasts

1. Preparation of reagents and culture media

(1)0.7M sodium chloride solution: 40.95g of sodium chloride (NaCl) was dissolved in 1000mL of water, and after a constant volume, the solution was subjected to conventional high-temperature sterilization (1.1 atm, sterilization at 121 ℃ C. for 20 min).

(2)1M Tris-Cl, pH 7.5: tris (hydroxymethyl) aminomethane (Tris, commonly abbreviated as Tris)121.14 was dissolved in 600mL of redistilled water, the pH was adjusted to 7.5 with concentrated hydrochloric acid, and then the volume was increased to 1L with redistilled water, and conventional high-temperature sterilization (1.1 atm, sterilization at 121 ℃ for 20min) was performed for use.

(3) Cell wall degrading enzyme solution: 100mg of the crashed Enzyme (Driselase) and 100mg of the lywallzyme (Lysing Enzyme) were weighed out on a balance, dissolved in 10mL of a 0.7M sodium chloride solution, and sterilized by filtration through a filter having a diameter of 0.22. mu.m.

(4)100mL of STC solution: 21.8604g of Sorbitol (Sorbitol) and 0.735g of calcium chloride were weighed out and dissolved in about 60mL of water, and 1mL of 1M Tris-Cl (pH 7.5) was added thereto, followed by volume adjustment to 100 mL.

(5) Potato dextrose agar medium (potato dextrose agar, PDA): cutting 200g of potatoes into small pieces, adding water, boiling for 15min, filtering by 2 layers of gauze, discarding the potato pieces, adding 20g of glucose and 20g of agar into the filtrate, and adding distilled water to a constant volume of 1000 mL; conventional autoclaving (1.1 atm, 121 ℃ C. for 20min) was then carried out.

(6) Potato Dextrose Broth (PDB): cutting 200g of potatoes into small pieces, adding water, boiling for 15min, filtering by 2 layers of gauze, removing the potato pieces, adding 20g of glucose into filtrate, and adding distilled water to a constant volume of 1000 mL; conventional autoclaving (1.1 atm, 121 ℃ C. for 20min) was then carried out.

2. Preparation of Proteus vitis protoplast

(1) Inoculating the laboratorial grape cavity bacterial strain FY-31 to PDA plate, culturing at 25 deg.C for 5 days, picking 5-8 blocks with about 3 × 3mm²The mycelia of (4) were inoculated into 100mL of a PDB liquid medium and cultured at 25 ℃ for 2 days.

(2) Filtering hyphae with four layers of gauze in an ultraclean workbench, washing the hyphae with 0.7M NaCl for 3 times, draining water with sterilized filter paper and absorbent paper, weighing 1g of hyphae, placing the hyphae in a 50mL sterilized centrifuge tube, adding 10mL of prepared cell wall degrading enzyme solution, and performing enzymolysis for 3.5 hours on a shaking table at the temperature of 28 ℃ at the rotating speed of 80 rpm.

(3) The enzymatic hydrolysate was filtered through two layers of sterilized paper, and the protoplasts remaining on the paper were washed twice with 10mL of 0.7M NaCl each time. The residue was removed and the filtrate was transferred to a 50ml centrifuge tube and placed in a centrifuge and centrifuged at 3000rpm for 10min at 4 ℃.

(4) The supernatant was carefully discarded, 10-20mL of STC was added, and the tube was gently shaken to suspend the pellet.

(5) 50ml of the tube was placed in a centrifuge and centrifuged at 3000rpm for 10min at 4 ℃.

(6) The supernatant was carefully discarded, 1mL of STC was added, and the tube was gently shaken to suspend the pellet.

(7) Counting the protoplast with a blood counting plate, adding STC solution to adjust the protoplast concentration to 10⁶one/mL.

(8) The protoplasts obtained were dispensed into sterilized 1.5mL centrifuge tubes, 100ul per tube, and stored at-80 ℃ until use.

