CN110004070B - Xylanase-producing Aspergillus niger genetically engineered bacterium and construction method and application thereof - Google Patents

Abstract

The invention discloses an Aspergillus niger genetically engineered bacterium for producing xylan, wherein the Msb2 gene in the strain is inactivated; the nucleotide sequence of the Msb2 gene is shown as SEQ ID NO.1, and the nucleotide sequence of the inactivated Msb2 gene is shown as SEQ ID NO. 2. The invention also discloses a construction method of the genetic engineering bacteria. The invention further discloses application of the genetic engineering bacteria in fermentation production of xylanase. According to the invention, by constructing the Aspergillus niger genetic engineering bacteria of the Msb2 gene, the yield of a biological membrane is reduced and the adhesiveness is weakened in the process of producing xylanase by Aspergillus niger through fermentation, the yield of the xylanase is improved, and the fermentation period is shortened.

Description

Xylanase-producing Aspergillus niger genetically engineered bacterium and construction method and application thereof

Technical Field

The invention belongs to the field of biological genetic engineering, and particularly relates to an Aspergillus niger genetic engineering bacterium for producing xylan, and a construction method and application thereof.

Background

The plant fiber is the most abundant and cheap renewable resource with the largest storage amount in nature, wherein the hemicellulose accounts for about 15-30%. As a main component of hemicellulose, xylan is widely distributed in cell walls of higher plants, and is a polysaccharide having storage capacity next to cellulose in nature. Xylanases are a class of hydrolases that can degrade xylan into oligosaccharides and xylose, and are mainly composed of beta-1, 4-endoxylanases and beta-xylosidases, which function to cleave xylosidic bonds in the xylan backbone and further degrade oligosaccharides into monomeric xylose, respectively.

Meanwhile, the xylanase is used as an industrial enzyme preparation and has wide application in various fields. The xylanase is added into the plant feed to degrade the non-starch polysaccharide of the anti-nutritional factors in the feed, thereby improving the utilization rate of the nutrient substances of the livestock. In the food industry, xylanase can degrade agricultural wastes with higher hemicellulose content into xylo-oligosaccharide. In the field of bioenergy conversion, xylanase can act synergistically with cellulase systems to degrade plant fibers into pentoses and hexoses, and further produce ethanol by microorganisms with the pentoses and the hexoses as fermentation substrates. In the field of biological pulping and bleaching, xylanase can be used as a biological bleaching auxiliary agent to be applied to the paper industry.

At present, xylanase is mainly obtained by means of microbial fermentation, and microorganisms capable of synthesizing xylanase are known to mainly relate to fungi, streptomyces, bacteria, yeast and the like. The aspergillus strain is an excellent strain for producing xylanase, and becomes the key point of the production research of the xylanase at home and abroad.

The mycelium is fixed on the grain stalks or other inert materials, or is repeatedly used by adopting a method of embedding carrier materials such as sodium alginate and the like, so that the viscosity of the fermentation liquor is reduced, the transfer of oxygen and nutrient substances is facilitated, the cell utilization rate and the biological reaction rate are improved, and the separation, extraction and other post-treatment processing of products are facilitated. In recent years, immobilized fermentative production of filamentous fungi has received increasing attention.

Disclosure of Invention

The purpose of the invention is as follows: aims to solve the problems of low yield and long fermentation period when the xylanase is produced by fermenting Aspergillus niger in the prior art.

The invention also aims to solve the technical problem of providing a construction method of the aspergillus niger genetically engineered bacteria.

The invention finally aims to solve the technical problem of providing the application of the Aspergillus niger genetically engineered bacteria in preparing xylanase by fermentation.

The invention content is as follows:

a strain of Aspergillus niger capable of producing xylan is classified and named as Aspergillus niger, the strain number is SJ1, the Aspergillus niger strain is preserved in China center for type culture collection, the preservation time is 2019, 02, 28 days, the preservation number is CCTCCNO: M2019115, the preservation address is university of Wuhan, China, and the postal code is 430072. The strain is obtained by diluting soil and screening with basic xylan screening culture medium, wherein the culture medium formula is 10g/L of xylan and KH₂PO₄、KH₂PO₄、MgSO₄、NH₄NO₃、NaCl、MnS0₄、ZnSO₄、FeSO₄And the dosage of agar is 2 percent. The strain was identified as Aspergillus niger and the phylogenetic tree is shown in FIG. 1.

The application of the aspergillus niger for producing xylan in the preparation of xylan is within the protection scope of the invention.

An Aspergillus niger genetically engineered bacterium for producing xylan, wherein the Msb2 gene in the strain is inactivated. The inactivation means that the Msb2 gene in the strain can not express a protein with activity, and the inactivation can be to insert a nucleotide sequence into the Msb2 gene, or delete a partial sequence of the Msb2 gene in Aspergillus niger, or replace the whole sequence of the Msb2 gene with other nucleotide sequences.

