CN109666690A - A kind of no trace trichoderma fungal gene overexpression method - Google Patents
A kind of no trace trichoderma fungal gene overexpression method Download PDFInfo
- Publication number
- CN109666690A CN109666690A CN201910045672.7A CN201910045672A CN109666690A CN 109666690 A CN109666690 A CN 109666690A CN 201910045672 A CN201910045672 A CN 201910045672A CN 109666690 A CN109666690 A CN 109666690A
- Authority
- CN
- China
- Prior art keywords
- gene
- mutant
- ura3
- trichoderma
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y401/00—Carbon-carbon lyases (4.1)
- C12Y401/01—Carboxy-lyases (4.1.1)
- C12Y401/01023—Orotidine-5'-phosphate decarboxylase (4.1.1.23)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of no trace trichoderma fungal genes to be overexpressed method.Firstly, passing through homologous recombination events twice and Hygromycin B resistant screening strategy and the lethal strategy of 5-FOA being combined to obtain Guizhou trichoderma ura3 gene seamless knockout mutant.Based on the mutant, the knockout segment comprising ura3 gene expression frame is inserted by target gene position by homologous recombination mode, and go out the mutant of first time homologous recombination occurs using the auxotrophy Feature Selection of the seamless mutant of ura3.After second of homologous recombination occurs, ura3 gene and target gene are removed by recombination, are reversely screened using the lethal characteristic of 5-FOA at this time, obtain the seamless mutant that target gene is erased entirely.The system is optimized enough, and 15% or more, the single-gene seamless operation cycle shortened within 15 days homologous recombination ratio, while can also realize the seamless overexpression of target gene, does not introduce any exogenous sequences in the process.
Description
Divisional application explanation
It is 2018-02-08 that the application, which is the applying date, entitled " a kind of seamless application No. is 2018101301042
The divisional application of mark trichoderma fungal gene edit methods ".
Technical field
The invention belongs to microbe technical fields, are related to a kind of no trace trichoderma fungal gene overexpression method.
Background technique
Microbial organic fertilizer have the function of promote plant growth, prevention and control soil-borne disease, can substitute or part substitutionization
Fertilizer meets national " weight-reducing subtracts medicine " policy in extensive use agriculturally.Most important ingredient is each work in microbial organic fertilizer
Property bacterial strain, it is main including the bacillus in division bacteria and the trichoderma filamentous fungi in classification of fungi.It studies for a long period of time
Show that trichoderma filamentous fungi has and promotes plant growth (cucumber, corn, banana, watermelon etc.), induction plant foreign immunologic,
The function of enhancing systemic resistance of plant and prevention and control soil-borne disease, because its is environmental-friendly, vdiverse in function be widely used in it is micro-
Biological organic fertilizer production.
While popularization and application, theoretical research is also the most important thing.The theoretical research of trichoderma be concentrated mainly on plant growth-promoting,
Several aspects such as pathogen antagonism and straw utilization, be related to molecular biology of fungi, Fungal Genetics, cell biology,
Intersection between the subjects such as Plant Nutrition.In this course, the genetic manipulation means of a set of maturation are each for trichoderma
Deeply probing into for function inherent mechanism is required.Team's previous work where the present inventor shows trichoderma only to a small number of antibiosis
Plain sensitive, wherein hygromycin B (Hygromycin B) is applied, and utilizes the outer of hygromycin B phosphotransferase encoding gene
Source imports, inverted, screening, after purification verifying and etc. be successfully realized the knockout and overexpression of gene in trichoderma.However, wooden
The inherent mechanism of mould different function is sufficiently complex, is a kind of result that polygenes participates in, regulates and controls jointly.It is above-mentioned to be based on hygromycin B
Genetic manipulation can only be carried out for the individual gene in reesei gene group, in many cases to term single gene character and function
Research can far from explain the synthesis result (growth-promoting, antagonism, straw utilization etc.) of polygenes product interaction.Meanwhile it is theoretical
The final purpose of research is to push to apply, and helps us understand it is that how to have to the further investigation of each function inherent mechanism of trichoderma
While effect promotes plant growth and prevention and control soil-borne disease, also enhances its function to us and active path is provided, to constantly mention
Field effect of high microorganism organic fertilizer.Consider for bio-safety, the artificial something lost of major function bacterial strain in microbial organic fertilizer
Any exogenous dna fragment can not be brought by passing transformation.Taking into account the above, it is required in the theoretical research and practical application of trichoderma
A kind of traceless quick, efficient, recyclable gene editing system that can be realized no gene dosage limitation.
Summary of the invention
The purpose of the present invention is operating very difficult reality for trichoderma multiple-factor inheritance, provide it is a kind of it is traceless can
The reesei gene edit methods of circulate operation.
The purpose of the present invention is achieved through the following technical solutions:
One plant of trichoderma ura3 gene seamless knockout mutation construction, the following steps are included:
Four pairs of primers are designed for ura3 gene order: where pair of primers expands on ura3 gene start codon ATG
The 1-1.5kb sequence of trip is fragment upstream；Pair of primers expands among fragment upstream to ura3 gene start codon ATG
1-1.5kb sequence is genetic fragment；The 500-800bp sequence in pair of primers amplifying target genes terminator codon downstream, under
Swim segment；Last is named as HygB tolerant gene expression to primer amplification Hygromycin B phosphofransferose gene expressed intact frame
Frame；Make by design of primers the end overlapping region between adjacent two segment there are 25bp between above-mentioned four kinds of different fragments.
Wherein, fragment upstream end is overlapped with segments downstream starting point, segments downstream end and HygB tolerant gene expression frame starting point
It is overlapped, the tolerant gene expression frame end HygB is overlapped with ura3 genetic fragment starting point.Using reesei gene group DNA as template, benefit
Pass through PCR amplification respectively with high fidelity enzyme and obtain fragment upstream, segments downstream, ura3 genetic fragment, using pcDNA1 plasmid as mould
Plate PCR amplification obtains HygB tolerant gene expression frame.Fragment upstream+segments downstream+HygB resistant gene is obtained by fusion DNA vaccine
The ura3 gene knockout segment of expression cassette+ura3 genetic fragment.Ura3 gene knockout segment conversion trichoderma protoplast is obtained
Obtain mutant.Mutant is cultivated in the PDA culture medium containing 200ppm HygB.Pass through mycelia lytic reagent box (Plant
Direct PCR kit, Thermo Secientific) it extracts and can be grown in the PDA culture medium containing 200ppm HygB
Mutant DNA and carry out first time homologous recombination verifying, retain the mutant strain that correct homologous recombination occurs, and 28 DEG C after
Continuous culture is until produce spore.The spore that the correct mutant of first time homologous recombination occurs is coated on containing 1.5mg/ml 5-
On the GSM solid medium of FOA, 5nmol uridine, the mutant spore that correct secondary homologous recombination occurs can contain 5- fluorine
Bacterium colony is sprouted and grown on the GSM plate of orotic acid (5-FOA) and uridine, is obtained after picking Positive mutants body and purified verifying
The trichoderma mutant of ura3 gene seamless knockout.
The trichoderma is " non-" auxotroph trichoderma containing ura3 gene, preferably Guizhou trichoderma NJAU4742.
The fragment upstream amplimer is 5 ' end primer U3_upF:SEQ ID NO.1 and 3 ' end primer U3_upR:
SEQ ID NO.2；Segments downstream amplimer is 5 ' end primer U3_downF:SEQ ID NO.3 and 3 ' end primer U3_downR:
SEQ ID NO.4；HygB tolerant gene expression frame amplimer is 5 ' end primer hygBox_F:SEQ ID NO.5 and 3 ' ends are drawn
Object hygBox_R:SEQ ID NO.6；Ura3 gene fragment amplification primer is 5 ' end primer U3_geneF:SEQ ID NO.7 and 3 '
Hold primer U3_geneR:SEQ ID NO.8.
