CN109666690B

CN109666690B - Method for over-expressing non-trace trichoderma fungus gene

Info

Publication number: CN109666690B
Application number: CN201910045672.7A
Authority: CN
Inventors: 沈其荣; 缪有志; 黄启为; 梅慧玲; 夏燕维
Original assignee: Nanjing Agricultural University
Current assignee: NANNING HARWORLD BIOTECHNOLOGY Co.,Ltd.
Priority date: 2018-02-08
Filing date: 2018-02-08
Publication date: 2020-05-26
Anticipated expiration: 2038-02-08
Also published as: CN108384797B; CN109666690A; CN108384797A

Abstract

The invention relates to a method for overexpressing a fungus gene of trichoderma traceless. First, a traceless knockout mutant of the Trichoderma guianensis ura3 gene was obtained by two homologous recombination events in combination with a hygromycin B resistance screening strategy and a 5-FOA lethal strategy. Based on the mutant, a knockout fragment containing an ura3 gene expression cassette is inserted into the target gene position through a homologous recombination mode, and the mutant which generates the first homologous recombination is screened by utilizing the auxotrophic characteristics of the ura3 traceless mutant. After the second homologous recombination, the ura3 gene and the target gene are recombined and removed, and then reverse screening is carried out by utilizing the lethal property of 5-FOA, so as to obtain a traceless mutant with the target gene completely deleted. The system is optimized enough, the homologous recombination ratio is more than 15%, the single-gene traceless operation period is shortened within 15 days, simultaneously traceless over-expression of a target gene can be realized, and no exogenous fragment is introduced in the process.

Description

Method for over-expressing non-trace trichoderma fungus gene

Description of divisional applications

The application is a divisional application with application date of 2018-02-08, application number of 2018101301042 and invented name of a method for editing genes of trichoderma traceless fungi.

Technical Field

The invention belongs to the technical field of applied microorganisms, and relates to a method for overexpressing a fungus gene of trichoderma traceless.

Background

The microbial organic fertilizer has the functions of promoting plant growth and preventing and controlling soil-borne diseases, can replace or partially replace chemical fertilizers, and is widely applied in agriculture to meet the national policy of weight reduction and drug reduction. The most important components in the microbial organic fertilizer are various active strains, and the active strains mainly comprise bacillus in bacterial classification and trichoderma filamentous fungi in fungal classification. Long-term research shows that the trichoderma filamentous fungi have the functions of promoting plant growth (cucumber, corn, banana, watermelon and the like), inducing exogenous immunity of plants, enhancing plant system resistance and preventing and controlling soil-borne diseases, and are widely applied to the production of microbial organic fertilizers due to environmental friendliness and multiple functions.

While the popularization and the application are carried out, theoretical research is also the greatest importance. The theoretical research of trichoderma mainly focuses on the aspects of plant growth promotion, pathogen antagonism, straw utilization and the like, and relates to the intersection among various disciplines such as fungal molecular biology, fungal genetics, cell biology, plant nutrition and the like. In the process, a set of mature genetic manipulation means is necessary for the deep exploration of the intrinsic mechanism of each function of trichoderma. Previous work of a team of the inventor shows that the trichoderma is sensitive to only a few antibiotics, wherein hygromycin B (hygromycin B) is applied, and the gene in the trichoderma is successfully knocked out and overexpressed by utilizing exogenous introduction of a hygromycin B phosphotransferase coding gene and steps of transformation, screening, verification after purification and the like. However, the intrinsic mechanism of different functions of trichoderma is very complex, and is a result of the participation and co-regulation of multiple genes. The genetic manipulation based on hygromycin B can only be performed on a single gene in a trichoderma genome, and the research on the characteristics and functions of the single gene is far from explaining the comprehensive results (growth promotion, antagonism, straw utilization and the like) of the interaction of multiple gene products in many cases. Meanwhile, the final purpose of theoretical research is to push application, and the deep research on the internal mechanisms of the functions of trichoderma helps us to understand how to effectively promote plant growth and prevent and control soil-borne diseases, and provides an effective path for enhancing the functions of the trichoderma, so that the field efficacy of the microbial organic fertilizer is continuously improved. Due to the biological safety consideration, the artificial genetic modification of the main functional strains in the microbial organic fertilizer cannot bring any exogenous DNA fragments. In view of the above, both the theoretical research and the practical application of trichoderma require a traceless, fast, efficient and recyclable gene editing system capable of realizing no gene quantity limitation.

Disclosure of Invention

The invention aims to provide a method for editing trichoderma genes, which is traceless and can be operated circularly, aiming at the reality that the genetic operation of the trichoderma polygenes is very difficult.

The purpose of the invention is realized by the following technical scheme:

the construction of a Trichoderma ura3 gene traceless knockout mutant comprises the following steps:

four pairs of primers were designed against the ura3 gene sequence: wherein, a pair of primers amplifies a 1-1.5kb sequence at the upstream of the ATG of the initiation codon of ura3 gene, and the sequence is an upstream fragment; amplifying the upstream fragment to 1-1.5kb sequence in the middle of the ura3 gene start codon ATG by a pair of primers to obtain a gene fragment; a pair of primers amplifies a 500-800bp sequence at the downstream of a target gene stop codon, and the sequence is a downstream segment; amplifying a complete expression frame of the hygromycin B phosphotransferase gene by using the last pair of primers, and naming the complete expression frame as a HygB resistance gene expression frame; the four different fragments are designed by primers so that a 25bp terminal overlapping region exists between two adjacent fragments. Wherein, the tail end of the upstream segment is coincided with the starting end of the downstream segment, the tail end of the downstream segment is coincided with the starting end of the HygB resistance gene expression frame, and the tail end of the HygB resistance gene expression frame is coincided with the starting end of the ura3 gene segment. The Trichoderma genome DNA is used as a template, an upstream fragment, a downstream fragment and a ura3 gene fragment are obtained by PCR amplification by using high fidelity enzyme, and the plasmid pcDNA1 is used as a template to obtain the HygB resistance gene expression cassette by PCR amplification. And obtaining an ura3 gene knockout fragment of the upstream fragment + the downstream fragment + the HygB resistance gene expression cassette + the ura3 gene fragment by fusion PCR. The ura3 gene knockout fragment is transformed into trichoderma protoplast to obtain a mutant. Mutants were cultured on PDA medium containing 200ppm HygB. Mutant DNA that could grow on PDA medium containing 200ppm HygB was extracted by a hyphal lysis kit (PlantDirect PCR kit, Thermo Secientific) and verified by first homologous recombination, and the mutant strain that underwent correct homologous recombination was retained and cultured at 28 ℃ until sporulation. Spores of the correct mutant subjected to the first homologous recombination are coated on a GSM solid medium containing 1.5mg/ml 5-FOA and 5nmol uridine, the spores of the mutant subjected to the correct second homologous recombination can germinate and grow colonies on a GSM (global system for mobile communications) plate containing 5-fluoroorotic acid (5-FOA) and uridine, and the positive mutant is picked and purified and verified to obtain the Trichoderma mutant with the ura3 gene subjected to traceless knockout.