The Msb2 gene has a nucleotide sequence shown as SEQ ID NO.1, and the Msb2 gene inactivated has a nucleotide sequence shown as SEQ ID NO. 2. The Msb2 Gene is an Aspergillus niger CBS513.88 signal mucin Msb2(Gene ID: 4986934) homolog protein, 90% similar. The full-length 2955bp of the Msb2 was replaced by the hygromycin resistance expression element 2740bp by homologous recombination.

Wherein the Aspergillus niger is Aspergillus niger SJ1, and is preserved in China center for type culture Collection with a preservation number of CCTCC NO: M201911.

The construction method of the aspergillus niger genetically engineered bacterium for producing xylan comprises the following steps:

(1) extracting an Aspergillus niger SJ1 genome;

(2) constructing a gene knockout fragment delta Msb2, wherein the nucleotide sequence of the gene knockout fragment is shown as SEQ ID NO. 3;

(3) preparing an Aspergillus niger protoplast;

(4) and (3) introducing the gene knockout segment into a protoplast for homologous recombination to obtain the Msb2 gene inactivated Aspergillus niger genetically engineered bacterium.

The application of the aspergillus niger genetically engineered bacterium for producing xylan in the preparation of xylanase is within the protection scope of the invention.

The specific application method is as follows: aspergillus niger genetically engineered bacteria for producing xylan are used as a fermentation microbial inoculum, porous fiber materials are used as an immobilized carrier, and xylanase is prepared by fermentation, wherein the immobilized carrier is polyurethane.

The immobilized carrier is pretreated by the following method:

soaking the immobilized carrier in 0.5-2M NaOH for 30min-2h, washing with water until the pH is neutral, soaking in 0.5-2 MHCl for 30min-2h, washing with water until the pH is neutral, and drying to obtain a pretreated immobilized carrier;

preferably, the method comprises the following steps: and (3) soaking the immobilized carrier in 1M NaOH for 1h, washing with water until the pH value is neutral, soaking in 1M HCl for 1h, washing with water until the pH value is neutral, and drying to obtain the pretreated immobilized carrier.

The fermentation conditions were as follows:

the fermentation medium is xylan 10-70 g/L, NaNO ₃2～6g/L、KH₂PO₄0.3～2g/L、MgSO₄·7H₂0.1-0.8 g/L of O and 800.1-0.8 g/L of Tween-and is prepared by bran extract; preferably xylan 30g/L, NaNO₃4.2g/L、KH₂PO₄1.0g/L、MgSO₄·7H₂O0.5 g/L, Tween-800.5 g/L;

the bran leachate is prepared by the following method: weighing 15-60 g/L bran, adding 800mL water, boiling for 30min-2h, filtering to obtain filtrate, and diluting to a constant volume of 1L with water; preferably, 40g/L of bran is weighed, 800mL of water is added, after boiling for 1h, the filtrate is obtained by filtration, and the volume is increased to 1L by using water.

The fermentation conditions were as follows: culturing at 28-32 ℃ and 150-300 r/min for 3-6 days, preferably culturing at 30 ℃ and 220r/min for 4 days.

Has the advantages that:

according to the invention, the Msb2 gene related to biofilm formation is knocked out, so that the biofilm formation is reduced, the xylanase yield is further improved, the substrate utilization capacity of the thallus is improved, and the fermentation period is shortened. According to the invention, the xylanase is produced by shake flask fermentation by taking polyurethane as an immobilized carrier, the enzyme activity is stable, the enzyme activity is improved from 1515.34U/mL to 1633.27U/mL, the yield is improved by 7.8%, and the period is shortened from 4d to 3.5 d. The culture medium is a pure clear liquid culture medium, and the supernatant of the fermentation liquid obtained after fermentation is xylanase liquid and can be directly used for subsequent experiments.

Drawings

FIG. 1 is a phylogenetic tree of Aspergillus niger.

FIG. 2 is an electrophoretogram of the genome of Aspergillus niger SJ1, in FIG. 1, lanes 1 and 2 are the genome of Aspergillus niger SJ1, and M is 10000bp DNA marker.

FIG. 3 is a PAN7-1 plasmid map;

FIG. 4 is an electrophoretogram of the upper homology arm, the lower homology arm and the resistance gene fragment of the Msb2 gene, M is 2000bp DNAmarker, lane 1 is the Msb2 upper homology arm, lane 2 is the resistance gene fragment, and lane 3 is the Msb2 lower homology arm.

FIG. 5 is an electrophoretogram of a Δ Msb2 knockout fragment, lane 1 is a Δ Msb2 knockout fragment, and M is 5000bp DNAmarker;

FIG. 6 is a graph of crystal violet staining;

FIG. 7 is a graph showing the difference in OD values of crystal violet stains;

FIG. 8 shows the results of fermentation of original Aspergillus niger and Aspergillus niger genetically engineered bacteria;

FIG. 9 is an attached map of vector bacterial load after immobilized fermentation of Aspergillus niger original bacteria and Msb2 knockout strain for 4 d.

Detailed Description

Example 1: the Aspergillus niger SJ1 genome was extracted.