10 μ l of HiFi Premix in the fusion DNA vaccine first step reaction system, four kinds of segments each 2 μ l, ddH2O 2μ
L, response procedures are 98 DEG C of 1s, (98 DEG C of 10s, 60 DEG C of 7s, 72 DEG C of 40s)15 circulations, 4 DEG C of preservations.Fusion DNA vaccine second step reaction system
Middle 25 μ l of HiFi Premix, first step reaction product 4 μ l, U3_upF and U3_geneR primer each 2 μ l, ddH217 μ l of O, instead
Answering program is 98 DEG C of 1s, (98 DEG C of 10s, 60 DEG C of 7s, 72 DEG C of 40s)30 circulations, 4 DEG C of preservations.
The mutant first time homologous recombination verifying primer is E_u3F:SEQ ID NO.9 and E_hygB_R:SEQ
ID NO.10。
Target gene seamless knockout method based on the seamless mutant of trichoderma Δ ura3 comprising the steps of:
(1) building target gene knocks out segment: designing four pairs of primers for objective gene sequence: where pair of primers expands
The 1-1.5kb sequence of the upstream gene start codon ATG of gaining is fragment upstream；Inside pair of primers amplifying target genes
1-1.5kb sequence, be genetic fragment；The 500-800bp sequence in pair of primers amplifying target genes terminator codon downstream is
Segments downstream；Last ura3 gene expressed intact frame to primer amplification Guizhou trichoderma, overall length 3598bp are named as U3 expression
Frame；The end overlapping region between adjacent two segment with 25bp is made by design of primers between above-mentioned four kinds of different fragments,
Wherein, fragment upstream end is overlapped with segments downstream starting point；Segments downstream end is overlapped with U3 expression cassette starting point；U3 expression
Frame end is overlapped with genetic fragment starting point；Using reesei gene group as template, is expanded with above-mentioned four pairs of primer PCRs and obtain four segments
Afterwards, above-mentioned four kinds of segments are connected by fragment upstream+segments downstream+U3 expression cassette+genetic fragment by the method for fusion DNA vaccine
It connects, and finally obtaining four segment composition products is that target gene knocks out segment；
(2) target gene knocks out the wood that segment converts seamless knockout ura3 gene of any of claims 1-7
Mould mutant protoplast；
(3) the trichoderma mutant for obtaining target gene and being knocked out by no trace is screened by homologous recombination twice.It is preferred that using
GSM(9.89mM KNO3, 7.35mM KH2PO4, 6.7mM KCl, 2.03mM MgSO4·7H2O, 0.9mM CaCl2, 0.094mM
MnSO4·H2O, 0.048mM ZnSO4·7H2O, 0.18mM FeSO4·7H2O, 0.121mM CoCl2·6H2O, 1% glucose)
Screening and culturing medium of the culture medium as first time homologous recombination mutant, the mutant inoculation of the first time homologous recombination screened
In on PDA plate, 28 DEG C of cultures produce spore；Spore is coated on containing 1.5mg/ml 5- fluororotic acid (5-FOA), 5nmol uridine
GSM solid medium carry out second of homologous recombination mutant screening.
The target gene seamless knockout method, preferably comprises following steps:
1.1 target gene knock out segment building:
According to Research Requirements, selects target gene and obtain the genome sequence of the gene from genome.It utilizes
The visual softwares such as SnapGene show objective gene sequence, and design four pairs of primers, knock out fragment internal sequence for expanding
Element.Wherein, the 1-1.5kb sequence of the upstream pair of primers amplifying target genes initiation codon ATG is fragment upstream；It is a pair of
1-1.5kb sequence inside primer amplification target gene is genetic fragment；Another pair primer amplification target gene stop codon
The 500-800bp sequence in downstream is segments downstream；Last ura3 gene expressed intact frame to primer amplification trichoderma, overall length
3598bp is named as U3 expression cassette.To have between adjacent two segment by design of primers between above-mentioned four kinds of different fragments
The end overlapping region of 25bp is expressed above-mentioned four kinds of segments by fragment upstream+segments downstream+U3 by the method for fusion DNA vaccine
Frame+genetic fragment is attached, and four segment composition products of acquisition are that target gene knocks out segment, and production concentration ensures
200ng/ μ l or more.Fusion DNA vaccine step is as described in technical solution 1.
It is prepared by the protoplast of the 1.2 seamless mutant of trichoderma Δ ura3
Firstly, configuring appropriate PDA solid medium (U.S. company BD) and carrying out 115 DEG C, 20min sterilization treatment.Prepare
The PDA solid plate of 20 or so 9cm diameters, and cover the tunica fibrosa of one layer of sterilizing.50 μ l trichoderma Δ ura3 are seamless prominent
The spore (about 10 of variant8A/ml) it is spread evenly across on the PDA plate containing tunica fibrosa.After 28 DEG C of stationary culture 20h, take out
Tunica fibrosa with mycelia is taken out and is reversely attached to containing 3-4ml protoplast lysate (1.2M by PDA plate
Sorbitol, 0.1M KH2PO4, pH 5.6,7.5mg/ml Lysing enzyme, Sigma:L1412) plate on, so grasp
Make, guarantees that every piece of plate handles 5-7 piece tunica fibrosa.Then plate is cultivated into 100min, Zhi Hou under the conditions of 28 DEG C, 100rpm
The tunica fibrosa in plate is taken out under sterile super-clean bench, and ensures that most of mycelium is retained in plate, in the process may be used
With with solution A (1.2M sorbitol, 0.1M KH2PO4, pH 5.6) and remaining mycelia block on tunica fibrosa is rinsed, it is anti-using pipette tips
Protoplast mycelia block 200 times or more in multiple pressure-vaccum liquid, sufficiently inside release.Then it is equipped with the 1.5ml of 4 layers of gauze
Pipe filters above-mentioned mixed liquor, retains lower layer's filtrate and carries out 2000rpm, 4 DEG C, the centrifugal treating of 10min.After centrifugation, abandon
Supernatant, retains the protoplast pellet of bottom, and with 4 DEG C of solution B (1M sorbitol, 50mM CaCl2, 10mM Tris-
HCl, pH 7.5) be resuspended to get the seamless mutant of trichoderma Δ ura3 protoplast, it is ensured that protoplast concentration is 107A/ml
More than.
1.3 target gene knock out the conversion and the screening of first time homologous recombination mutant, purifying and verifying of segment
Protoplast transformation: the above-mentioned protoplast solution of 200 μ l, 10 μ l target gene are knocked out into segment solution and 50 μ l
PEG solution (25%PEG6000,50mM CaCl2, 10mM Tris-HCl, pH 7.5) be sequentially added into 15ml sterile tube, gently
20min is placed on ice after micro- mixing.It is subsequently added into 2ml PEG solution and is mixed by inversion, be placed at room temperature for 5min, be subsequently added into 3ml
Solution B is simultaneously mixed by inversion.Finally about 5ml conversion fluid is spread evenly across the 9cm containing 1/2PDA and 1M sucrose by 500 every part of μ l
On plate, plate is not required to dry up, and smoothens, and does not need to seal.Conversion plate is then placed in 28 DEG C of stationary cultures
About for 24 hours, after protoplast sprouting, one layer of GSM solid inorganic salt medium is covered on original plate, continues to place 28 DEG C of trainings
It supports.After about 48h, it will include complete ura3 gene expression frame in the protoplast genome of successful conversion that lower layer, which realizes, therefore
It can be grown in the GSM culture medium existing for no uridine, show to grow into upper layer from the 1/2PDA culture medium of lower layer
GSM media surface, and the similar round of formation rule grows circle.Picking surface fungus block and to be transferred to new GSM solid flat immediately
On plate, mycelia lytic reagent box quick release mutant gene group DNA is utilized after covering with plate, and detect using homologous recombination
Primer carries out the PCR verifying that target gene first time homologous recombination occurs.Correct mutant spore will be verified to be diluted, applied
It is distributed on GSM solid plate, picking monospore is transferred on PDA solid medium, is carried out a PCR again after mycelia grows well and is tested
Card, it is ensured that its correctness.