The trichoderma is a non-auxotrophic trichoderma containing ura3 gene, and preferably trichoderma guizhouense NJAU 4742.

The upstream fragment amplification primer is a 5' end primer U3-upF: SEQ ID NO.1 and 3' end primer U3_ upR: SEQ ID No. 2; the downstream fragment amplification primer is a 5' end primer U3_ downF: SEQ ID NO.3 and 3' end primer U3_ downR: SEQ ID No. 4; the primer for amplifying the HygB resistance gene expression cassette is a 5' end primer hygBox _ F: SEQ ID No.5 and 3' primer hygBox _ R: SEQ ID No. 6; the ura3 gene fragment amplification primer is a 5' end primer U3_ geneF: SEQ ID NO.7 and 3' end primer U3_ gene R: SEQ ID NO. 8.

In the fusion PCR first-step reaction system, 10 mu l of HiFi Premix, 2 mu l of each of four fragments and ddH₂O2. mu.l, reaction program 98 ℃ for 1s, (98 ℃ for 10s, 60 ℃ for 7s, 72 ℃ for 40s)_{15 cycles}And storing at 4 ℃. Fusion PCR in the second step reaction system HiFi Premix 25. mu.l, first step reaction product 4. mu.l, U3_ upF and U3_ gene R primer each 2. mu.l, ddH₂O17. mu.l, reaction program 98 ℃ for 1s, (98 ℃ for 10s, 60 ℃ for 7s, 72 ℃ for 40s)_{30 cycles}And storing at 4 ℃.

The first homologous recombination verification primer of the mutant is E _ u 3F: SEQ ID NO.9 and E _ hygB _ R: SEQ ID NO. 10.

A targeted gene traceless knockout method based on a trichoderma delta ura3 traceless mutant comprises the following steps:

(1) constructing a target gene knockout fragment: four pairs of primers were designed for the target gene sequence: wherein, a pair of primers amplifies a 1-1.5kb sequence at the upstream of the initiation codon ATG of the target gene to be an upstream fragment; a pair of primers amplifies a 1-1.5kb sequence in a target gene to be a gene fragment; a pair of primers amplifies a 500-800bp sequence at the downstream of a target gene stop codon, and the sequence is a downstream segment; finally, amplifying a ura3 gene complete expression frame of trichoderma guizhouense with a total length of 3598bp by a pair of primers, and naming the expression frame as a U3 expression frame; the four different fragments are designed through primers to enable a terminal coincidence region of 25bp to be formed between two adjacent fragments, wherein the terminal of an upstream fragment coincides with the starting end of a downstream fragment; the tail end of the downstream segment is coincided with the starting end of the U3 expression frame; the tail end of the U3 expression frame is coincided with the starting end of the gene segment; after the trichoderma genome is used as a template and four segments are obtained by PCR amplification of the four pairs of primers, the four segments are connected by a fusion PCR method according to an upstream segment, a downstream segment, a U3 expression frame and a gene segment, and finally a four-segment fusion product is obtained, namely a target gene knockout segment;

(2) transforming a trichoderma mutant protoplast of the traceless knockout ura3 gene of any one of claims 1-7 with the knockout fragment of interest;

(3) and obtaining the trichoderma mutant with the target gene knocked out without trace through two times of homologous recombination screening. GSM (9.89mM KNO) is preferably used₃，7.35mM KH₂PO₄，6.7mM KCl，2.03mM MgSO₄·7H₂O，0.9mM CaCl₂，0.094mMMnSO₄·H₂O，0.048mM ZnSO₄·7H₂O，0.18mM FeSO₄·7H₂O，0.121mM CoCl₂·6H₂O, 1% glucose) culture medium is used as a screening culture medium of the first homologous recombination mutant, the screened first homologous recombination mutant is inoculated on a PDA (personal digital assistant) plate, and spore is produced at 28 ℃; spores were plated on GSM solid medium containing 1.5mg/ml 5-fluoroorotic acid (5-FOA) and 5nmol uridine for selection of second homologous recombination mutants.

The traceless knockout method of the target gene preferably comprises the following steps:

1.1 construction of target gene knockout fragment:

according to the research requirement, a target gene is selected and the genome sequence of the gene is obtained from the genome. Visualization software such as SnapGene is utilized to display a target gene sequence, and four pairs of primers are designed for amplifying internal sequence elements of the knockout fragment. Wherein, a pair of primers amplifies a 1-1.5kb sequence at the upstream of the initiation codon ATG of the target gene to be an upstream fragment; a pair of primers amplifies a 1-1.5kb sequence in a target gene to be a gene fragment; the other pair of primers amplifies a 500-800bp sequence downstream of the termination codon of the target gene, and the sequence is a downstream segment; and finally, amplifying the ura3 gene complete expression frame of the trichoderma by a pair of primers, wherein the total length is 3598bp, and the expression frame is named as a U3 expression frame. The four different fragments are connected by a fusion PCR method according to an upstream fragment, a downstream fragment, a U3 expression frame and a gene fragment through a primer design so that a terminal overlapping region of 25bp is formed between two adjacent fragments, and an obtained four-fragment fusion product is a target gene knockout fragment, wherein the product concentration is ensured to be more than 200 ng/mul. The fusion PCR procedure was as described in scheme 1.

1.2 protoplast preparation of a Trichoderma DELTA ura3 traceless mutant

First, a suitable amount of PDA solid medium (BD Co., U.S.A.) was prepared and sterilized at 115 ℃ for 20 min. 20 PDA solid plates of about 9cm diameter were prepared and covered with a sterile fibrous membrane. 50 μ l spores of a Trichoderma DELTA ura3 traceless mutant (about 10)⁸Pieces/ml) was uniformly coated on a PDA plate containing a fibrous membrane. After standing at 28 deg.C for 20h, taking out PDA plate, taking out the fiber membrane with hyphae, and reversely sticking it on the lysis solution (1.2Msorbitol, 0.1M KH) containing 3-4ml of protoplast₂PO₄pH 5.6, 7.5mg/ml lysine enzyme, Sigma: L1412), and this was done to ensure that 5-7 sheets of fiber membranes were treated per plate. The plates were then incubated at 28 ℃ for 100min at 100rpm, after which the fibrous membranes in the plates were removed under a sterile hood and it was ensured that most of the mycelia remained in the plates, during which time solution A (1.2M sorbitol, 0.1M KH) was used₂PO₄pH 5.6) to wash the residual mycelium blocks on the fiber membrane, and repeatedly blowing and sucking the mycelium blocks in the liquid for more than 200 times by using the gun head to fully release the protoplasts inside. Then, the mixture was filtered through a 1.5ml tube containing 4 layers of gauze, the lower filtrate was retained and the temperature was 4 ℃ at 2000rpmAnd centrifuging for 10 min. After centrifugation was complete, the supernatant was discarded, the bottom protoplast pellet was retained, and the pellet was washed with 4 ℃ solution B (1M sorbitol, 50mM CaCl)₂10mM Tris-HCl, pH 7.5) to obtain the protoplast of the Trichoderma delta ura3 traceless mutant, and ensuring the protoplast concentration to be 10⁷More than one/ml.