Inoculating Aspergillus niger spore into YPD medium, culturing at 30 deg.C and 220rpm for 12 hr. Centrifuging at 12000rpm and 4 deg.C for 5min, and removing supernatant. Washed twice with PBS (8g/L NaCl,0.2g/L KCl,1.44g/L Na2HPO4,0.24g/L KH2PO4, pH 7.4). Then, the mixture was immediately centrifuged (4 ℃, 12000rpm, 2min), and the supernatant was discarded. The cells were pulverized in liquid nitrogen and then subjected to the TaKaRa MiniBEST Plant Genomic DNA Extraction Kit instructions. The Aspergillus niger genome concentration was determined by agarose gel electrophoresis as shown in FIG. 2.

Example 2: a gene Δ Msb2 knock-out fragment was constructed.

(1) Designing a primer: obtaining an upstream homology arm and a downstream homology arm of an Msb2 gene by PCR, wherein the nucleotide sequence of the upstream homology arm of the Msb2 gene is shown as SEQ ID NO.4, the nucleotide sequence of the downstream homology arm of the Msb2 gene is shown as SEQ ID NO.5, amplifying a resistance expression element by PCR by taking pAN7-1 plasmid as a template, drawing a pAN7-1 plasmid map as shown in figure 3, carrying out gel recovery and purification on the upstream homology arm, the downstream homology arm and the resistance fragment of Msb2, and carrying out electrophoresis detection on the purified Msb2 upstream homology arm, the downstream homology arm and the resistance element by using 0.8% (0.8g/100mL) agarose gel, wherein the result is shown in figure 4. And then constructing a knockout fragment delta Msb2 of Msb2 by using a upstream homology arm, a downstream homology arm and a resistance element by adopting an overlap pcr method, recovering and purifying delta Msb2 knockout fragment glue, performing agarose gel electrophoresis and sequencing verification. The results of the Δ Msb2 knock-out fragment are shown in fig. 5. The primers are as follows:

TABLE 1 Δ Msb2 knock-out fragment construction primers

The PCR system was as follows:

gel recovery yielded the Msb2 upper and lower homology arms, the resistant fragment and the Δ Msb2 knock-out fragment:

purification was performed using the TaKaRa kit (TaKaRa MiniBEST Agarose Gel DNA Extraction KitVer.4.0).

Example 3: preparation and transformation of Aspergillus niger protoplast.

1. Aspergillus niger was inoculated into 3 PDA plates, which were overgrown with spores, for use.

2. Add appropriate amount of scrape spore buffer (0.02% tween80 in 0.9% NaCl, sterilized at 115 ℃ for 20 min.) to the plate, scrape spores with a spreading rod to obtain spore liquid, and count with a hemocytometer.

3. Inoculation 10⁷Spores were cultured in 50ml YPD medium at 30 ℃ and 220rpm for 10 hours.

4. Enzyme solutions (Yatalase, lysine enzyme, crashed enzyme, snailase each 0.1g/10ml, dextranase 50. mu.l/10 ml, cellulase 400. mu.l/10 ml) were prepared and sterilized by filtration using a 20ml sterile syringe into sterilized Erlenmeyer flasks.

5. After the spores were germinated, they were filtered through Miracloth to leave hyphae, which were weighed and 2g of hyphae were added to the enzyme solution. Enzymolysis is carried out for 3h at 30 ℃ and 200 rpm.

6. After completion of the enzymatic hydrolysis, the mixture was filtered through Miracloth, and the filtrate was centrifuged at 4 ℃ and 5000rpm for 10 min. Removing supernatant, adding 1ml of 1M sorbitol, mixing well by blowing and sucking with a gun, adding 15ml of sorbitol, centrifuging, and removing supernatant. And then repeated once more. The supernatant was removed, 1ml of buffer (100ml containing KCl 4.47g, CaCl20.735g, MOP 0.2093g, KOH to adjust pH to 6.0) was added, mixed by pipetting with a gun, and then placed in a 4 ℃ freezer for further use.

9. Pipette the Δ Msb2 knock-out fragment into a 1.5ml sterile centrifuge tube

10. Mixing the prepared protoplast with 1ml pipette gently for several times (if it is done, it is not necessary to mix evenly or just need to reverse for several times)

11. Mu.l of protoplasts were pipetted into a 1.5ml centrifuge tube and mixed with 10ul of the Δ Msb2 knock-out fragment, 50. mu.l of buffer A (100ml containing PEG 800025 g, CaCl 21.47g, KCl 4.47g, 10mM Tris pH7.5) was added and mixed well, placed on ice and timed for 20 min.

After 12.20min, 1ml of buffer A was added, inverted several times, left at room temperature and timed for 20 min.

After 20min, 200, 300, 500. mu.l of PDA medium with hygromycin concentration of 150mmol/L was aspirated and cultured upright.

Example 4: and (5) carrying out colony PCR verification.

1. Aspergillus niger was inoculated into 3 PDA plates, which were overgrown with spores, for use.

2. Adding a proper amount of the spore scraping buffer solution into the plate, scraping the spores by using a coating rod to obtain spore liquid, and counting by using a blood counting plate.