The screening of 1.4 target gene seamless knockout mutant
Final mutant in above-mentioned 1.3 is the product that first time homologous recombination occurs for purpose gene location, knocks out segment
With the same clip of target gene position homologous recombination occurs for the fragment upstream and genetic fragment at both ends respectively, and by U3 expression cassette
It is integrated into target gene position, accordingly, with respect to the auxotrophic strain of no ura3 gene, mutant itself can be normal
It is grown on GSM solid plate.Spore of the mutant on PDA solid plate is recycled, produce spore this during be mutated
Know from experience spontaneous second of homologous recombination of carry out, recombination event occurs in the downstream for the segments downstream and target gene for knocking out segment
Between segment, recombination result is to remove all U3 expression cassettes and objective gene sequence, only retains its upstream in target gene position
Segment and segments downstream sequence.Therefore, by mutant spore be coated on containing 1.5mg/ml 5- fluororotic acid (5-FOA),
When on the GSM solid medium of 5nmol uridine, the spore of second of homologous recombination does not occur because containing complete ura3 gene,
5-FOA, with lethal function, occurs the spore of second of homologous recombination because ura3 gene has been removed on the contrary, is not caused to it
Extremely, it shows good under conditions of external source adds uridine to be grown on GSM solid plate.Therefore, after 72 h, contain
The bacterium colony to grow out on the GSM plate of 5-FOA and uridine is the target gene seamless knockout mutation that second of recombination occurs
Body on its mycelia block of picking to the new GSM plate containing 5-FOA and uridine, after 28 DEG C of placements culture 4d, collects spore, and
It is diluted coating, the seamless knockout bacterial strain that picking monospore is verified up to target gene.
The circulation of 1.5 other purposes genes knocks out operation
While 1 seamless knockout mutant of target gene obtained above realizes target gene seamless knockout, also remain
The characteristic of the seamless mutant of trichoderma Δ ura3 does not contain ura3 gene expression frame.Therefore the knockout of other purposes gene can
Using 1 seamless knockout mutant of target gene as the bacterial strain for preparing of protoplast, target gene 2 is carried out together according to the method described above
Sample operates the mutant for obtaining seamless knockout that target gene 1 and 2 can be obtained, and so on, it can obtain by research people
The polygenes seamless knockout mutant of member's wish.
The covering of 1.6 ura3 gene expression frames is inserted into
The missing of ura3 gene can result in trichoderma strain auxotrophy feature, that is, external source is needed to provide uridine or urinate phonetic
Pyridine, bacterial strain can normal growths.Therefore, the seamless knockout of the last one gene or individual gene needs in polygenes editor
The endogenous ura3 gene expression frame of trichoderma is covered.The concrete operation step by taking the last one gene in polygenes editor as an example
Are as follows: firstly, constructing the homologous knockout segment of 3 segments, the i.e. fragment upstream+U3 of the last one gene by above-mentioned fusion DNA vaccine method
Expression cassette+the last one gene segments downstream.Meanwhile preparing the plasm of the mutant of the equal seamless knockout of other purposes gene
Body.Pass through above-mentioned PEG-CaCl2The protoplast transformation method of mediation imports segment is knocked out in the protoplast of preparation, and presses
1.3 the methods are screened and are verified.In this course, the fragment upstream of the last one gene and downstream in segment are knocked out
With the corresponding position of target gene in genome homologous recombination can occur for segment respectively, to remove and replace target gene fragment
U3 expression cassette is changed into, it is achieved that most having the knockout and the covering of ura3 gene of a gene.
The seamless overexpression method of target gene comprising the steps of:
Overexpression method is more relatively easy than seamless knockout, but be again based on trichoderma auxotrophic strain Δ ura3 without
Trace mutant.It is overexpressed the target gene used and its strong promoter needed for being overexpressed is the endogenous fragment of trichoderma, lead to
It crosses fusion DNA vaccine and U3 expression cassette and target gene overexpression frame is fused into a complete segment.Then above-mentioned 2.3 conversion side is pressed
Method will be overexpressed segment and be transferred in trichoderma and filter out correct mutant.Mutant is overexpressed because having in complete trichoderma
Source U3 expression cassette, and nutritional utilization characteristic identical with original strain can be shown, it does not need external source addition uridine or urine is phonetic
Pyridine, while target gene also can be correctly overexpressed.
Beneficial effects of the present invention:
The present invention solves trichoderma polygenes for the first time and operates extremely difficult scientific research problem, realizes polygenic in trichoderma
Seamless recyclable operation (gene knockout and overexpression) is plant growth-promoting, the disease of the critical strain trichoderma in microbial organic fertilizer
The further investigation of the functional mechanisms such as opportunistic pathogen antagonism and straw utilization provides strong methodology support；It meanwhile being also micro-
The theoretical research of function stem trichoderma provides a set of safely and effectively without exogenous sequences Jie to achievements conversion in biological organic fertilizer
The genetic modification system entered.
Detailed description of the invention
The seamless gene editing systematic schematic diagram of the Guizhou Fig. 1 trichoderma
The plate screening of ura3 gene seamless knockout first time homologous recombination mutant in the trichoderma NJAU4742 of the Guizhou Fig. 2；
The bacterium colony that white arrow is indicated is to knock out segment to be correctly inserted into NJAU4742 genome
The plate screening that second of homologous recombination of ura3 gene seamless knockout is mutated in the trichoderma NJAU4742 of the Guizhou Fig. 3；Figure
Middle black arrow mark and a series of white round spots not indicated are that the ura3 gene of the correct secondary homologous recombination of generation is seamless
Knock-out bacterial strain
Colony growth diameter figure of the Guizhou Fig. 4 trichoderma different mutants in different culture medium；NJAU4742 is original bacteria
Strain, NJAU4742- Δ ura3 are ura3 gene seamless knockout mutant, and NJAU4742-1 is during ura3 gene seamless knockout
First time homologous recombination mutant occurs；GSM is GSM minimal medium, and B is addition 200ppm HygB, and U is addition 5nmol
Uridine
Xyr1 gene seamless knockout first time homologous recombination mutant is flat in the trichoderma NJAU4742- Δ ura3 of the Guizhou Fig. 5
Screen choosing；It is the doubtful hair that upper layer GSM media surface can be grown into lower layer's culture medium that black dotted lines, which enclose the bacterium colony come,
The mutant strain of raw first time homologous recombination
The extracellular protein SDS- of the Guizhou Fig. 6 trichoderma NJAU4742 and NJAU4742- Δ ura3- Δ xyr1 wood fibre induction
PAGE figure；M be protein marker, C1, C2, C3 be cellulose induce 72h after extracellular protein SDS-PAGE silver staining swimming lane, X1,
X2, X3 are that xylan induces extracellular protein SDS-PAGE silver staining swimming lane after 72h.Xyr1 gene mutation body, which can hardly be secreted, appoints
What extracellular protein.