EXAMPLE 3 Agrobacterium-mediated transformation of Staphylococus DNA

1. Preparation of the strain of Staphylococcus aureus FY-31:

the staphylococcus aureus strain FY-31 preserved in the laboratory is inoculated on a PDA plate and cultured for 5 days at 25 ℃ for later use.

2. Preparation of plasmids

pBDH3G-Thy1 and pBDH3G-Thy2 in example 1, and PKO1-HPH plasmid for control were extracted, and the concentration of the plasmid was adjusted to 0.25. mu.g/. mu.L.

3. Transformation of plasmid vectors into Agrobacterium by freeze-thaw methods

(1) The LB solid medium formulation is as follows: 10g of tryptone (tryptone), 5g of yeast extract (Yeastextract), 10g of sodium chloride (NaCl), 15g of agar and 1000mL of water, wherein the pH value is 7.0. Conventional high temperature sterilization (1.1 atm, 121 ℃ C. for 20 min).

LB liquid medium: no agar was added to the LB solid medium, and the other was the same.

(2) Agrobacterium strain AGL1 was streaked on LB plate and activated, and cultured at 28 ℃ for 2 days. Then, 1 single colony was transferred to 5mL of LB liquid medium and cultured overnight with shaking at 28 ℃.

(3) Transferring 2mL of the culture solution into a triangular flask containing 50mL of LB liquid medium, culturing at 28 ℃ for 6 hours with shaking, measuring the absorbance, OD₆₀₀And stopping culturing when the culture medium is equal to 0.5-1.0.

(4) The cultured cell suspension was placed on ice, transferred to a 50mL centrifuge tube, and centrifuged at 3000g for 5min at 4 ℃.

(5) The supernatant was discarded and the pellet was treated with 1mL of pre-cooled 20mM CaCl₂The solution was suspended and dispensed into pre-cooled 1.5mL centrifuge tubes, 0.1mL per tube.

(6) Three kinds of plasmids 4. mu.L adjusted to a concentration of 0.25. mu.g/. mu.L were added to 1.5mL centrifuge tubes containing 0.1mL of Agrobacterium, covered with a cap, gently mixed, and then rapidly frozen in liquid nitrogen.

(7) Taking out a 1.5mL centrifuge tube, placing in a water bath at 37 ℃ and preserving the heat for 5min for unfreezing.

(8) 1mL of LB medium was added to a 1.5mL centrifuge tube and incubated at 28 ℃ with gentle shaking at 100rpm for 2-4 h.

(9) And (3) putting the centrifuge tube into a centrifuge, centrifuging at 12000rpm for 2min, discarding 1mL of culture solution, suspending the precipitate, coating the precipitate on an LB (Langmuir-Blodgett) flat plate containing kanamycin, standing for 30min on the front surface, inverting the culture dish after the bacterial solution is completely absorbed by the culture medium, and culturing for 2-4 days at 28 ℃.

4. Agrobacterium transformed fungal gluconobacter strain FY-31

An agrobacterium culture medium IM formula: 0.8mL of 1.25K-phospate-buffer pH 4.8 (with KH)₂PO₄And K₂HPO₄Preparation); 20mL MN-buffer (30g/L MgSO)₄·7H₂O，15g/L NaCl)；1mL 1％CaCl₂·2H₂O(w/v)；10mL0.01％FeSO₄(w/v)；5mL spore elements(100mg/L ZnSO₄·7H2O，100mg/L CuSO₄·H₂O，100mg/L H₃BO₃，100mg/L Na₂MoO₄·2H₂O) (filter sterilization); 2.5mL of 20% NH₄NO₃(w/v); 10mL 50% glycerol (v/v); 40mL of 1M MES pH 5.5 (pH adjusted with NaOH); 20% glucose (w/v), adding 10mL of liquid culture medium, and adding 5mL of solid culture medium; adding water to 1L, and adding 1.5% agar powder into solid culture medium.