1.3 transformation of the knockout fragment of the target Gene and screening, purification and verification of the first homologous recombination mutant

Protoplast transformation: mu.l of the above protoplast solution, 10. mu.l of the knockout fragment of interest solution, and 50. mu.l of PEG solution (25% PEG6000, 50mM CaCl)₂10mM Tris-HCl, pH 7.5) were added in sequence to a 15ml sterile tube, gently mixed and placed on ice for 20 min. Then 2ml of PEG solution was added and mixed by inversion, and left at room temperature for 5min, then 3ml of solution B was added and mixed by inversion. About 5ml of the final transformation solution was applied uniformly in 500. mu.l portions to 9cm plates containing 1/2PDA and 1M sucrose, which were not dried, applied uniformly, and sealed. And then placing the transformation plate at 28 ℃ for static culture for about 24 hours, covering a layer of GSM solid inorganic salt culture medium on the original plate after the protoplast germinates, and continuing to place the transformation plate at 28 ℃ for culture. After about 48h, the lower protoplast genome that achieved successful transformation will contain the complete ura3 gene expression cassette and thus be able to grow in GSM medium without uridine present, show growth from 1/2PDA medium in the lower layer to the GSM medium surface in the upper layer, and form a regular circle-like growth circle. And then picking surface bacterium blocks and transferring the surface bacterium blocks to a new GSM solid plate, quickly releasing mutant genome DNA by using a hypha cracking kit after the plate is overgrown, and performing PCR verification of the occurrence of the first homologous recombination of the target gene by using a homologous recombination detection primer. Diluting the correctly verified mutant spores, coating the diluted mutant spores on a GSM solid plate, selecting single spores, transferring the single spores to a PDA solid culture medium, and performing PCR verification once after hyphae grow well to ensure the correctness of the spores.

1.4 screening of traceless knockout mutants of target genes

The final mutant in 1.3 above is the product of the first homologous recombination at the target gene position, the upstream fragment and gene fragment at both ends of the knockout fragment undergo homologous recombination with the same fragment at the target gene position, respectively, and the U3 expression cassette is integrated at the target gene position, therefore, the mutant itself can grow on normal GSM solid plates relative to auxotrophic strains without ura3 gene. And (3) recovering spores of the mutant on a PDA solid plate, wherein the mutant spontaneously carries out second homologous recombination in the sporulation process, the recombination event occurs between a downstream fragment of the knockout fragment and a downstream fragment of the target gene, the recombination result is to remove all the U3 expression boxes and the target gene sequence, and only the upstream fragment and the downstream fragment sequence of the target gene are reserved at the position of the target gene. Therefore, when the mutant spores were plated on a GSM solid medium containing 1.5mg/ml 5-fluoroorotic acid (5-FOA) and 5nmol uridine, the spores that did not undergo the second homologous recombination contained the intact ura3 gene, and 5-FOA was lethal to them, whereas the spores that did undergo the second homologous recombination were not lethal because ura3 gene was deleted, and showed good growth on GSM solid plates under the condition of exogenous addition of uridine. Therefore, after 72h, colonies growing on the GSM plate containing the 5-FOA and the uridine are all target gene traceless knockout mutants subjected to secondary recombination, hypha blocks of the colonies are picked to a new GSM plate containing the 5-FOA and the uridine, the GSM plate is placed and cultured for 4d at 28 ℃, spores are collected, diluted and coated, and single spores are picked for verification, so that the traceless knockout strains of the target genes are obtained.

1.5 circular knockout of other genes of interest

The obtained target gene 1 traceless knockout mutant realizes the traceless knockout of the target gene, and simultaneously keeps the characteristics of the trichoderma delta ura3 traceless mutant, namely does not contain a ura3 gene expression cassette. Therefore, the knockout of other target genes can be carried out by taking a traceless knockout mutant of the target gene 1 as a preparation strain of the protoplast, carrying out the same operation on the target gene 2 according to the method to obtain traceless knockout mutants of the target genes 1 and 2, and so on, so that a multi-gene traceless knockout mutant according to the will of researchers can be obtained.

1.6 anaplerotic insertion of the ura3 Gene expression cassette

ura3Deletion of the gene can result in auxotrophic characteristics of the Trichoderma strain, i.e., requiring exogenous provision of uridine or uracil, to enable the strain to grow normally. Thus, traceless knock-out of the last gene or a single gene in multigene editing requires the complementation of the ura3 gene expression cassette endogenous to trichoderma. The specific operation steps taking the last gene in the multi-gene editing as an example are as follows: first, 3-fragment homologous knock-out fragments, i.e., the upstream fragment of the last gene + the U3 expression cassette + the downstream fragment of the last gene, were constructed by the fusion PCR method described above. Meanwhile, protoplasts of mutants with traceless knockout of other target genes were prepared. By the above PEG-CaCl₂Mediated protoplast transformation methods knockout fragments were introduced into prepared protoplasts and screened and validated as described in 1.3. In the process, the upstream segment and the downstream segment of the last gene in the knockout segment are subjected to homologous recombination with the corresponding positions of the target gene in the genome respectively, so that the target gene segment is removed and replaced by a U3 expression box, and therefore, the knockout of the most one gene and the complementation of the ura3 gene are realized.

A method for traceless overexpression of a target gene, comprising the steps of:

the overexpression method is relatively simpler than the traceless knockout, but is also based on a Trichoderma auxotrophic strain, Δ ura3 traceless mutant. The target gene used for overexpression and the strong promoter required for overexpression are all endogenous fragments of trichoderma, and a U3 expression frame and the target gene overexpression frame are fused into a complete fragment through fusion PCR. The over-expressed fragments were then transferred to Trichoderma and the correct mutants were selected as described above for transformation 2.3. The overexpression mutant has a complete trichoderma endogenous U3 expression frame, so that the overexpression mutant can show the same nutrient utilization characteristics as the original strain, uridine or uracil does not need to be added externally, and the target gene can be correctly overexpressed.