The knockout of carbon source inhibiting factor encoding gene cre1 and the covering of ura3 gene are tested in the trichoderma NJAU4742 of the Guizhou Fig. 7
Card；A is the PCR verifying glue figure that correct homologous recombination occurs for cre1 gene location, NJAU4742- Δ ura3- Δ xyr1- Δ
Cre1::ura3 mutant has the amplified production of about 1600bp, and NJAU4742- Δ ura3- Δ xyr1 is then without any amplification
Product.B is that cre1 genetic fragment detects glue figure, and NJAU4742- Δ ura3- Δ xyr1- Δ cre1::ura3 is because of cre1 gene quilt
It knocks out completely then without amplified production, and NJAU4742- Δ ura3- Δ xyr1 has the amplified production of about 970bp.C is ura3 base
Because detecting glue figure, NJAU4742- Δ ura3- Δ xyr1- Δ cre1::ura3 has about due to ura3 gene is correctly covered
The amplified production of 600bp, and NJAU4742- Δ ura3- Δ xyr1 is then without any amplified production.D is NJAU4742- Δ
Upgrowth situation figure of the ura3- Δ xyr1- Δ cre1::ura3 and NJAU4742- Δ ura3- Δ xyr1 in PDA culture medium.Its
In: a:NJAU4742- Δ ura3- Δ xyr1- Δ cre1::ura3, b:NJAU4742- Δ ura3- Δ xyr1, M:DNA
Marker, DL2000.
The seamless overexpression qPCR verifying of nit3 gene in the trichoderma NJAU4742 of the Guizhou Fig. 8；A:NJAU4742- Δ ura3-
OEnit3::ura3, b:NJAU4742- Δ ura3.
Biological sample preservation information
NJAU4742, classification naming are Guizhou trichoderma Trichoderma guizhouense, are preserved in Chaoyang District, Beijing City
The institute 3 of North Star West Road 1, China Committee for Culture Collection of Microorganisms's common micro-organisms center, the deposit date is 2016
11 days 04 month, preservation address was Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3 Institute of Microorganism, Academia Sinica, and strain is protected
Hiding number is CGMCC NO.12166.
Specific embodiment
Below with reference to specific implementation case, the present invention is further explained.The case study on implementation enumerated is only used for illustrating this hair
Bright implementation method is not used in and limits use scope of the invention.It is all that specific implementation condition is not specified, it is according to this field
Normal condition known to technical staff carries out.
Implement 1: Guizhou trichoderma NJAU4742 auxotrophic strain NJAU4742- Δ ura3 seamless mutation construction
(1) segment building is knocked out
The presence or absence of gene itself is used during the seamless knockout of ura3 as the screening of secondary homologous recombination
Label, therefore be slightly different when building knocks out segment.It knocks out segment to be made of 4 different pieces: fragment upstream+downstream
Segment+HygB tolerant gene expression frame+genetic fragment.Wherein, HygB tolerant gene expression frame can be transcribed and be translated into damp mould
Plain B phosphotransferase, so that original strain NJAU4742 has Hygromycin B resistant, after secondary homologous recombination occurs, HygB is anti-
Property gene expression frame and ura3 gene order will be deleted jointly, therefore can use 5-FOA and do reversed screening and obtain ura3 base
The seamless knockout mutant of cause.Taking into account the above, in first time homologous recombination, using HygB resistant gene as selection markers
Meanwhile needing not destroy the original expression cassette of ura3 gene, otherwise secondary homologous recombination can not then be screened.Therefore, it knocks out
Fragment primer design is as follows: fragment upstream amplimer is 5 ' end primer U3_upF:CTGTCAGGCAATTAGCACAGG (SEQ
ID NO.1) and 3 ' end primer U3_upR:CGGCATTGGACAAGAGCTTCTGACTAACAAGCGCCATCAATGC (SEQ ID
NO.2)；Segments downstream amplimer is 5 ' end primer U3_downF:GCATTGATGGCGCTTGTTAGTCAGAAGCTCTTGTC
The end CAATGCCG (SEQ ID NO.3) and 3 ' primer U3_downR:GCCATATTGATGTAAGGTAGCTCTCCGTATTCTCTG
CCCTTGTTGC(SEQ ID NO.4)；HygB tolerant gene expression frame amplimer is 5 ' end primer hygBox_F:
The end GAGAGCTACCTTACATCAATATGGC (SEQ ID NO.5) and 3 ' primer hygBox_R:
GGTACTATGGCTTAGATGGAATACCC(SEQ ID NO.6)；Gene fragment amplification primer is 5 ' end primer U3_geneF:G
The end GGTATTCCATCTAAGCCATAGTACCCACATTTACATCCAGGTCGACG (SEQ ID NO.7) and 3 ' primer U3_
GeneR:CTAGATATGAAGGACAGCTGGCG (SEQ ID NO.8).Utilize PrimeSTAR HS DNA polymerase
(TAKARA) high fidelity enzyme obtains fragment upstream (223ng/ μ from PCR amplification on NJAU4742 genome and pcDNA1 plasmid respectively
L), segments downstream (236ng/ μ l), genetic fragment (195ng/ μ l) and HygB tolerant gene expression frame (264ng/ μ l).By with
Lower fusion DNA vaccine step, knockout segment (341ng/ the μ l, 50 μ for being 5950bp using plastic recovery kit gel extraction final lengths
l)。
10 μ l of HiFi Premix in fusion DNA vaccine first step reaction system, segment each 2 μ l, ddH2O 2μl；Response procedures
For 98 DEG C of 1s, (98 DEG C of 10s, 60 DEG C of 7s, 72 DEG C of 40s)15 circulations, 4 DEG C of preservations.HiFi in fusion DNA vaccine second step reaction system
25 μ l of Premix, first step reaction product 4 μ l, U3_upF and U3_geneR primer each 2 μ l, ddH2O 17μl；Response procedures are
98 DEG C of 1s, (98 DEG C of 10s, 60 DEG C of 7s, 72 DEG C of 40s)30 circulations, 4 DEG C of preservations.
(2) protoplast transformation
It is (dense eventually that the fresh protoplast of original strain NJAU4742 is prepared by the protoplast preparation flow in summary of the invention
Degree is 2.51 × 107A/ml).Utilize PEG-CaCl210 μ l are knocked out about 3.41 μ g of segment by the protoplast transformation method of mediation
DNA mixes implementation conversion with 200 μ l protoplasts, is finally spread evenly across about 5ml conversion fluid containing 1M sugarcane by 500 every part of μ l
On the PDA solid plate of sugar, after 28 DEG C of placement cultures for 24 hours, the solid PDA training of one layer of HygB containing 200ppm is covered on it
Base is supported, 28 DEG C are continued to place culture 3-5 days.
(3) screening of first time homologous recombination mutant and purifying
The double-deck PDA plate after growth 3-5 days, the mutant strain for being correctly inserted into knockout segment can resist HygB, from
And it is grown in the PDA culture medium that 200ppm HygB is contained on upper layer, therefore be able to observe that well-grown white hypha block
(as shown in Figure 2), picking fungus block and being transferred on the new PDA plate containing 200ppm HygB allow its continued growth, utilize bacterium
Mitogen solution kit (Plant Direct PCR kit, Thermo Secientific) carries out mutant first time homologous recombination
Verifying, verifying primer are E_u3F:AGCGAGGGACTGGGATTATGAG (SEQ ID NO.9) and E_hygB_R:
CAAGTACAACCTAACAGCTGAGCAC (SEQ ID NO.10) retains the mutant strain that correct homologous recombination occurs, and allows
Its continued growth is to producing spore.