3. Adding 2ul of spores into a buffer solution (100ml containing 0.01M Tris, 10Mm EDTA, 1M KCl and PH9.5), carrying out water bath at 95 ℃ for 10 minutes, taking out the ice bath for 5 minutes as a template, carrying out PCR verification by using a verification primer delta Msbchck 1 (sequence: CGCTCTGTCCATTCATTTCAGC) and a delta Msbchck 2 (sequence: ATGGCAACATCAACAACGCT) primer, and carrying out sequencing verification on PCR-obtained fragments to obtain a knockout strain for knocking out Msb 2.

Example 5: crystal violet staining test

Respectively inoculating original aspergillus niger and knockout bacteria to a PDA (personal digital assistant) plate, adding 3mL of spore scraping buffer solution into the plate when spores grow fully, scraping the spores by using a coating rod, transferring the spores into a sterilized 5mL centrifuge tube, and fixing the volume to 2mL by using the spore scraping buffer solution to obtain spore liquid. Quantitated and diluted to 10 using a hemocytometer⁶one/mL, followed by further dilution to 10⁵，10⁴，10³。

1ml of Aspergillus minimal medium was added to a 24-well plate, and 2uL of spore liquid at different concentrations was inoculated into the medium. Standing and culturing for 48h at 30 ℃ to enable the Aspergillus niger to form a film at the bottom of the pore plate. The medium was then decanted, washed 2 times with PBS, and stained with 0.1% crystal violet for 15 min. Then pouring out the crystal violet, washing with PBS for 2 times, adding glacial acetic acid, and placing in a shaking instrument for 30min to decolorize the crystal violet. Then, observation and detection of OD570 by microplate reader were carried out. FIG. 6 shows the results of the plate stained with crystal violet, and FIG. 7 shows the difference in OD values.

Example 6: and (5) fermentation verification.

1, the carrier is a polyurethane material, and the pretreatment method comprises the following steps: soaking the carrier in 1M Na (OH) for 1h, washing with pure water, soaking in 1M HCl for 1h, washing with pure water until pH is neutral, and oven drying at 65 deg.C to constant weight. Adding appropriate amount of the carrier cut into the same size into the culture medium, sterilizing with the culture medium at 115 deg.C for 20min, and cooling.

2, bran leaching solution: weighing 40g/L bran, adding 800mL water, boiling for 1h, filtering with 4 layers of gauze to obtain filtrate, and diluting to 1L with water.

3, a culture medium formula: the slant culture medium is potato glucose agar (PDA) culture medium. The seed culture medium is 10g/L of cane sugar and is prepared by bran extract. Fermentation medium (g/L) comprising xylan 30, NaNO34.2, KH2PO41.0, MgSO4 & 7H2O 0.5.5, and Tween-800.5, and is prepared from bran extract. Sterilizing the above culture medium at 121 deg.C and 105Pa for 15 min.

4. Inoculating the preserved strain into a PDA slant culture medium, culturing in a constant temperature incubator at 30 ℃ for 3d, inoculating into a 500mL shake flask containing 100mL seed culture medium, and culturing at 30 ℃ for 24h at 220 r/min.

5. Inoculating the cultured seeds to a fermentation medium at a volume fraction of 5%, and culturing at 30 deg.C and 220r/min for 4 days.

6. Preparing a crude enzyme solution: and centrifuging the fermentation liquor by a refrigerated centrifuge at 5000rpm for 10min to obtain a crude enzyme solution.

7. And (3) xylanase activity determination: 50. mu.L of the appropriately diluted crude enzyme solution was added with 0.45mL of 0.05mol/L citric acid buffer solution (pH 4.8) and 1mL of 1.2% (mass fraction) xylan substrate, and the mixture was reacted at 50 ℃ for 30 min. The amount of xylose produced was measured with reference to the literature. Enzyme activity definition (U) enzyme amount required for degrading substrate to generate 1 mu mol xylose at 50 ℃ for 30 min.

8. According to the method, Aspergillus niger SJ1 and Msb2 knockout strains are inoculated to 100mL of seed culture medium added with 0.1g of carrier for culture for 24h, then the carrier is transferred to a fermentation culture medium, the culture is carried out at 30 ℃ and 220r/min for 4d, fermentation liquor is taken at different times for detecting the enzyme activity, and the enzyme activity data is shown in figure 8. And taking out the immobilized and fermented carrier for 4 days, and washing the immobilized and fermented carrier for 3 times by PBS to remove adsorbed hyphae. As shown in FIG. 9, the number of mycelia attached to the carrier was large, and the number of knockdown bacteria was moderate.