100mM Acetosyringone stock solution (Acetosyringone, AS): 1.962g of acetosyringone was dissolved in dimethyl sulfoxide (DMSO) to 100mL, and the solution was filtered through a 0.22 μm pore size microfiltration membrane to sterilize the solution.

The formula of the AIM of the agrobacterium inducing culture medium is as follows: add 200. mu.L of acetosyringone stock solution to 100mL of IM medium to make the final concentration of acetosyringone 200. mu.M.

Recovery medium yps (Yeast extract Peptone sucrose): peptone (Peptone)5g, Yeast extract (Yeast extract)3.5g, Glucose (Glucose)10g, Sucrose (Sucrose)342.3g, water 1000mL, pH 7.0. Conventional high temperature sterilization (1.1 atm, 121 ℃ C. for 20 min).

Canavamycin stock (50 mg/mL): 1g of chloramphenicol was dissolved in 20mL of absolute ethanol for use.

Streptomycin stock (10 mg/mL): 100mg of streptomycin was dissolved in 10mL of sterilized water for use.

Stock solution of cefamycin (400 mg/mL): dissolving 2g of cefuroxime in 5mL of sterilized water for later use

Hygromycin stock solution: 50mg/mL, purchased from Biotechnology Ltd.

A conversion step:

(1) a single colony of Agrobacterium was picked from freshly cultured LB plate (containing 50. mu.g/mL kanamycin) and inoculated into 5mLLB liquid medium (containing 50. mu.g/mL kanamycin) and cultured at 200rpm at 28 ℃ overnight.

(2) The next day, 400. mu.L of the culture broth was transferred to 5mL of an induction liquid medium (AIM) containing 50g/mL of kanamycin to have an OD value of about 0.15, and cultured at 28 ℃ for 5 to 6 hours to make the OD600 of the bacterial liquid to be 0.5 to 0.6.

(3) Optimization of the transformation material of the strain of the gluconobacter strain FY-31: mu.L of recovery medium was added to a 1.5mL centrifuge tube containing 100. mu.L of protoplasts, and the mixture was subjected to recovery culture at 28 ℃ for 5 to 6 hours.

(4) Melting 100mL IM solid culture medium, cooling to 50 deg.C at room temperature, adding acetosyringone stock solution 200 μ L, cefamycin stock solution 100 μ L, streptomycin stock solution 100 μ L, kanamycin stock solution 100 μ L, gently shaking, mixing, pouring into 6cm disposable plastic culture dish, and making into induction plate. After the culture medium in the culture dish is solidified, a sterilized cellulose membrane with the diameter of 5cm is covered on the surface of the culture medium.

(5) 100 mu L of cultured agrobacterium AGL-1 (containing a carrier) bacterial liquid and 200 mu L of transformation material are mixed, the mixed liquid is uniformly coated on the surface of a nitrocellulose membrane on an induction plate, and the mixture is co-cultured for 48h at 22 ℃.

(6) Melting 100mL of PDA solid culture medium, cooling to 50 ℃ at room temperature, adding 200 μ L of acetosyringone stock solution, 100 μ L of cefomycin stock solution, 100 μ L of streptomycin stock solution, 100 μ L of kanamycin stock solution and 20 μ L of hygromycin stock solution, shaking gently, mixing uniformly, pouring into a 6cm disposable plastic culture dish, and preparing into a screening plate. The nitrocellulose membrane on the induction plate was cut into approximately 0.5cm strips, transferred to a screening plate, spaced approximately 0.5cm apart, and placed on a medium incubated at 28 ℃ for 7 days with visible growth of the hyphae between the nitrocellulose membrane strips.

(7) The grown mycelia were picked, transferred to a PDA plate containing 10. mu.g/mL hygromycin, and cultured at 28 ℃ for 5 days to confirm whether the transformation was successful. If growth is possible, the transformation is confirmed to be successful.

The transformation results are shown in FIG. 2: the vector pBDH3G-Thy1 yielded on average more than 20 transformants per medium pBDH3G-Thy2 yielded more than 13 transformants, whereas the control PKO1-HPH yielded on average only about 3 transformants per dish. The result shows that the transformation efficiency of the vector constructed by the invention is greatly improved compared with that of other vectors.