The invention has the beneficial effects that:

the invention solves the scientific research problem that the operation of the polygene of the trichoderma is extremely difficult for the first time, realizes the traceless recyclable operation (gene knockout and overexpression) of the polygene in the trichoderma, and provides powerful methodology support for the deep research on the functional mechanisms of plant growth promotion, pathogen antagonism, straw utilization and the like of the important strain trichoderma in the microbial organic fertilizer; meanwhile, a set of safe and effective genetic modification system without exogenous fragment intervention is provided for theoretical research of functional strains of trichoderma in microbial organic fertilizers to result transformation.

Drawings

FIG. 1 is a schematic diagram of a traceless gene editing system for Trichoderma Guizhou

FIG. 2 plate screening of ura3 gene traceless knockout first homologous recombination mutants from Trichoderma Guizhou NJAU 4742; colonies marked by white arrows are correct insertions of knock-out fragments into NJAU4742 genome

FIG. 3 plate screening of the ura3 gene traceless knockout second homologous recombination mutation in Trichoderma Guizhou NJAU 4742; the black arrows in the figure and the series of white circular spots not marked are the ura3 gene traceless knockout strains which have correct two-time homologous recombination

FIG. 4 is a plot of colony growth diameters of different mutants of Trichoderma Guizhou on different media; NJAU4742 is an original strain, NJAU 4742-delta ura3 is a ura3 gene traceless knockout mutant, and NJAU4742-1 is a first homologous recombination mutant in the ura3 gene traceless knockout process; GSM is GSM inorganic salt culture medium, B is supplemented with 200ppm HygB, U is supplemented with 5nmol of uridine

FIG. 5 plate screening of xyr1 gene traceless knockout first homologous recombination mutants in Trichoderma Guizhou NJAU4742- Δ ura 3; the bacterial colony formed by the black dotted circles is a mutant strain suspected of generating the first homologous recombination in the lower layer culture medium and capable of growing to the surface of the upper layer GSM culture medium

FIG. 6 SDS-PAGE graphs of extracellular proteins induced by lignocellulose of Trichoderma Guizhou NJAU4742 and NJAU4742- Δ ura3- Δ xyr 1; m is protein marker, C1, C2 and C3 are extracellular protein SDS-PAGE silver staining lanes after 72h of cellulose induction, and X1, X2 and X3 are extracellular protein SDS-PAGE silver staining lanes after 72h of xylan induction. xyr1 gene mutant can hardly secrete any extracellular protein.

FIG. 7 knock-out of carbon source inhibitory factor encoding gene cre1 and ura3 gene complementation assay in Trichoderma Guizhou NJAU 4742; a is a PCR verified gel chart of correct homologous recombination of cre1 gene position, NJAU 4742-delta ura 3-delta xyr 1-delta cre1 shows that ura3 mutant has about 1600bp amplification product, and NJAU 4742-delta ura 3-delta xyr1 does not have any amplification product. B is a gel picture of a cre1 gene fragment detection, NJAU 4742-delta ura 3-delta xyr 1-delta cre1, ura3 has no amplification product because cre1 gene is completely knocked out, and NJAU 4742-delta ura 3-delta xyr1 has an amplification product of about 970 bp. C is ura3 gene detection gel picture, NJAU 4742-delta ura 3-delta xyr 1-delta cre1, ura3 has about 600bp amplification product because ura3 gene is correctly complemented, and NJAU 4742-delta ura 3-delta xyr1 does not have any amplification product. D is a growth condition diagram of NJAU 4742-delta ura 3-delta xyr 1-delta cre1, namely ura3 and NJAU 4742-delta ura 3-delta xyr1 on a PDA culture medium. Wherein: a, NJAU 4742-delta ura 3-delta xyr 1-delta cre1, ura3, b: NJAU4742- Δ ura3- Δ xyr1, M: DNAmarker, DL 2000.

FIG. 8 Trace-free overexpression qPCR validation of nit3 gene in Trichoderma Guizhou NJAU 4742; a: NJAU 4742-delta ura3-OEnit3: ura3, b: NJAU4742- Δ ura 3.

Biological sample preservation information

NJAU4742, classified and named as Trichoderma guizhou, deposited in No.1 Xilu north Chen of the south facing area of Beijing, 3, the general microbiological center of the China Committee for culture Collection of microorganisms, with the date of 2016, 04, 11 days, the date of deposit being in the institute of microbiology of the national institute of sciences, No.3, the north Chen Xilu 1 North Chen of the south facing area of Beijing, and the strain preservation number being CGMCC NO. 12166.

Detailed Description

The invention is further illustrated below with reference to specific embodiments. The embodiments are only used for illustrating the implementation method of the invention and are not used for limiting the application scope of the invention. The reaction is carried out according to conventional conditions well known to those skilled in the art, unless otherwise specified.

Implementation 1: construction of traceless mutant of Trichoderma Guizhou NJAU4742 auxotrophic strain NJAU 4742-delta ura3

(1) Knock-out fragment construction

The traceless knockout process of ura3 uses the presence of the gene itself as a selection marker for secondary homologous recombination, and thus is slightly different when constructing a knockout fragment. The knock-out fragment consists of 4 different parts: upstream fragment + downstream fragment + HygB resistance gene expression cassette + gene fragment. Wherein, the expression frame of the HygB resistance gene can be transcribed and translated into hygromycin B phosphotransferase, so that the original strain NJAU4742 has hygromycin B resistance, and after the secondary homologous recombination, the expression frame of the HygB resistance gene and the ura3 gene sequence are deleted together, therefore, 5-FOA can be used for reverse screening to obtain a traceless knockout mutant of the ura3 gene. In conclusion, it is necessary to use the HygB resistance gene as a selection marker in the first homologous recombination without disrupting the original expression cassette of ura3 gene, otherwise the second homologous recombination cannot be selected. Thus, the knock-out fragment primers were designed as follows: the upstream fragment amplification primer is a 5' end primer U3-upF: CTGTCAGGCAATTAGCACAGG (SEQ ID NO.1) and a 3' end primer U3_ upR: CGGCATTGGACAAGAGCTTCTGACTAACAAGCGCCATCAATGC (SEQ ID NO. 2); the downstream fragment amplification primer is a 5' end primer U3_ downF: GCATTGATGGCGCTTGTTAGTCAGAAGCTCTTGTCCAATGCCG (SEQ ID NO.3) and 3' end primer U3_ downR: GCCATATTGATGTAAGGTAGCTCTCCGTATTCTCTGCCCTTGTTGC (SEQ ID NO. 4); the primer for amplifying the HygB resistance gene expression cassette is a 5' end primer hygBox _ F: GAGAGCTACCTTACATCAATATGGC (SEQ ID NO.5) and the 3' end primer hygBox _ R: GGTACTATGGCTTAGATGGAATACCC (SEQ ID NO. 6); the gene fragment amplification primer is a 5' end primer U3_ geneF: GGGTATTCCATCTAAGCCATAGTACCCACATTTACATCCAGGTCGACG (SEQ ID NO.7) and 3' end primer U3_ gene R: CTAGATATGAAGGACAGCTGGCG (SEQ ID NO. 8). An upstream fragment (223 ng/. mu.l), a downstream fragment (236 ng/. mu.l), a gene fragment (195 ng/. mu.l) and a HygB resistance gene expression cassette (264 ng/. mu.l) were PCR-amplified from NJAU4742 genome and pcDNA1 plasmid, respectively, using PrimeSTAR HS DNA polymerase (TAKARA) Hi-Fi enzyme. The final 5950bp long knockout fragment (341 ng/. mu.l, 50. mu.l) was recovered by gel cutting using a gel recovery kit by the following fusion PCR procedure.