Sequence listing

<110> Nanjing university of industry

<120> Aspergillus niger genetically engineered bacterium for producing xylanase as well as construction method and application thereof

<160>13

<170>SIPOSequenceListing 1.0

<210>1

<211>2955

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atgatcgcgc ccacgacttc attgttggcc gcgttcctgt ccttgggcgg cctcgagctc 60

gtcgctgccc gggaggcagg acagatccgg gacttgggag cgcgtgaggt tagctccgcc 120

gttcctggtt cctcccagcc cgttacgcct gtcgagttga caaccaggtc cgaaacgagt 180

acgcatgatt cagcgccgac ttcggacaat gaacaaacaa gcccgatcgt tgacccttca 240

cctgctgtta tcgttgttcc tgtaaccatt tccgtggacg ccaatggtgt tacgcatacc 300

attgtgggca cggcacccaa cgttcccggt gcttcaacga caactagctc cacccttgag 360

cgtgcagaga gtaccccggc ggcagctgct gctacttcga cggcgagcgc gactacatcg 420

gacaaggatt caactaccag tgactcggaa aagcagaaat ctacatccga atccgagaaa 480

cacacttccg cgtctgaatc gtcagcgaaa ccagaggcag cttcttcgtc agcagcagca 540

acgacggcag agacagcttc ttcgtcggcc gcagcggcag cagcagcagc tactacatct 600

agccagagtt cgttggctga ctcctgggag agcttcattt caagtatctt ggggtcctct 660

accagcacca gcgcaacctc cacggccagc cctaccgcat cgccagccga gtccagctct 720

gcaacccccg ctcccgcttc aagctctgct ggcgtcattg tagatgtcac ctcgagcaag 780

agttctacaa gcgatagctc gacgacttcg gagagctcta cggctaagga ttccaccact 840

cagagctctt ccagcccagc atcctcgacc cctgcttcca ctacggagtc ttcggccgag 900

gcttcgcaat cggaatctgc cacttctagc tcgaaggcag agacttcgag tcaacttatc 960

actagccaga gcgcatctgc ccagagttct tccgctcagg tccctctggc tgagtctact1020

tcgaagtccg agtcttcaac ccagagctcc tcgagtcagg ttacatctgt tcaggccacc1080

tcatcaggcg cagcctctca gactactggg tcagcatcct cgagcctcat cccgtctgca1140

tctgaagatg tgacctcttc ttcttccacc ccctcatcat caggaggtgt cctcggcttc1200

ctctcggacc tcttccctac taccaccact tccagcggat ctgcctctgc tactagcaag1260

agtgcaagcg agtctgccga ctccagtgct ttccctctga gcctccctac catctccgtt1320

agtgttcctg tggttacgcc tgcctcatct tctggatcgg tcaatattgt ttctgcccta1380

cttggcacat cctcaggcgc ttccttggaa ccttcggcca ttagtctggg tatctcggcc1440

acttccacgg ctcttatccc cggagcttcc agcggaaccc agagctcctc agcgggagcc1500

tcgactccga tcatcagcgg tggcattgtc atcatgccca cttcgactga atctgcttct1560

gcttccgtct caggatctgc ctcgacgggt ctttttggaa ccacttcaga atcagcatct1620

tcattggctt cgggatccgc ctctggatct gcgggcgtta ttcctacatc ggtgtctggg1680

tctgtatctg gatctgcagg actgttccct acgtcggcgt ctggatccgt ttcgggatct1740

gcaggtgtta ttcctacatc ggctcctggc tctgcatctg gatctgtgtc gggatctgct1800

tctggatccg tttcaggctc tgccattggc accagctctg catccaagtt tacctccatt1860

tctggccctg cctcttcgat tcctttgatc acttccacca aggagtcctc gggtctggta1920

tctgcgacgc cttcctatgc cccgtccact accagcaagg aaacgcccac gcctatcgca1980

caacccacca cgacgaccac ctcggccgct gagacgactg tcgcccccaa accgaccacg2040

accacctccg attctgacaa ctacctgccg tcaagcattc tcgtggttga gcccacaact2100

actacgtcac tgagcacggg cacagctacc cattcgagta ccagcactgc tgctgctcag2160

cttcctggat cgatctctcc ttctggtggt cttcccgagc agccggccaa cgataccttg2220

gtccaaatcg gattcaatgg caaactgcgc tggagctttg tggccacaac gcccttgtct2280

tcctcccaga tcttcatgta tgttcccgag ggtatgggct acgcgttgca gctcaatgac2340

tctgacgtgg tcatgtacga cctccaaccc tacgacaact cggcaagcac tggctacatt2400

gctactgttg cgctgatgta catcccttcg gatgacgttg acaccctgag aaagatgctc2460

cacaacccta tttcgaggct ctacgagcag cccaacgaga cggtcaagac attgatggcc2520

atgatcgacc cttccatccc tcttctggtg ggcgactcgg gttcttccag tggcagctcg2580

tccaacagcg gtggatcggg tagcagcagc agcaacggcg atggcagtga cggtggctac2640

gaccaaagcg atgctggtac cagctcatct ggaaccacca aggctagtgc cgttggtata2700

ggatgtggtg ctgtggccgg tgctgcagca tatggtgctg gtatgttctg ggttgcgcgt2760

cggtaccgga agaagcgcca gttgcaccag cgctccccct cgagcgtcga ccagatgagc2820