Example 4 detection of transformants

1. Stability detection of Staphylococus transformants

From the transformants obtained, 12 transformants were randomly selected, and were subcultured 5 times at 28 ℃ on PDA medium plates, and then subcultured on PDA plates containing 10. mu.g/mL hygromycin for 5 days at 28 ℃.

As a result, all 12 transformants can grow, which indicates that the transformants have good stability and the transferred resistance gene stably exists.

2. Green fluorescence detection of gluconobacter transformants

Three vectors transformed into transformants of Staphylococus at random were selected and cultured on PDA plates for 5 days at 28 ℃. Picking a small amount of hyphae with a picking needle, placing on a glass slide, making into an observation slide, and placing on a microscope stage. Turning on ultraviolet light (450-490 nm) and observing green fluorescence.

As shown in FIG. 3, the mycelia of the transformants with the vectors pBDH3G-Thy1 and pBDH3G-Thy2 constructed in the present invention also showed strong fluorescence, while only a small fraction of the mycelia of the transformants with pKO1-HPH as a control showed weak fluorescence. As shown in FIG. 4, the transformant of the vector constructed by the present invention can be expressed in conidium, spore germination, mycelium, and conidiophore cells, which indicates that the vector constructed by the present invention can make exogenous genes efficiently expressed in the cells of gluconobacter.

3. PCR detection of transformants of Staphylococus viticola.

(1) Small extraction of fungal genomic DNA

Extracting a buffer solution: containing 1M KCl, 100mM Tris-HCl, 10mM EDTA, pH 8.0.

(2) The extraction method comprises the following steps:

① growing 12 random transformant strains on PDA plate at 25 deg.C for 7 days, scraping hyphae with toothpick, placing into sterilized centrifuge tube containing 300 μ L extraction buffer solution 1.5mL, grinding ② hyphae with electric grinder, adding 300 μ L extraction buffer solution, and shaking vigorously for 2 min;

③ 10000 centrifuging at 10000rpm for 10 min;

④ sucking the supernatant to another centrifuge tube, and discarding the precipitate;

⑤ adding equal volume of isopropanol (analytically pure), precipitating nucleic acid, mixing by gentle inversion for several times, and centrifuging at 12000rpm for 10 min;

⑥ pouring out the supernatant, and draining on absorbent paper;

⑦ adding 300 μ L70% ethanol, mixing by gently inverting for several times, and centrifuging at 12000rpm for 2 min;

⑧ pouring out the supernatant, draining off water on absorbent paper, and standing at 37 deg.C for 15min to volatilize ethanol;

⑨ the pellet was resuspended in 50. mu.L of ddH2O to give genomic DNA at a concentration of 30 ng/. mu.L.

(3) PCR amplification of hygromycin-resistant and GFP genes in transformants

PCR amplification was performed using a 50. mu.L reaction system containing: 2 μ M each of the upstream and downstream primers, 200 μ M dNTPs, Mg²⁺1.5mM, 10 XPCR buffer 5. mu.L, template DNA 2. mu.L, Taq enzyme 2U.

The sequence of an upstream primer Hph-F of the hygromycin resistant gene is 5'-TCGTTATGTTTATCGGCACT-3', and the sequence of a downstream primer Hph-R of the hygromycin resistant gene is 5'-GTTCGGTCGGCATCTACT-3'.

The sequence of the upstream primer GFP1 of the GFP gene is 5'-GGCGAGGGCGAGGGCGATGC-3', and the sequence of the downstream primer GFP2 is 5'-AGTTCACCTTGATGCCGTTC-3'.

The PCR amplification reaction was performed on a Langzy MG96G type PCR machine. Reaction conditions are as follows: pre-denaturation at 94 ℃ for 2min, followed by 35 cycles comprising: denaturation at 94 ℃ for 30sec, annealing at 57 ℃ for 40sec, and extension at 72 ℃ for 1.5 min. Finally, extension is carried out for 10min after 72 ℃.