Fusion PCR in the first reaction system HiFi Premix 10. mu.l, fragments 2. mu.l each, ddH₂O2 mu l; the reaction sequence was 98 ℃ for 1s, (98 ℃ for 10s, 60 ℃ for 7s, 72 ℃ for 40s)_{15 cycles}And storing at 4 ℃. Fusion PCR in the second step reaction system HiFiPremix 25. mu.l, first step reaction product 4. mu.l, U3_ upF and U3_ geneR primers 2. mu.l each, ddH₂O17 μ l; the reaction sequence was 98 ℃ for 1s, (98 ℃ for 10s, 60 ℃ for 7s, 72 ℃ for 40s)_{30 cycles}And storing at 4 ℃.

(2) Protoplast transformation

The original strain NJAU4742 fresh protoplast (final concentration of 2.51X 10) is prepared by the protoplast preparation process in the invention content⁷Pieces/ml). Using PEG-CaCl₂Mediated protoplast transformation method about 3.41. mu.g DNA of 10. mu.l knockout fragment was mixed with 200. mu.l protoplast for transformation, and finally about 5ml transformation solution was uniformly coated on a PDA solid plate containing 1M sucrose in 500. mu.l portions, and after 24 hours of standing and culturing at 28 ℃, a layer of solid PDA medium containing 200ppm HygB was overlaid thereon, and standing and culturing at 28 ℃ was continued for 3-5 days.

(3) Screening and purifying first homologous recombination mutant

After growing the double-layer PDA plate for 3-5 days, the mutant strain with the correctly inserted knockout fragment can resist HygB, so that the mutant strain grows in the PDA culture medium with 200ppm HygB on the upper layer, therefore, a white mycelium block with good growth can be observed (as shown in figure 2), the mycelium block is picked and is connected to a new PDA plate with 200ppm HygB to continue to grow, a mycelium lysis kit (Plant Direct PCR kit, Thermo Secientific) is used for carrying out the first homologous recombination verification of the mutant, and the verification primer is E _ u 3F: AGCGAGGGACTGGGATTATGAG (SEQ ID NO.9) and E _ hygB _ R: CAAGTACAACCTAACAGCTGAGCAC (SEQ ID NO.10), the mutant strain in which the correct homologous recombination has occurred is retained and allowed to continue growing until sporulation.

(4) Screening and purifying second homologous recombination mutant and verifying NJAU 4742-delta ura3 traceless mutant

Spores of the correct mutants that underwent the first homologous recombination were plated on GSM solid medium containing 1.5mg/ml 5-FOA and 5nmol uridine and observed for spore germination and growth after culturing at 28 ℃ for 3-5 days. As shown in FIG. 3, the fragments which underwent the second homologous recombination were able to germinate and colonize on GSM plates containing 5-FOA and uridine, and the mutants were picked and verified by purification to give a traceless NJAU4742- Δ ura3 mutant. As shown in fig. 4, functional verification of the original strain, NJAU4742, the mutant strain in which the first homologous recombination occurred, and the traceless mutant of NJAU4742- Δ ura3 revealed that: NJAU4742 was not able to grow on HygB plates, nor on plates containing 5-FOA, indicating that NJAU4742 has the complete ura3 gene expression cassette but not HygB resistance; the mutant strain in which the first homologous recombination occurred was able to grow on the HygB plate but was not able to grow on the 5-FOA-containing plate, indicating that it had a complete HygB resistance gene expression cassette and a complete ura3 gene expression cassette; NJAU4742- Δ ura3 traceless mutants were not able to grow on HygB plates, but were able to grow on plates containing 5-FOA, indicating that NJAU4742- Δ ura3 traceless mutants did not have either a HygB resistance gene expression cassette or a ura3 gene expression cassette.

Implementation 2: traceless knockout of trichoderma Guizhou NJAU4742 lignocellulose degrading enzyme regulatory gene xyr1

Trichoderma strain: trichoderma Guizhou NJAU 4742-delta ura3(NJAU 4742-delta ura3)

(1) Knock-out fragment construction

The knockout fragment amplification primers are respectively: upstream fragment amplification primer x1 — upF: GGCCTTGAAACGGTATGTCGA (SEQ ID NO.11) and x1_ upR: CGTACACACCATCACAGGGATATCAATAGGAGATGGCTGAACTGTGTG (SEQ ID NO. 12); downstream fragment amplification primer x1_ downF: CACACAGTTCAGCCATCTCCTATTGATATCCCTGTGATGGTGTGTACG (SEQ ID NO.13) and x1_ downR: GCCATATTGATGTAAGGTAGCTCTCCTCACTTCCGCTTCACATAGACC (SEQ ID NO. 14); u3 expression cassette amplification primer U3box _ F: GAGAGCTACCTTACATCAATATGGCGCGCAGATGTAGCGGTACATG (SEQ ID NO.15) and U3box _ R: GGTACTATGGCTTAGATGGAATACCCCGTATTCTCTGCCCTTGTTGC (SEQ ID NO. 16); gene fragment amplification primer x1_ geneF: GGGTATTCCATCTAAGCCATAGTACCCTTCTTCAGCCCTTGATCCACAC (SEQ ID NO.17) and x1_ gene R: CCTTGATTCACACGCAAATGTTCC (SEQ ID NO. 18). The final concentration of the knock-out fragment constructed by fusion PCR was 263 ng/. mu.l, for a total of 40. mu.l.

(2) Protoplast transformation

As above PEG-CaCl₂The mediated protoplast transformation method comprises obtaining about 5ml of transformation solution, spreading 500. mu.l each of the solution on 1/2PDA plates containing 1M sucrose, standing at 28 deg.C for 24h, and covering with solid GSM medium at 28 deg.CAnd (5) continuing culturing.