gaaggccgcg gcgctgggtc cgtcttcggc gcaggtggcc gtctctcccg caacagccag2880

aacagccggg gcactggccg cacccagatg atcagcgcgc cggtgatggc cgagaactcg2940

ctcggctgga actaa 2955

<210>2

<211>2798

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

gctattgtta cccaaccatt cgaatcaatt aaaatccgcc gcctccacca tttgtagaaa 60

aatgtgacga actcgtgagc tctgtacagt gaccggtgac tctttctggc atgcggagag 120

acggacggac gcagagagaa gggctgagta ataagccact ggccagacag ctctggcggc 180

tctgaggtgc agtggatgat tattaatccg ggaccggccg cccctccgcc ccgaagtgga 240

aaggctggtg tgcccctcgt tgaccaagaa tctattgcat catcggagaa tatggagctt 300

catcgaatca ccggcagtaa gcgaaggaga atgtgaagcc aggggtgtat agccgtcggc 360

gaaatagcat gccattaacc taggtacaga agtccaattg cttccgatct ggtaaaagat 420

tcacgagata gtaccttctc cgaagtaggt agagcgagta cccggcgcgt aagctcccta 480

attggcccat ccggcatctg tagggcgtcc aaatatcgtg cctctcctgc tttgcccggt 540

gtatgaaacc ggaaaggccg ctcaggagct ggccagcggc gcagaccggg aacacaagct 600

ggcagtcgac ccatccggtg ctctgcactc gacctgctga ggtccctcag tccctggtag 660

gcagctttgc cccgtctgtc cgcccggtgt gtcggcgggg ttgacaaggt cgttgcgtca 720

gtccaacatt tgttgccata ttttcctgct ctccccacca gctgctcttt tcttttctct 780

ttcttttccc atcttcagta tattcatctt cccatccaag aacctttatt tcccctaagt 840

aagtactttg ctacatccat actccatcct tcccatccct tattcctttg aacctttcag 900

ttcgagcttt cccacttcat cgcagcttga ctaacagcta ccccgcttga gcagacatca 960

ccatgcctga actcaccgcg acgtctgtcg agaagtttct gatcgaaaag ttcgacagcg1020

tctccgacct gatgcagctc tcggagggcg aagaatctcg tgctttcagc ttcgatgtag1080

gagggcgtgg atatgtcctg cgggtaaata gctgcgccga tggtttctac aaagatcgtt1140

atgtttatcg gcactttgca tcggccgcgc tcccgattcc ggaagtgctt gacattgggg1200

aattcagcga gagcctgacc tattgcatct cccgccgtgc acagggtgtc acgttgcaag1260

acctgcctga aaccgaactg cccgctgttc tgcagccggt cgcggaggcc atggatgcga1320

tcgctgcggc cgatcttagc cagacgagcg ggttcggccc attcggaccg caaggaatcg1380

gtcaatacac tacatggcgt gatttcatat gcgcgattgc tgatccccat gtgtatcact1440

ggcaaactgt gatggacgac accgtcagtg cgtccgtcgc gcaggctctc gatgagctga1500

tgctttgggc cgaggactgc cccgaagtcc ggcacctcgt gcacgcggat ttcggctcca1560

acaatgtcct gacggacaat ggccgcataa cagcggtcat tgactggagc gaggcgatgt1620

tcggggattc ccaatacgag gtcgccaaca tcttcttctg gaggccgtgg ttggcttgta1680

tggagcagca gacgcgctac ttcgagcgga ggcatccgga gcttgcagga tcgccgcggc1740

tccgggcgta tatgctccgc attggtcttg accaactcta tcagagcttg gttgacggca1800

atttcgatga tgcagcttgg gcgcagggtc gatgcgacgc aatcgtccga tccggagccg1860

ggactgtcgg gcgtacacaa atcgcccgca gaagcgcggc cgtctggacc gatggctgtg1920

tagaagtact cgccgatagt ggaaaccgac gccccagcac tcgtccgagg gcaaaggaat1980

agagtagatg ccgaccgcgg gatccactta acgttactga aatcatcaaa cagcttgacg2040

aatctggata taagatcgtt ggtgtcgatg tcagctccgg agttgagaca aatggtgttc2100

aggatctcga taagatacgt tcatttgtcc aagcagcaaa gagtgccttc tagtgattta2160

atagctccat gtcaacaaga ataaaacgcg ttttcgggtt tacctcttcc agatacagct2220

catctgcaat gcattaatgc attgactgca acctagtaac gccttncagg ctccggcgaa2280

gagaagaata gcttagcaga gctattttca ttttcgggag acgagatcaa gcagatcaac2340

ggtcgtcaag agacctacga gactgaggaa tccgctcttg gctccacgcg actatatatt2400

tgtctctaat tgtactttga catgctcctc ttctttactc tgatagcttg actatgaaaa2460

ttccgtcacc agcncctggg ttcgcaaaga taattgcatg tttcttcctt gaactctcaa2520

gcctacagga cacacattca tcgtaggtat aaacctcgaa atcanttcct actaagatgg2580

tatacaatag taaccatgca tggttgccta gtgaatgctc cgtaacaccc aatacgccgg2640

ccgaaacttt tttacaactc tcctatgagt cgtttaccca gaatgcacag gtacacttgt2700

ttagaggtaa tccttctttc tagaagtcct cgtgtactgt gtaagcgccc actccacatc2760

tccactcgag cccatcagta tttctcctat aaaccatg 2798

<210>3

<211>6740

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ttctccgtat actattgatc gtttggcatc tagtgtacct tttgatgggg ggttcgacca 60