(4) Detection of PCR products

After the PCR reaction, the PCR product was detected by 1% agarose gel electrophoresis, and as a result, it was found that the 12 transformants all showed an electrophoretic band of about 850bp hygromycin-resistant gene (FIG. 5) and an electrophoretic band of about 400bp GFP gene (FIG. 6), indicating that both the hygromycin-resistant gene and the GFP gene were stably integrated into the genome of the Staphyloccocus vinosus.

(5) Quantitative PCR detection of expression level of transformed gene

① extraction of Total RNA of transformant

The mycelium was cultured as in example 2 using RNAioso PLus to extract total RNA from the samples, using the following specific steps:

1) a0.5 g sample of hyphae was placed in a pre-cooled mortar and ground to a powder in liquid nitrogen.

2) 1mL of RNAioso PLus was added and left at room temperature for 5min to allow sufficient lysis.

3) Centrifuging at 8500rpm for 5min, and discarding the precipitate.

4) Adding chloroform at a ratio of 200 μ L chloroform per ml RNAisso PLus, mixing for 15s, standing at room temperature for 15min, and centrifuging at 4 deg.C 8500rpm for 15 min.

5) Absorbing the upper aqueous phase, putting into another centrifuge tube, adding isopropanol according to the volume of 1:1, mixing uniformly, standing at room temperature for 10min, centrifuging at 4 ℃ 8500rpm for 10min, discarding the supernatant, and precipitating RNA at the bottom of the tube.

6) Adding 75% ethanol into RNAioso PLus 1mL 75% ethanol per mL, gently shaking the centrifuge tube, suspending and precipitating at 4 deg.C, centrifuging at 6500rpm for 5min, removing supernatant, and air drying on ice for 15 min.

7) RNase H removal with 100. mu.L₂And O, dissolving the RNA sample.

8) OD quantitation RNA concentration was determined and stored at-70 ℃.

② first Strand cDNA Synthesis

The first strand was synthesized using the reverse transcription kit Prime Script RT reagent kit with gDNA Eraser ((TaKaRa, Dalian China).

1) Removal of genomic DNA contamination in Total RNA

The removal reaction was completed on ice, the removal mixture was prepared according to table 2, centrifuged at low speed and mixed, reacted at 42 ℃ for 2min, and stored at 4 ℃ for further use.

TABLE 2 preparation of the mixture for genomic DNA removal reaction

2) Reverse transcription reaction

The RNA is reversely transcribed into cDNA by a Takara reverse transcription box, and the specific steps are as follows: preparing a reverse transcription reaction mixed solution (shown in table 3) on ice, centrifuging at a low speed, mixing uniformly, reacting at 37 ℃ for 15min, reacting at 85 ℃ for 5s, and storing at 4 ℃; by ddH₂O the reaction mixture was diluted to 200. mu.L and stored at-20 ℃.

TABLE 3 preparation of reaction mixture for inversion ratio

③ fluorescent quantitative PCR

The primers for the quantitative PCR reaction are shown in Table 1

1) The method comprises the steps of taking a Tubulin gene as an internal reference, detecting the primer pair of the Tubulin gene as Bd-Tubu/Bd-Tubd, detecting the hygromycin resistance gene as q-HPH-F/q-HPH-R, and detecting the primer pair of the GFP gene as GFP-F-RT/GFP-R-RT. Primer synthesis was performed by Shanghai Bioengineering, Inc.

2) RT-PCR reaction System (25. mu.L)

RT-PCR reaction mixtures were prepared on ice according to Table 4 and subjected to low speed centrifugation.

TABLE 4 qRT-PCR reaction mixture System preparation

qRT-PCR reaction conditions

qRT-PCR reaction was performed on an ICyceler iQ fluorescence quantitative PCR instrument (Bio-rad, USA) using a two-step process with reaction conditions set as: pre-denaturation at 95 ℃ for 30 s; the mixture enters circulation, wherein the denaturation is carried out for 3s at 95 ℃, and the annealing is carried out for 31s at 55 ℃, and the total number of the circulation is 40.