(3) Screening and purifying first homologous recombination mutant

After the double-layer screening plate is cultured at 28 ℃ for 48-72h, obvious round bacterium blocks grow on the surface of the upper GSM culture medium, as shown in FIG. 5. Mutants of each circular pellet were inoculated onto new GSM solid plates and verified for the first homologous recombination using a hyphal lysis kit (Plant Direct PCR kit, Thermo scientific) to verify primers E _ x1_ F, AGCGAGGGACTGGGATTATGAG (SEQ ID No.19) and Eu3box _ R, CATCCAATGCAATGCATGCGAG (SEQ ID No. 20). It was verified that a total of 3 independent mutants were obtained in which the first homologous recombination occurred.

(4) Screening and purifying second homologous recombinant mutant and verifying NJAU 4742-delta ura 3-delta xyr1 traceless mutant

The 3 mutants independently undergoing the first homologous recombination are respectively inoculated on a PDA plate, and cultured at 28 ℃ to produce spores. Spores of the mutant are coated on a GSM solid medium containing 1.5mg/ml 5-FOA and 5nmol uridine, a large number of small circular bacterial blocks formed by spore germination and growth appear on GSM plates of the mutant 1 and the mutant 2 after 5d, no bacterial block grows in the mutant 3, the knockout fragment is randomly inserted into other positions of a chromosome presumably while homologous recombination occurs, and the randomly inserted fragment cannot undergo secondary homologous recombination, so that an ura3 gene expression frame cannot be eliminated, and the mutant cannot grow on the GSM plates containing the 5-FOA.

xyr1 Gene traceless knock-out yielded a total of 2 independent NJAU4742- Δ ura3- Δ xyr1 mutants. Functional studies on the gene show that the deletion of the xyr1 gene can completely lose the induction and secretion capacity of lignocellulose degrading enzyme of trichoderma guichenense NJAU 4742. The specific detection method comprises the steps of respectively inoculating the NJAU 4742-delta ura 3-delta xyr1 mutant and the original strain NJAU4742 into a GSM liquid culture medium, culturing at 28 ℃ and 150rpm for 48h, filtering through 2 layers of sterile gauze to obtain mycelium of the mutant and the original strain, and respectively transferring the mycelium into the GSM liquid culture medium (without adding glucose) containing 1% (w/v) xylan or cellulose to continue the induction culture of the lignocellulose degrading enzyme. After 72h, the liquid fermentation broth was recovered, centrifuged at 10000rpm for 5min and the supernatant was retained. The NJAU 4742-delta ura 3-delta xyr1 mutant and the fermentation supernatant of the original strain were subjected to protein separation by SDS-PAGE, and protein coloration by silver staining. The results show that NJAU4742- Δ ura3- Δ xyr1 is not capable of secreting any extracellular proteins including lignocellulose degrading enzymes (as shown in FIG. 6).

Implementation 3: non-trace knockout of trichoderma guizhouense NJAU4742 carbon source inhibition regulatory gene cre1 and ura3 gene anaplerotic trichoderma strain: trichoderma Guizhou NJAU 4742-delta ura 3-delta xyr1(NJAU 4742-delta ura 3-delta xyr1)

(1) Homologous knock-out fragment construction

The knockout fragment is: the upstream fragment of the cre1 gene + the U3 expression cassette + the downstream fragment of the cre1 gene. The amplification primers are respectively: upstream fragment amplification primer c1 — upF: GGTGGGCAAAAAGGAACCTGG (SEQ ID NO.21) and c1_ upR: GCCATATTGATGTAAGGTAGCTCTCAGAGATTATCCGCTGGTGGAGTG (SEQ ID NO. 22); u3 expression cassette amplification primer U3box _ F: GAGAGCTACCTTACATCAATATGGCGCGCAGATGTAGCGGTACATG (SEQ ID NO.23) and U3box _ R: GGTACTATGGCTTAGATGGAATACCCCGTATTCTCTGCCCTTGTTGC (SEQ ID NO. 24); downstream fragment amplification primer c1_ downF: GGGTATTCCATCTAAGCCATAGTACCGCGCCTCGAATGACTTGATGAC (SEQ ID NO.25) and c1_ downR: GCCCTACGAGAATGTCGGTTC (SEQ ID NO. 26). The final concentration of the knock-out fragment constructed by fusion PCR was 383 ng/. mu.l, for a total of 40. mu.l.

(2) Protoplast transformation

As above PEG-CaCl₂The protoplast transformation method was performed by obtaining about 5ml of transformation solution, spreading 500. mu.l each of the solution on 1/2PDA plates containing 1M sucrose, incubating at 28 ℃ for 24 hours, spreading a solid GSM medium on the surface, and further incubating at 28 ℃.

(3) Screening and purification of cre1 traceless knockout and ura3 gene complementation mutant

After the double-layer screening plate is cultured at 28 ℃ for 48-72h, an obvious circular colony grows on the surface of an upper GSM culture medium, the circular colony is transferred to a new GSM solid plate, homologous recombination verification is carried out by using a hypha lysis kit, and a verification primer is E _ c1_ F: CACACCAGACCAAGCCGTATTC (SEQ ID NO.27) and Eu3box _ R: CATCCAATGCAATGCATGCGAG (SEQ ID NO.28), and the pair of primers can detect the correct homologous recombination of the knockout fragment to the target gene position, and the correct size of the PCR product is about 1600 bp. The correct mutants were sporulated, diluted and plated, and the single spores were picked up on new GSM medium and cultured at 28 ℃. The correct homologous recombination fragment is continuously verified by verifying the primers E _ c1_ F and Eu3box _ R; verifying primers cre1_ F, GTGCCCTCTTTGTGAAAAGGC (SEQ ID NO.29) and cre1_ R, GCAGTTGAACTTCTGCCGCT (SEQ ID NO.30) to verify whether cre1 gene is knocked out, wherein an amplification product is a fragment of about 970bp in cre1 gene, and a PCR product is not generated when a complete knock-out mutant is generated; by verifying primer ura3_ F: ATGACATGGTCTCTGGATGGG (SEQ ID NO.31) and ura3_ R: GTTGCCTTGGCTAGACATCTGG (SEQ ID NO.32) verified that ura3 gene was successfully complemented back, and the correctly complemented PCR product was about 600 bp. The experimental results showed that the cre1 gene was completely knocked out and the complete expression cassette of ura3 gene was complemented (as shown in FIG. 7), and the resulting mutant NJAU 4742-delta ura 3-delta xyr 1-delta cre1: ura3 was able to grow on GSM medium without uridine or uracil. The traceless knockout of the cre1 gene resulted in a strain that grew slowly in polar growth on PDA media, exhibiting a completely different colony morphology from the original strain NJAU4742 (as shown in figure 7).