(4) second of homologous recombination mutant screening, purifying and the seamless mutant verifying of NJAU4742- Δ ura3
By the spore of the correct mutant of above-mentioned generation first time homologous recombination be coated on containing 1.5mg/ml 5-FOA,
On the GSM solid medium of 5nmol uridine, spore germination and growing state are observed after 28 DEG C of culture 3-5d.As shown in figure 3, hair
The segment of raw secondary homologous recombination can sprout and grow bacterium colony, picking mutant on the GSM plate containing 5-FOA and uridine
And the seamless mutant of NJAU4742- Δ ura3 is obtained after carrying out purifying verifying.As shown in figure 4, to original strain NJAU4742, hair
The mutant strain of raw first time homologous recombination and the seamless mutant of NJAU4742- Δ ura3 carry out functional verification and show:
NJAU4742 can not be grown on HygB plate, while can not be grown on the plate containing 5-FOA, this shows
NJAU4742 has complete ura3 gene expression frame but does not have HygB resistance；The mutant strain of first time homologous recombination occurs
It can grow but can not be grown on the plate containing 5-FOA on HygB plate, this shows that it is anti-with complete HygB
Property gene expression frame and complete ura3 gene expression frame；The seamless mutant of NJAU4742- Δ ura3 can not be in HygB plate
Upper growth, but can be grown on the plate containing 5-FOA, this shows that the seamless mutant of NJAU4742- Δ ura3 does not have
HygB tolerant gene expression frame does not have ura3 gene expression frame yet.
Implementation 2: the seamless knockout of Guizhou trichoderma NJAU4742 wood fibre degrading enzyme controlling gene xyr1
Trichoderma strain: Guizhou trichoderma NJAU4742- Δ ura3 (NJAU4742- Δ ura3)
(1) segment building is knocked out
It knocks out fragment amplification primer and is respectively as follows: fragment upstream amplimer x1_upF:GGCCTTGAAACGGTATGTCGA
(SEQ ID NO.11) and x1_upR:CGTACACACCATCACAGGGATATCAATAGGAGATGGCTGAACTGTGTG (SEQ
ID NO.12)；Segments downstream amplimer x1_downF:CACACAGTTCAGCCATCTCCTATTGATATCCCTGTGATGGT
GTGTACG (SEQ ID NO.13) and x1_downR:GCCATATTGATGTAAGGTAGCTCTCCTCACTTCCGCTTCACATA
GACC(SEQ ID NO.14)；U3 expression cassette amplimer U3box_F:GAGAGCTACCTTACATCAATATGGCGCGCAGAT
GTAGCGGTACATG (SEQ ID NO.15) and U3box_R:GGTACTATGGCTTAGATGGAATACCCCGTATTCTCTGCC
CTTGTTGC(SEQ ID NO.16)；Gene fragment amplification primer x1_geneF:GGGTATTCCATCTAAGCCATAGTACCCT
TCTTCAGCCCTTGATCCACAC (SEQ ID NO.17) and x1_geneR:CCTTGATTCACACGCAAATGTTCC (SEQ ID
NO.18).The final concentration of 263ng/ μ l for knocking out segment is constructed by fusion DNA vaccine, totally 40 μ l.
(2) protoplast transformation
By above-mentioned PEG-CaCl2The protoplast transformation method of mediation, obtains about 5ml conversion fluid, and 500 every part of μ l are coated on
On 1/2PDA plate containing 1M sucrose, after 28 DEG C of placements culture for 24 hours, covering one layer of solid GSM culture medium above, 28 DEG C after
Continuous culture.
(3) screening of first time homologous recombination mutant and purifying
Above-mentioned bilayer screening flat board can be grown obviously after 48-72h is cultivated in 28 DEG C of cultures in upper layer GSM media surface
Round fungus block, as shown in Figure 5.The mutant of each round fungus block is inoculated on new GSM solid plate, is cracked using mycelia
Kit (Plant Direct PCR kit, Thermo Secientific) carries out the verifying of first time homologous recombination, and verifying is drawn
Object is E_x1_F, AGCGAGGGACTGGGATTATGAG (SEQ ID NO.19) and Eu3box_R,
CATCCAATGCAATGCATGCGAG(SEQ ID NO.20).Verifying obtains 3 independent generation first time homologous recombinations altogether
Mutant.
(4) second of homologous recombination mutant screening, purifying and the seamless mutation experience of NJAU4742- Δ ura3- Δ xyr1
Card
3 independent mutant that first time homologous recombination occurs are inoculated on PDA plate respectively, 28 DEG C of cultures produce spore.
By its spore be coated on containing 1.5mg/ml 5-FOA, 5nmol uridine GSM solid medium on, after 5d mutant 1 and mutation
Occurs circle small bacteria block made of largely being grown as spore germination on the GSM plate of body 2 respectively, muton 3 is then without any fungus block
Growth, thus it is speculated that may be while homologous recombination occurs knock out segment also radom insertion to chromosome other positions, radom insertion
Segment secondary homologous recombination can not occur, therefore ura3 gene expression frame can not be eliminated, not so as to cause mutant
It can be grown on the GSM plate containing 5-FOA.
The seamless knockout of xyr1 gene obtains 2 independent NJAU4742- Δ ura3- Δ xyr1 mutant altogether.To its into
Row functional study shows the missing of xyr1 gene, and Guizhou trichoderma NJAU4742 is enabled to completely lose wood fibre degrading enzyme
Induction and secretion capacity.Specific detection method is, by NJAU4742- Δ ura3- Δ xyr1 mutant and original strain
NJAU4742 is inoculated in respectively in GSM fluid nutrient medium, and 28 DEG C, 150rpm culture 48h then pass through 2 layers of sterile gauzes filtering
The mycelium of mutant and original strain is obtained, and is transferred to the GSM liquid containing 1% (w/v) xylan or cellulose respectively
Continue the Fiber differentiation of wood fibre degrading enzyme in culture medium (not adding glucose).After 72h, withdrawal liquid fermentation liquid,
10000rpm centrifugation 5min simultaneously retains supernatant.By the fermentation supernatant of NJAU4742- Δ ura3- Δ xyr1 mutant and original strain
Liquid carries out Protein Separation by the method for SDS-PAGE, and carries out albumen colour developing by silver staining.The results show that NJAU4742- Δ
Ura3- Δ xyr1 can not secrete any extracellular protein (as shown in Figure 6) including wood fibre degrading enzyme.
Implement 3: Guizhou trichoderma NJAU4742 carbon source inhibits controlling gene cre1 seamless knockout and ura3 gene to cover trichoderma
Bacterial strain: Guizhou trichoderma NJAU4742- Δ ura3- Δ xyr1 (NJAU4742- Δ ura3- Δ xyr1)
(1) homologous knockout segment building
Knock out segment are as follows: cre1 upstream region of gene segment+U3 expression cassette+cre1 downstream of gene segment.Amplimer is respectively as follows:
Fragment upstream amplimer c1_upF:GGTGGGCAAAAAGGAACCTGG (SEQ ID NO.21) and c1_upR:GCCATATTG
ATGTAAGGTAGCTCTCAGAGATTATCCGCTGGTGGAGTG(SEQ ID NO.22)；U3 expression cassette amplimer U3box_
F:GAGAGCTACCTTACATCAATATGGCGCGCAGATGTAGCGGTACATG (SEQ ID NO.23) and U3box_R:GGTA
CTATGGCTTAGATGGAATACCCCGTATTCTCTGCCCTTGTTGC(SEQ ID NO.24)；Segments downstream amplimer c1_
DownF:GGGTATTCCATCTAAGCCATAGTACCGCGCCTCGAATGACTTGATGAC (SEQ ID NO.25) and c1_
DownR:GCCCTACGAGAATGTCGGTTC (SEQ ID NO.26).It is constructed by fusion DNA vaccine and knocks out the final concentration of of segment
383ng/ μ l, totally 40 μ l.
(2) protoplast transformation
By above-mentioned PEG-CaCl2The protoplast transformation method of mediation, obtains about 5ml conversion fluid, and 500 every part of μ l are coated on
On 1/2PDA plate containing 1M sucrose, after 28 DEG C of placements culture for 24 hours, covering one layer of solid GSM culture medium above, 28 DEG C after
Continuous culture.