ggacggcatg cgtacatgcc ttctccattg ggacgttcct ccggctagac acgcacatac 120

tgtccgttca cactatccat tcattcattc ggccattagt aaatacactc atacatatta 180

gccgggatgt aatgacttgt agtgcatgag gtgtaggcag agagtccaga accggtgaca 240

cgcaacgaca gcaacgaaag caactccagt atcaaatagc aaagacctag aacatgctca 300

accccaggtt gttgcgggca tttgtcgtca gtgagtgagc aaatgtgcaa ttgggctaat 360

gaggatgcga ggtgaagata cggcaaccaa ggtacaatac cgtacggcaa gaggtgggac 420

aaagtggaag ggggcccacc tctacccggt gcgtgtagtt tatggccttg tcatggggtg 480

gttggcattg tagccacggc cttttccttt gcttttcccg cgtgcttcct gccttttccc 540

ccctctgctt tggtgtgcct cgtttttccc ctgccgtgcc tttttccctt ccttccctcc 600

tcccccccct tttttccagt ggtaccaaac cacaactccc acagcccaac ccggaaatcc 660

aagtggtggt ggtaagagct aagtaaagta aagtaaagtc aaaaagtaaa agccgggccc 720

caaaataatc aaatctacca aaaaaaggcg atgacacgga ccggcaaacc aactaagcca 780

aactaatcca aaccgccagc cagaagtaat ctccccttcc ctctcactct cctttcattc 840

attttagtgc tgttgttatt attactgttc ctaattacta ccaccatttt tttgattttg 900

atttttcccg tccttccttt ggtattatta ttattattct tctgcttctt cactttgcat 960

cgcctatctt tcttttcatt ctttactatc atcctttccc tcttcctcct ctctcttcct1020

ctctctttccccccctcttc gccccgtttt tgcttcgcca gcgccggtgc ttcgttgacg1080

tagcccacct gcgaacacct tttctacgtc aacgagccgt tgggacttgc caattcatcc1140

tcagcctttc tctccttgca tcccatcccc ctcccacggt cgcgcgccct cttcaggtac1200

taccaccacc tccaaccgcc gttcaccata acaacccacc cccctcctcc actaccatta1260

ccacctccac ctcctccctc cctctccacg gccgtttttc tcacttaaca tccctttctt1320

agatcttgtc gctcgctcct taccgcctct acattcgtta ttgttttgtt tgctggtagt1380

ttttcgtgag gggttactgt tggtttctcg tcgaccacac cccctgccgc tctttgaacc1440

cgctttgttt ataccgaact cccgccgttg gtgcgcgcac atccatccgt cagctgtcag1500

tgcactatta gagcttgtcg ctttcgatac ttttgattcg gagatttttt tggtgatata1560

gttttgtgat atctgcaaac tttctggttg tttgttcgac tcaatatacc aggaagctta1620

ccgaccgttg tcatcgcatc cccagccgtc gaccgattcg ggatatcgcc atcgctcgcg1680

ccatccttcg attgagatag gttcgcttca agtggttcaa atcgtggaga ggtggatata1740

cgaaaacgcc gggaatagga catctatata gcccgggggt tagactattc gaatttccaa1800

ccaccgaccc catgcatcag caatcttaac gactggcttt gatccttgac gtttgaatac1860

tccgtgccta gggatatttg gttttggagg ttcccatctg agccttcgct ctgtccattc1920

atttcagcat tgttacggtc ttttcgacca cctgaccact ctttatcgcc tgctattgtt1980

acccaaccat tcgaatcaat taaaatccgc cgcctccacc atttgtagaa aaatgtgacg2040

aactcgtgag ctctgtacag tgaccggtga ctctttctgg catgcggaga gacggacgga2100

cgcagagaga agggctgagt aataagccac tggccagaca gctctggcgg ctctgaggtg2160

cagtggatga ttattaatcc gggaccggcc gcccctccgc cccgaagtgg aaaggctggt2220

gtgcccctcg ttgaccaaga atctattgca tcatcggaga atatggagct tcatcgaatc2280

accggcagta agcgaaggag aatgtgaagc caggggtgta tagccgtcgg cgaaatagca2340

tgccattaac ctaggtacag aagtccaatt gcttccgatc tggtaaaaga ttcacgagat2400

agtaccttct ccgaagtagg tagagcgagt acccggcgcg taagctccct aattggccca2460

tccggcatct gtagggcgtc caaatatcgt gcctctcctg ctttgcccgg tgtatgaaac2520

cggaaaggcc gctcaggagc tggccagcgg cgcagaccgg gaacacaagc tggcagtcga2580

cccatccggt gctctgcact cgacctgctg aggtccctca gtccctggta ggcagctttg2640

ccccgtctgt ccgcccggtg tgtcggcggg gttgacaagg tcgttgcgtc agtccaacat2700

ttgttgccat attttcctgc tctccccacc agctgctctt ttcttttctc tttcttttcc2760

catcttcagt atattcatct tcccatccaa gaacctttat ttcccctaag taagtacttt2820