Implementation 4: traceless overexpression of gene nit3 related to auxin synthesis of trichoderma guizhouensis NJAU4742

(1) Overexpression fragment construction

The sequence of internal elements for construction of the over-expressed fragment is: endogenous strong promoter sequence + nit3 complete gene sequence + nit3 complete terminator sequence + U3 expression cassette. Endogenous strong promoter sequence was determined by primer P _ F: CTGATCTGGGTTGCACGCTTG (SEQ ID NO.33) and primer P _ R: GATGATTGATGTGGGTTGTTTTGGG (SEQ ID NO.34) from NJAU4742 genomic DNA amplification; nit3 complete Gene sequence + nit3 complete terminator sequence the primer nit3_ F: CCCAAAACAACCCACATCAATCATCATGAGCGAAACTATCAAAGTTGGC (SEQ ID NO.35) and primer nit3_ R: GCCATATTGATGTAAGGTAGCTCTCCCAACTAGCAAGTACCTCGAGC (SEQ ID NO.36) from NJAU4742 genomic DNA amplification; the U3 expression cassette was determined by primer U3box _ F: GAGAGCTACCTTACATCAATATGGCGCGCAGATGTAGCGGTACATG (SEQ ID NO.37) and U3box _ R: GGTACTATGGCTTAGATGGAATACCCCGTATTCTCTGCCCTTGTTGC (SEQ ID NO.38) was amplified from NJAU4742 genomic DNA. The final over-expressed fragment product was obtained by the above fusion PCR step at a concentration of 268 ng/. mu.l for a total of 40. mu.l.

(2) Transformation of over-expressed fragments

(3) Screening and purifying overexpression mutant and qPCR verification

After the double-layer screening plate is cultured at 28 ℃ for 48-72h, an obvious circular colony grows on the surface of an upper GSM culture medium, the circular colony is transferred to a new GSM solid plate, a hypha lysis kit is used for extracting mutant DNA, whether an over-expression fragment is correctly inserted into a genome is verified through PCR, and a verification primer is nit3_ F: CCCAAAACAACCCACATCAATCATCATGAGCGAAACTATCAAAGTTGGC (SEQ ID NO.39) and Eu3box _ R: CATCCAATGCAATGCATGCGAG (SEQ ID NO.40), the PCR verified product size was about 2200 bp. The genotype of the over-expression mutant is NJAU 4742-delta ura3-OEnit3: ura 3. The mutant was able to grow normally on GSM medium without uridine or uracil and the ura3 gene was correctly complemented.

Mutant NJAU 4742-delta ura3-OEnit3, ura3 and original strain NJAU4742 were fermented at 28 deg.C and 150rpm in GSM liquid culture medium, and mycelia of the two were recovered after 48 h. The total RNA of the mutant and the original strain was extracted using an RNA extraction kit (RNeasy Plant Minikit, QIAGEN), followed by cDNA reverse transcription kit (PrimeScript)^TMRT-PCR Kit, TAKARA) reverse transcribes mRNA from total RNA to cDNA. Then, verification of the nit3 gene transcription level was performed using a quantitative PCR Kit (SYBRPremix Ex TaqTM Kit, TAKARA) and the internal reference gene was selected for the quantitative primer qtef1-F of Trichoderma housekeeping gene tef 1: TACAAGATCGGTGGTATTGGAACA (SEQ ID NO.41) and qtef 1-R: AGCTGCTCGTGGTGCATCTC (SEQ ID NO. 42). The qPCR validation result shows that the expression level of nit3 in the nit3 overexpression mutant NJAU 4742-delta ura3-OEnit3 is about 360 times higher than that of the original strain NJAU4742 (for example, nit3 in ura3)Shown in fig. 8), indicating successful overexpression of nit3 gene.

Sequence listing

<110> Nanjing university of agriculture

<120> method for over-expressing fungus gene of non-trace trichoderma

<160>42

<170>SIPOSequenceListing 1.0

<210>1

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

ctgtcaggca attagcacag g 21

<210>2

<211>43

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

cggcattgga caagagcttc tgactaacaa gcgccatcaa tgc 43

<210>3

<211>43

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gcattgatgg cgcttgttag tcagaagctc ttgtccaatg ccg 43

<210>4

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gccatattga tgtaaggtag ctctccgtat tctctgccct tgttgc 46

<210>5

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gagagctacc ttacatcaat atggc 25

<210>6

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ggtactatgg cttagatgga atacc 25

<210>7

<211>48

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gggtattcca tctaagccat agtacccaca tttacatcca ggtcgacg 48

<210>8

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

ctagatatga aggacagctg gcg 23

<210>9

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

agcgagggac tgggattatg ag 22

<210>10

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

caagtacaac ctaacagctg agcac 25

<210>11

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

ggccttgaaa cggtatgtcg a 21

<210>12

<211>48

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

cgtacacacc atcacaggga tatcaatagg agatggctga actgtgtg 48

<210>13

<211>48

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

cacacagttc agccatctcc tattgatatc cctgtgatgg tgtgtacg 48

<210>14

<211>48

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

gccatattga tgtaaggtag ctctcctcac ttccgcttca catagacc 48

<210>15

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

gagagctacc ttacatcaat atggcgcgca gatgtagcgg tacatg 46

<210>16

<211>47

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

ggtactatgg cttagatgga ataccccgta ttctctgccc ttgttgc 47

<210>17

<211>49

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

gggtattcca tctaagccat agtacccttc ttcagccctt gatccacac 49

<210>18

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

ccttgattca cacgcaaatg ttcc 24

<210>19

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

agcgagggac tgggattatg ag 22

<210>20

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

catccaatgc aatgcatgcg ag 22

<210>21

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

ggtgggcaaa aaggaacctg g 21

<210>22

<211>48

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

gccatattga tgtaaggtag ctctcagaga ttatccgctg gtggagtg 48

<210>23

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>23

gagagctacc ttacatcaat atggcgcgca gatgtagcgg tacatg 46

<210>24

<211>47

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>24

ggtactatgg cttagatgga ataccccgta ttctctgccc ttgttgc 47

<210>25

<211>48

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>25

gggtattcca tctaagccat agtaccgcgc ctcgaatgac ttgatgac 48

<210>26

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>26

gccctacgag aatgtcggtt c 21

<210>41

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>41

cacaccagac caagccgtat tc 22

<210>42

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>42

catccaatgc aatgcatgcg ag 22

<210>27

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>27

gtgccctctt tgtgaaaagg c 21

<210>28

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>28

gcagttgaac ttctgccgct20

<210>29

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>29

atgacatggt ctctggatgg g 21

<210>30

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>30

gttgccttgg ctagacatct gg 22

<210>31

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>31

ctgatctggg ttgcacgctt g 21

<210>32

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>32

gatgattgat gtgggttgtt ttggg 25

<210>33

<211>49

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>33

cccaaaacaa cccacatcaa tcatcatgag cgaaactatc aaagttggc 49

<210>34

<211>47

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>34

gccatattga tgtaaggtag ctctcccaac tagcaagtac ctcgagc 47

<210>35

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>35

gagagctacc ttacatcaat atggcgcgca gatgtagcgg tacatg 46

<210>36

<211>47

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>36

ggtactatgg cttagatgga ataccccgta ttctctgccc ttgttgc 47

<210>37

<211>49

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>37

cccaaaacaa cccacatcaa tcatcatgag cgaaactatc aaagttggc 49

<210>38

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>38

catccaatgc aatgcatgcg ag 22

<210>39

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>39

tacaagatcg gtggtattgg aaca 24

<210>40

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>40

agctgctcgt ggtgcatctc 20

Claims

1. A method for overexpression of a Trichoderma traceless fungal gene, comprising: target genes used for overexpression and strong promoters required for overexpression are all endogenous fragments of trichoderma, a U3 expression frame and the target gene overexpression frame are fused into a complete fragment through fusion PCR, the overexpression fragment is transferred into a trichoderma mutant with a traceless knockout ura3 gene through protoplast transformation, and correct mutants are screened out;