(3) screening and purifying of cre1 seamless knockout and ura3 gene covering mutant
Above-mentioned bilayer screening flat board can be grown obviously after 48-72h is cultivated in 28 DEG C of cultures in upper layer GSM media surface
Circular colonies, be transferred on new GSM solid plate, using mycelia lytic reagent box carry out homologous recombination verifying, test
Card primer is E_c1_F:CACACCAGACCAAGCCGTATTC (SEQ ID NO.27) and Eu3box_R:
CATCCAATGCAATGCATGCGAG (SEQ ID NO.28), this, which is able to detect primer, knocks out the correct homologous recombination of segment to mesh
Gene location, the correct size of PCR product is about 1600bp.Correct mutant is carried out to produce spore and dilution spread, picking monospore
Onto new GSM culture medium, 28 DEG C are continued to cultivate.It is correct homologous heavy to continue verifying by verifying primer E_c1_F and Eu3box_R
Group segment；Primer cre1_F, GTGCCCTCTTTGTGAAAAGGC (SEQ ID NO.29) and cre1_R are verified,
Whether GCAGTTGAACTTCTGCCGCT (SEQ ID NO.30) verifying cre1 gene knocks out, and amplified production is cre1 gene internal
Complete knockout mutations body occurs for about 970bp segment then without the PCR product；By verifying primer ura3_F:
ATGACATGGTCTCTGGATGGG (SEQ ID NO.31) and ura3_R:GTTGCCTTGGCTAGACATCTGG (SEQ ID
NO.32) verifying ura3 gene successfully covers, and the PCR product correctly covered is about 600bp.The experimental results showed that cre1 gene quilt
It knocks out completely, and ura3 gene expressed intact frame is covered (as shown in Figure 7), gained mutant NJAU4742- Δ ura3- Δ
Xyr1- Δ cre1::ura3 can be grown on the GSM culture medium for not adding uridine or uracil.The seamless knockout of cre1 gene
It is slow then to will lead to bacterial strain polar growth in PDA culture medium, shows the bacterium colony entirely different with original strain NJAU4742
Form (as shown in Figure 7).
Implementation 4: the seamless overexpression of Guizhou trichoderma NJAU4742 auxin synthetic related genes nit3
Trichoderma strain: Guizhou trichoderma NJAU4742- Δ ura3 (NJAU4742- Δ ura3)
(1) it is overexpressed segment building
It is overexpressed the internal element sequence of segment building are as follows: endogenous strong promoter sequence+nit3 complete genome sequence+
Complete terminator sequence+U3 the expression cassette of nit3.Endogenous strong promoter sequence passes through primer P_F:
CTGATCTGGGTTGCACGCTTG (SEQ ID NO.33) and primer P_R:GATGATTGATGTGGGTTGTTTTGGG (SEQ ID
NO.34 it) expands and obtains from NJAU4742 genomic DNA；The complete terminator sequence of nit3 complete genome sequence+nit3 is by drawing
Object nit3_F:CCCAAAACAACCCACATCAATCATCATGAGCGAAACTATCAAAGTTGGC (SEQ ID NO.35) and draw
Object nit3_R:GCCATATTGATGTAAGGTAGCTCTCCCAACTAGCAAGTACCTCGAGC (SEQ ID NO.36) from
Amplification obtains in NJAU4742 genomic DNA；U3 expression cassette passes through primer U3box_F:GAGAGCTACCTTACATCAATATGG
CGCGCAGATGTAGCGGTACATG (SEQ ID NO.37) and U3box_R:GGTACTATGGCTTAGATGGAATACCCCGTA
TTCTCTGCCCTTGTTGC (SEQ ID NO.38) is expanded from NJAU4742 genomic DNA to be obtained.Pass through above-mentioned fusion DNA vaccine
Step obtains final overexpression fragment products, and concentration is 268ng/ μ l, totally 40 μ l.
(2) it is overexpressed segment conversion
By above-mentioned PEG-CaCl2The protoplast transformation method of mediation, obtains about 5ml conversion fluid, and 500 every part of μ l are coated on
On 1/2PDA plate containing 1M sucrose, after 28 DEG C of placements culture for 24 hours, covering one layer of solid GSM culture medium above, 28 DEG C after
Continuous culture.
(3) muton screening, purifying and qPCR verifying are overexpressed
Above-mentioned bilayer screening flat board can be grown obviously after 48-72h is cultivated in 28 DEG C of cultures in upper layer GSM media surface
Circular colonies, be transferred on new GSM solid plate, using mycelia lytic reagent box extract mutant DNA, pass through
PCR verifying is overexpressed whether segment is initially inserted properly in genome, and verifying primer is nit3_F:CCCAAAACAACCCACATCA
ATCATCATGAGCGAAACTATCAAAGTTGGC (SEQ ID NO.39) and Eu3box_R:CATCCAATGCAATGCATGCGAG
(SEQ ID NO.40), it is about 2200bp that PCR, which verifies primer size,.Overexpression mutant gene type is NJAU4742- Δ ura3-
OEnit3::ura3.Mutant normal growth, ura3 gene can obtain on the GSM culture medium for not adding uridine or uracil
To correct covering.
By muton NJAU4742- Δ ura3-OEnit3::ura3 and original strain NJAU4742 28 DEG C, 150rpm into
Row GSM solution culture fermentation, both recycling mycelium after 48h.Utilize RNA extracts kit (RNeasy Plant Mini
Kit, QIAGEN) mutant and original strain total serum IgE are extracted, then pass through cDNA reverse transcription reagent box (PrimeScriptTM
RT-PCR Kit, TAKARA) by the mRNA reverse transcription in total serum IgE at cDNA.Then, quantitative PCR kit (SYBR is utilized
Premix Ex TaqTM Kit, TAKARA) carry out nit3 gene transcription level verifying, reference gene select trichoderma house keeper
The quantitative primer qtef1-F:TACAAGATCGGTGGTATTGGAACA (SEQ ID NO.41) and qtef1-R of gene tef1:
AGCTGCTCGTGGTGCATCTC(SEQ ID NO.42).QPCR verification result shows that nit3 is overexpressed mutant NJAU4742-
The expression quantity of nit3 about 360 times (as shown in Figure 8) higher than original strain NJAU4742 in Δ ura3-OEnit3::ura3, this
Show the success of nit3 gene overexpression.