The relative expression level of the foreign gene is expressed in the formula E-2^CTt-CTgAnd (3) calculating, wherein E is the relative expression amount of the detected gene, CTt is the CT value of tubulin gene expression, and CTg is the CT value of the detected gene.

After the vectors pBDH3G-Thy1 and pBDH3G-Thy2 constructed by the invention and the PKO1-HPH plasmid used for comparison are transformed into the staphylococcus, both exogenous gene GFP and hygromycin resistant gene hygromycin B (HPH) are expressed, and the expression quantity of the vector constructed by the invention is far greater than that of the control vector PKO 1-HPH. Wherein the hygromycin-resistant gene was expressed more than 11-fold higher in the transformant pBDH3G-Thy2 than in the transformant pBDH3G-Thy1 than in the transformant pBDH3 1-HPH (FIG. 7). The expression level of the GFP gene in the transformants of pBDH3G-Thy1 and pBDH3G-Thy2 was 46 times higher than that of PKO1-HPH (FIG. 8).

Finally, it is also noted that the above-mentioned lists merely illustrate a few specific embodiments of the invention. It is obvious that the invention is not limited to the above embodiments, but that many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.

Claims

1. A plasmid vector is formed by modifying and constructing pCAMBIA1300, and is characterized in that a gene promoter of Hippocampus Histone H3, a gene promoter of Hippocampus stone transcription elongation factor α and a resistance gene are inserted into a multiple cloning site of pCAMBIA1300, and the resistance gene is positioned at the downstream of the gene promoter of the Hippocampus stone transcription elongation factor α;

the nucleotide sequence of the plasmodiophora viticola histone H3 gene promoter is shown as SEQ ID No.1, the nucleotide sequence of the plasmodiophora viticola transcription elongation factor α gene promoter is shown as SEQ ID No.2 or the nucleotide sequence of the plasmodiophora viticola transcription elongation factor α gene promoter is shown as SEQ ID No. 3;

the resistance gene is a hygromycin resistance gene;

a reporter gene is inserted into the downstream of the histone H3 gene promoter of the gluconobacter wallichiana, and the reporter gene is a GFP gene.

2. The method of constructing a plasmid vector according to claim 1, comprising the steps of:

(2) inserting the DNA fragment into the multiple cloning site of the pCAMBIA1300 vector through recombination reaction to obtain the plasmid vector;

the resistance gene is a hygromycin resistance gene, and primers are designed as follows:

an upstream primer: CATTATTATGGAGAAACGGCAGCAGAAAGGGTTGAGAC, respectively;

a downstream primer: CCTCGCCCTTGCTCACCATGCAGAAGTTGTGTTGGGTCGG, respectively;

an upstream primer: CTGTACAAGTAATCTAGATCGAGAGTGGAGAGTGGCGAGAAA, respectively;

a downstream primer: GTGAGTTCAGGCTTTTTCAT TGTAGAGGCTGAGGTGTCTG, respectively;

or

An upstream primer: CTGTACAAGTAATCTAGAGGAGTCATACCGTGAACA, respectively;

a downstream primer: GTGAGTTCAGGCTTTTTCAT TGTAGAGGCTGAGGTGTCTG, respectively;

the primers for amplifying the resistance gene are as follows:

an upstream primer: ATGAAAAAGCCTGAACTCACCG, respectively;

a downstream primer: ACGACGGCCAGTGCCACATCTACTCTATTCCTTTGCCC, respectively;

the GFP gene is inserted into the downstream of the gene promoter of the Hippocampus Histone H3, and the primers for amplifying the GFP gene are as follows:

an upstream primer: ATGGTGAGCAAGGGCGAGGAG, respectively;

a downstream primer: TCTAGATTACTTGTACAGCTCGTCCATGCCG are provided.