the over-expression fragment is constructed by a method that a strong promoter sequence passes through a primer P _ F: SEQ ID NO.33 and primer P _ R: SEQ ID No.34 was amplified from NJAU4742 genomic DNA; amplifying the complete sequence of the over-expressed target gene and the complete terminator sequence of the over-expressed target gene from NJAU4742 genome DNA by PCR; the U3 expression cassette was determined by primer U3box _ F: SEQ ID NO.37 and U3box _ R: SEQ ID NO.38 is obtained by amplifying NJAU4742 genome DNA, and a final over-expression fragment product is obtained by a fusion PCR step; fusing 2 mul and ddH of the HiFi Premix10 mul and four fragments in a PCR first-step reaction system₂Mu.l of O2, reaction program 98 ℃ for 1s, (98 ℃ for 10s, 60 ℃ for 7s, 72 ℃ for 40s)_{15 cycles}Fusing 2 mul, ddH and 2 mul of each primer of HiFi Premix, 4 mul, U3_ upF and U3_ geneR in the reaction system of the second step of PCR₂O17 μ l, reaction program 98 ℃ for 1s, (98 ℃ for 10s, 60 ℃ for 7s, 72 ℃ for 40s)_{30 cycles}Storing at 4 ℃;

the Trichoderma mutant with the ura3 traceless knockout gene is constructed according to the following method: four pairs of primers were designed against the ura3 gene sequence: wherein, a pair of primers amplifies a 1-1.5kb sequence at the upstream of the ATG of the initiation codon of ura3 gene, and the sequence is an upstream fragment; amplifying a 1-1.5kb sequence between an upstream fragment and an ATG (start codon) of ura3 gene by using a pair of primers to obtain a gene fragment; a pair of primers amplifies a 500-800bp sequence at the downstream of a target gene stop codon, and the sequence is a downstream segment; amplifying a complete expression frame of the hygromycin B phosphotransferase gene by using the last pair of primers, and naming the complete expression frame as a HygB resistance gene expression frame; the four different fragments are designed through primers to enable a terminal coincidence region of 25bp to be formed between two adjacent fragments, wherein the terminal of an upstream fragment coincides with the starting end of a downstream fragment; the tail end of the downstream segment is coincided with the starting end of the expression frame of the HygB resistance gene; the tail end of the HygB resistance gene expression cassette coincides with the starting end of the ura3 gene segment; respectively carrying out PCR amplification on a trichoderma genome by using high fidelity enzyme to obtain an upstream fragment, a downstream fragment and a ura3 gene fragment, and carrying out PCR amplification on a pcDNA1 plasmid to obtain a HygB resistance gene expression cassette; obtaining an ura3 gene knockout fragment of an upstream fragment, a downstream fragment, a HygB resistance gene expression box and an ura3 gene fragment through fusion PCR; transforming the ura3 gene knockout fragment into trichoderma protoplast to obtain a mutant; culturing the mutant on a PDA culture medium containing HygB, performing mutant first homologous recombination verification on trichoderma capable of growing on the PDA culture medium containing HygB by using a hypha lysis kit, reserving the mutant strain with correct homologous recombination, and continuing to grow until sporulation; and (3) coating spores of the correct mutant subjected to the first homologous recombination on a GSM solid medium containing 1.5mg/ml 5-FOA and 5nmol uridine for culture, allowing fragments subjected to the second homologous recombination to germinate on a GSM plate containing 5-FOA and uridine and grow bacterial blocks, and selecting positive mutants and carrying out purification and verification to obtain the Trichoderma mutant with the trace-free ura3 gene knocked out.

2. The method of overexpressing fungal genes in Trichoderma reesei according to claim 1, comprising the steps of:

(1) overexpression fragment construction

(2) Transformation of over-expressed fragments

Transferring the overexpression segment into a trichoderma mutant of a traceless knockout ura3 gene through protoplast transformation;

(3) screening and purifying overexpression mutant and qPCR verification

After the double-layer screening plate is cultured and cultured for 48-72h at 28 ℃, an obvious circular colony can grow on the surface of an upper GSM culture medium, the colony is transferred to a new GSM solid plate, a hypha lysis kit is used for extracting mutant DNA, whether an over-expression fragment is correctly inserted into a genome is verified through PCR (polymerase chain reaction) to obtain an over-expression mutant, the mutant can normally grow on the GSM culture medium without adding uridine or uracil, and the ura3 gene is correctly complemented;

fermenting the overexpression mutant and the original strain NJAU4742 in a GSM liquid culture medium, recovering mycelia of the overexpression mutant and the original strain, extracting total RNA of the mutant and the original strain, carrying out reverse transcription on mRNA in the total RNA into cDNA, and then carrying out verification on the transcription level of an overexpression target gene by using a quantitative PCR kit.

3. The method of overexpressing fungal genes in Trichoderma reesei according to claim 1, wherein the Trichoderma is Trichoderma harzianum comprising ura3 gene.

4. The method for overexpression of a fungal gene of trichoderma non-tracele as claimed in claim 1, wherein the upstream fragment amplification primer is a primer U3_ upF at the 5' end: SEQ ID NO.1 and 3' end primer U3_ upR: SEQ ID No. 2; the downstream fragment amplification primer is a 5' end primer U3_ downF: SEQ ID NO.3 and 3' end primer U3_ downR: SEQ ID No. 4; the primer for amplifying the HygB resistance gene expression cassette is a 5' end primer hygBox _ F: SEQ ID No.5 and 3' primer hygBox _ R: SEQ ID No. 6; the ura3 gene fragment amplification primer is a 5' end primer U3_ geneF: SEQ ID NO.7 and 3' end primer U3_ gene R: SEQ ID NO. 8.

5. The method for overexpression of a fungal gene of trichoderma asperellum according to claim 1, wherein the verification primer for the first homologous recombination of the mutant is E _ u 3F: SEQ ID NO.9 and E _ hygB _ R: SEQ ID NO. 10.