Sequence table
<110>Agricultural University Of Nanjing
<120>a kind of no trace trichoderma fungal gene is overexpressed method
<160> 42
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
ctgtcaggca attagcacag g 21
<210> 2
<211> 43
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
cggcattgga caagagcttc tgactaacaa gcgccatcaa tgc 43
<210> 3
<211> 43
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
gcattgatgg cgcttgttag tcagaagctc ttgtccaatg ccg 43
<210> 4
<211> 46
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
gccatattga tgtaaggtag ctctccgtat tctctgccct tgttgc 46
<210> 5
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
gagagctacc ttacatcaat atggc 25
<210> 6
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
ggtactatgg cttagatgga atacc 25
<210> 7
<211> 48
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
gggtattcca tctaagccat agtacccaca tttacatcca ggtcgacg 48
<210> 8
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
ctagatatga aggacagctg gcg 23
<210> 9
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
agcgagggac tgggattatg ag 22
<210> 10
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
caagtacaac ctaacagctg agcac 25
<210> 11
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
ggccttgaaa cggtatgtcg a 21
<210> 12
<211> 48
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
cgtacacacc atcacaggga tatcaatagg agatggctga actgtgtg 48
<210> 13
<211> 48
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
cacacagttc agccatctcc tattgatatc cctgtgatgg tgtgtacg 48
<210> 14
<211> 48
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
gccatattga tgtaaggtag ctctcctcac ttccgcttca catagacc 48
<210> 15
<211> 46
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
gagagctacc ttacatcaat atggcgcgca gatgtagcgg tacatg 46
<210> 16
<211> 47
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
ggtactatgg cttagatgga ataccccgta ttctctgccc ttgttgc 47
<210> 17
<211> 49
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 17
gggtattcca tctaagccat agtacccttc ttcagccctt gatccacac 49
<210> 18
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 18
ccttgattca cacgcaaatg ttcc 24
<210> 19
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 19
agcgagggac tgggattatg ag 22
<210> 20
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 20
catccaatgc aatgcatgcg ag 22
<210> 21
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 21
ggtgggcaaa aaggaacctg g 21
<210> 22
<211> 48
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 22
gccatattga tgtaaggtag ctctcagaga ttatccgctg gtggagtg 48
<210> 23
<211> 46
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 23
gagagctacc ttacatcaat atggcgcgca gatgtagcgg tacatg 46
<210> 24
<211> 47
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 24
ggtactatgg cttagatgga ataccccgta ttctctgccc ttgttgc 47
<210> 25
<211> 48
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 25
gggtattcca tctaagccat agtaccgcgc ctcgaatgac ttgatgac 48
<210> 26
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 26
gccctacgag aatgtcggtt c 21
<210> 41
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 41
cacaccagac caagccgtat tc 22
<210> 42
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 42
catccaatgc aatgcatgcg ag 22
<210> 27
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 27
gtgccctctt tgtgaaaagg c 21
<210> 28
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 28
gcagttgaac ttctgccgct 20
<210> 29
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 29
atgacatggt ctctggatgg g 21
<210> 30
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 30
gttgccttgg ctagacatct gg 22
<210> 31
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 31
ctgatctggg ttgcacgctt g 21
<210> 32
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 32
gatgattgat gtgggttgtt ttggg 25
<210> 33
<211> 49
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 33
cccaaaacaa cccacatcaa tcatcatgag cgaaactatc aaagttggc 49
<210> 34
<211> 47
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 34
gccatattga tgtaaggtag ctctcccaac tagcaagtac ctcgagc 47
<210> 35
<211> 46
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 35
gagagctacc ttacatcaat atggcgcgca gatgtagcgg tacatg 46
<210> 36
<211> 47
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 36
ggtactatgg cttagatgga ataccccgta ttctctgccc ttgttgc 47
<210> 37
<211> 49
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 37
cccaaaacaa cccacatcaa tcatcatgag cgaaactatc aaagttggc 49
<210> 38
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 38
catccaatgc aatgcatgcg ag 22
<210> 39
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 39
tacaagatcg gtggtattgg aaca 24
<210> 40
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 40
agctgctcgt ggtgcatctc 20
Claims (6)
1. a kind of no trace trichoderma fungal gene is overexpressed method, it is characterised in that the method includes: by fusion DNA vaccine structure
Overexpression segment is built, the overexpression segment group becomes the complete sequence of endogenous strong promoter sequence+overexpression target gene
Complete terminator sequence+U3 the expression cassette of column+overexpression target gene；The endogenous strong promoter sequence passes through primer P_
F:SEQ ID NO.33 and primer P_R:SEQ ID NO.34 is expanded from the trichoderma NJAU4742 genomic DNA of Guizhou and is obtained；It is logical
It crosses protoplast transformation overexpression segment is transferred in the trichoderma mutant of seamless knockout ura3 gene and is filtered out correctly prominent
Variant；
The target gene being wherein overexpressed and its strong promoter needed for being overexpressed are the endogenous fragment of trichoderma；
The trichoderma mutant of the seamless knockout ura3 gene, building obtains in accordance with the following methods: for ura3 gene order
Design four pairs of primers: where pair of primers expands the 1-1.5kb sequence of the upstream ura3 gene start codon ATG, is upstream piece
Section；Pair of primers expands fragment upstream to the 1-1.5kb sequence between ura3 gene start codon ATG, is genetic fragment；One
It is segments downstream to the 500-800bp sequence in primer amplification target gene stop codon downstream；Last is to primer amplification tide
Mycin B phosphoric acid transferase gene expressed intact frame, is named as HygB tolerant gene expression frame；Lead between above-mentioned four kinds of different fragments
It crosses design of primers and makes the end overlapping region between adjacent two segment with 25bp, wherein fragment upstream end and downstream piece
Section starting point is overlapped；Segments downstream end is overlapped with HygB tolerant gene expression frame starting point；HygB tolerant gene expression frame end
End is overlapped with ura3 genetic fragment starting point；Upstream is obtained by PCR amplification respectively from reesei gene group using high fidelity enzyme
Segment, segments downstream, ura3 genetic fragment obtain HygB tolerant gene expression frame from PCR amplification on pcDNA1 plasmid；By melting
It closes PCR and obtains fragment upstream+segments downstream+HygB tolerant gene expression frame+ura3 genetic fragment ura3 gene knockout segment；
Ura3 gene knockout segment conversion trichoderma protoplast is obtained into mutant；It is cultivated in the PDA culture medium containing HygB prominent
Variant carries out mutant for the first time using mycelia lytic reagent box to the trichoderma that can be grown in the PDA culture containing HygB
Homologous recombination verifying, retains the mutant strain that correct homologous recombination occurs, and allows its continued growth to producing spore；By above-mentioned generation
The spore of the correct mutant of first time homologous recombination is coated on the training of the GSM solid containing 1.5mg/ml 5-FOA, 5nmol uridine
It supports and is cultivated on base, the segment that secondary homologous recombination occurs can be sprouted and be grown on the GSM plate containing 5-FOA and uridine
Fungus block out, picking Positive mutants body simultaneously obtain the trichoderma mutant of seamless knockout ura3 gene after carrying out purifying verifying.
2. no trace trichoderma fungal gene according to claim 1 is overexpressed method, it is characterised in that it is characterized in that packet
Include following steps:
(1) it is overexpressed segment building
It is overexpressed the internal element sequence of segment building are as follows: endogenous strong promoter sequence+overexpression complete sequence of target gene
Complete terminator sequence+U3 the expression cassette of column+overexpression target gene.Endogenous strong promoter sequence passes through primer P_F:SEQ
ID NO.33 and primer P_R:SEQ ID NO.34 is expanded from NJAU4742 genomic DNA to be obtained；The target gene of overexpression
The complete terminator sequence of the target gene of complete sequence and overexpression is expanded from NJAU4742 genomic DNA by PCR and is obtained；
U3 expression cassette passes through primer U3box_F:SEQ ID NO.37 and U3box_R:SEQ ID NO.38 from NJAU4742 genomic DNA
Middle amplification obtains, and obtains final overexpression fragment products by above-mentioned fusion DNA vaccine step；
(2) it is overexpressed segment conversion
It is transferred in the trichoderma mutant of seamless knockout ura3 gene by protoplast transformation by segment is overexpressed；
(3) muton screening, purifying and qPCR verifying are overexpressed
Above-mentioned bilayer screening flat board can grow apparent circle in upper layer GSM media surface after 48-72h is cultivated in 28 DEG C of cultures
Shape bacterium colony is transferred on new GSM solid plate, is extracted mutant DNA using mycelia lytic reagent box, is tested by PCR
Whether card overexpression segment, which is initially inserted properly to obtain in genome, is overexpressed mutant, and mutant can not add uridine or urine
Normal growth on the GSM culture medium of pyrimidine, ura3 gene are correctly covered；
Mutant will be overexpressed and original strain NJAU4742 ferments in GSM fluid nutrient medium, both recycling mycelium extracts
Then mutant and original strain total serum IgE, are carried out by the mRNA reverse transcription in total serum IgE at cDNA using quantitative PCR kit
It is overexpressed the verifying of target gene transcriptional level.
3. no trace trichoderma fungal gene according to claim 1 is overexpressed method, it is characterised in that the trichoderma is
Trichoderma containing ura3 gene.
4. no trace trichoderma fungal gene according to claim 1 is overexpressed method, it is characterised in that the upstream piece
Section amplimer is 5 ' end primer U3_upF:SEQ ID NO.1 and 3 ' end primer U3_upR:SEQ ID NO.2；Segments downstream expands
Increasing primer is 5 ' end primer U3_downF:SEQ ID NO.3 and 3 ' end primer U3_downR:SEQ ID NO.4；HygB resistance base
Because expression cassette amplimer is 5 ' end primer hygBox_F:SEQ ID NO.5 and 3 ' end primer hygBox_R:SEQ ID NO.6；
Ura3 gene fragment amplification primer is 5 ' end primer U3_geneF:SEQ ID NO.7 and 3 ' end primer U3_geneR:SEQ ID
NO.8。
5. no trace trichoderma fungal gene according to claim 1 is overexpressed method, it is characterised in that the fusion DNA vaccine
10 μ l of HiFi Premix in first step reaction system, four kinds of segments each 2 μ l, ddH2O 2μl；Response procedures be 98 DEG C of 1s, (98
DEG C 10s, 60 DEG C of 7s, 72 DEG C of 40s)15 circulations, 4 DEG C of preservations；25 μ l of HiFi Premix in fusion DNA vaccine second step reaction system, the
Single step reaction product 4 μ l, U3_upF and U3_geneR primer each 2 μ l, ddH2O 17μl；Response procedures be 98 DEG C of 1s, (98 DEG C
10s, 60 DEG C of 7s, 72 DEG C of 40s)30 circulations, 4 DEG C of preservations.
6. no trace trichoderma fungal gene according to claim 1 is overexpressed method, it is characterised in that the mutant
It is E_u3F:SEQ ID NO.9 and E_hygB_R:SEQ ID NO.10 that first time homologous recombination, which verifies primer,.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910045672.7A CN109666690B (en) | 2018-02-08 | 2018-02-08 | Method for over-expressing non-trace trichoderma fungus gene |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810130104.2A CN108384797B (en) | 2018-02-08 | 2018-02-08 | A kind of no trace trichoderma fungal gene edit methods |
| CN201910045672.7A CN109666690B (en) | 2018-02-08 | 2018-02-08 | Method for over-expressing non-trace trichoderma fungus gene |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810130104.2A Division CN108384797B (en) | 2018-02-08 | 2018-02-08 | A kind of no trace trichoderma fungal gene edit methods |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109666690A true CN109666690A (en) | 2019-04-23 |
| CN109666690B CN109666690B (en) | 2020-05-26 |
Family
ID=63074645
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910045672.7A Active CN109666690B (en) | 2018-02-08 | 2018-02-08 | Method for over-expressing non-trace trichoderma fungus gene |
| CN201810130104.2A Active CN108384797B (en) | 2018-02-08 | 2018-02-08 | A kind of no trace trichoderma fungal gene edit methods |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810130104.2A Active CN108384797B (en) | 2018-02-08 | 2018-02-08 | A kind of no trace trichoderma fungal gene edit methods |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN109666690B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108676811B (en) * | 2018-05-28 | 2021-07-13 | 郝志敏 | Gene traceless editing vector and application thereof in organism gene editing |
| CN111019967A (en) * | 2019-11-27 | 2020-04-17 | 南京农业大学 | Application of GmU3-19g-1 and GmU6-16g-1 promoters in soybean polygene editing system |
| CN114717268A (en) * | 2021-11-01 | 2022-07-08 | 天津农学院 | Preparation of traceless genetic transformation strain |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102604929A (en) * | 2012-03-29 | 2012-07-25 | 山东大学 | Method of performing traceless knockout and integration on gene of Acidithiobacillus caldus |
| CN105420134A (en) * | 2015-12-25 | 2016-03-23 | 天津大学 | Recombinant yeast strain, and construction method and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104946688B (en) * | 2015-05-26 | 2018-04-20 | 中国科学院青岛生物能源与过程研究所 | A kind of method for cutting off screening label and application |
| CN106434651B (en) * | 2016-07-19 | 2021-05-18 | 广西大学 | Agrobacterium tumefaciens and CRISPR-Cas9 mediated gene site-directed insertion inactivation method and application thereof |
-
2018
- 2018-02-08 CN CN201910045672.7A patent/CN109666690B/en active Active
- 2018-02-08 CN CN201810130104.2A patent/CN108384797B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102604929A (en) * | 2012-03-29 | 2012-07-25 | 山东大学 | Method of performing traceless knockout and integration on gene of Acidithiobacillus caldus |
| CN105420134A (en) * | 2015-12-25 | 2016-03-23 | 天津大学 | Recombinant yeast strain, and construction method and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 郭亭 等: "酵母基因中断技术研究进展", 《生物技术》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108384797A (en) | 2018-08-10 |
| CN109666690B (en) | 2020-05-26 |
| CN108384797B (en) | 2019-02-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Baker et al. | Isolation by sucrose-density fractionation and cultivation in vitro of actinomycetes from nitrogen-fixing root nodules | |
| CN108384797B (en) | A kind of no trace trichoderma fungal gene edit methods | |
| CN105838619B (en) | Two pairs can successfully infect wild rice stem plant and make wild rice smut and its Inoculation Method of its pregnant hay | |
| CN105830760B (en) | A kind of wild rice smut Inoculation Method successfully making the pregnant hay of wild rice stem plant | |
| CN105838615B (en) | A kind of wild rice smut haploid strains UET2 and its application | |
| CN105838616B (en) | A kind of wild rice smut haploid strains UET1 and its application | |
| CN109913488A (en) | A method of improving bacillus iturin yield | |
| CN105670940B (en) | A kind of fungal bacterial strain of high efficient expression huperzine and its application | |
| CN111057654B (en) | Cas9 gene knockout vector applicable to morinda officinalis endophytic fungus A761 and construction method and application thereof | |
| CN106591154B (en) | One plant of Penicillium notatum for effectively preventing cucumber fusarium axysporum | |
| CN107236751B (en) | Method for rapidly and efficiently screening antibacterial genes by using bacillus subtilis expression system | |
| CN103834681B (en) | A kind of method of Agrobacterium tumefaciens-mediated Transformation rice aspergillus | |
| CN104152483A (en) | Application of argJ gene in fermentation production of L-citrulline | |
| CN106520572A (en) | Chinese toon Alternaria mali 56-50 and its secondary metabolite, preparation method and use | |
| CN106906238A (en) | A kind of streptomycete antibiotic biological synthesis gene cluster multicopy amplification method and application | |
| CN102102108A (en) | Method for cultivating efficient selected-marker-free transgenic crop by using double T-DNA+1 vectors | |
| CN100460511C (en) | Method for inducing and cultivating hairy root system of Saussurea medusa | |
| CN105732781A (en) | Protein for promoting root surface colorization of trichoderma harzianum and application of protein | |
| CN106222097A (en) | A kind of isolation and identification method of sorghum hybrid sudangrass Leaf blotch pathogeny | |
| CN105838618B (en) | A kind of wild rice smut haploid strains UEMT2 and its application | |
| CN105779315A (en) | Preparation method of asparagus stem blight generic transformant mediated by agrobacterium | |
| CN109554321A (en) | A kind of genetic engineering bacterium of high yield lipopeptid and its application | |
| CN110452821A (en) | It can promote the Flora of Rhizosphere Fungi and purposes of nursery stock adventitious root and secondary root development | |
| CN103740612A (en) | High-yield enramycin strain and screening method thereof | |
| CN104962574B (en) | A kind of arthrobacterium expression plasmid and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20210127 Address after: No. 17, Nanning City, the Guangxi Zhuang Autonomous Region, the Guangxi Zhuang Autonomous Region Patentee after: NANNING HARWORLD BIOTECHNOLOGY Co.,Ltd. Address before: 211225 Jiangsu Nanjing Lishui District Baima Town National Agricultural Science and Technology Park Nanjing Agricultural University base Patentee before: NANJING AGRICULTURAL University |