gctacatcca tactccatcc ttcccatccc ttattccttt gaacctttca gttcgagctt2880

tcccacttca tcgcagcttg actaacagct accccgcttg agcagacatc accatgcctg2940

aactcaccgc gacgtctgtc gagaagtttc tgatcgaaaa gttcgacagc gtctccgacc3000

tgatgcagct ctcggagggc gaagaatctc gtgctttcag cttcgatgta ggagggcgtg3060

gatatgtcct gcgggtaaat agctgcgccg atggtttcta caaagatcgt tatgtttatc3120

ggcactttgc atcggccgcg ctcccgattc cggaagtgct tgacattggg gaattcagcg3180

agagcctgac ctattgcatc tcccgccgtg cacagggtgt cacgttgcaa gacctgcctg3240

aaaccgaact gcccgctgtt ctgcagccgg tcgcggaggc catggatgcg atcgctgcgg3300

ccgatcttag ccagacgagc gggttcggcc cattcggacc gcaaggaatc ggtcaataca3360

ctacatggcg tgatttcata tgcgcgattg ctgatcccca tgtgtatcac tggcaaactg3420

tgatggacga caccgtcagt gcgtccgtcg cgcaggctct cgatgagctg atgctttggg3480

ccgaggactg ccccgaagtc cggcacctcg tgcacgcgga tttcggctcc aacaatgtcc3540

tgacggacaa tggccgcata acagcggtca ttgactggag cgaggcgatg ttcggggatt3600

cccaatacga ggtcgccaac atcttcttct ggaggccgtg gttggcttgt atggagcagc3660

agacgcgcta cttcgagcgg aggcatccgg agcttgcagg atcgccgcgg ctccgggcgt3720

atatgctccg cattggtctt gaccaactct atcagagctt ggttgacggc aatttcgatg3780

atgcagcttg ggcgcagggt cgatgcgacg caatcgtccg atccggagcc gggactgtcg3840

ggcgtacaca aatcgcccgc agaagcgcgg ccgtctggac cgatggctgt gtagaagtac3900

tcgccgatag tggaaaccga cgccccagca ctcgtccgag ggcaaaggaa tagagtagat3960

gccgaccgcg ggatccactt aacgttactg aaatcatcaa acagcttgac gaatctggat4020

ataagatcgt tggtgtcgat gtcagctccg gagttgagac aaatggtgtt caggatctcg4080

ataagatacg ttcatttgtc caagcagcaa agagtgcctt ctagtgattt aatagctcca4140

tgtcaacaag aataaaacgc gttttcgggt ttacctcttc cagatacagc tcatctgcaa4200

tgcattaatg cattgactgc aacctagtaa cgccttncag gctccggcga agagaagaat4260

agcttagcag agctattttc attttcggga gacgagatca agcagatcaa cggtcgtcaa4320

gagacctacg agactgagga atccgctctt ggctccacgc gactatatat ttgtctctaa4380

ttgtactttg acatgctcct cttctttact ctgatagctt gactatgaaa attccgtcac4440

cagcncctgg gttcgcaaag ataattgcat gtttcttcct tgaactctca agcctacagg4500

acacacattc atcgtaggta taaacctcga aatcanttcc tactaagatg gtatacaata4560

gtaaccatgc atggttgcct agtgaatgct ccgtaacacc caatacgccg gccgaaactt4620

ttttacaact ctcctatgag tcgtttaccc agaatgcaca ggtacacttg tttagaggta4680

atccttcttt ctagaagtcc tcgtgtactg tgtaagcgcc cactccacat ctccactcga4740

gcccatcagt atttctccta taaaccatgg atcgtgtact ttgttcaata ctagacaggg4800

ccaaaatata agccgaagcc atgacgcaac gctctagaga ggttgttggg ggcgttgggc4860

ccctaatctg tgtggaatac ataccaagcg ttgttgatgt tgccatttgt tcccaactgt4920

attcacattttatcttgata tgccatcgcg tcctcatttc cctggcattt gtttgattat4980

atcctttttc tttttctttt ctactcttct tattccccac acgttttgtg ccattttcca5040

ctaccttttc atccattcca ttcttactct ccttatggtg acacagaaaa agacctgcca5100

ccgcaatcac ttttttactc ttcttctatc ccattttcta tatcttcttt ccatcctctc5160

catatgacct atcccatctt ccctcagcca tggatctacc tatccctcct gactgaactc5220

accccatccc ctacgctttc ttaatgattg ggtggtaggt atctgctgtg acgagtgaac5280

gccgtgctat actctcctac cccgcgtttt gttttctacc tctttgtccg tcctttttta5340

tctcgctatg tgtacagatg tatatttctc ttttcttatt tttcaagtag atcgaaatgc5400

aagcatgcaa agctagctat ttagcttagc ccagctagtt ggattaaatc tgactcggtt5460

gggttgggct gaatgaaaat gttcaaatgt ggttgattct tttgtagaga tgtaggagta5520

gttctctgat tgttttgatg tgtgaaggta tttttgaacc gggacctagg tagggattgt5580

ttctgttgat aggcaaatgc ggaggaccga tgagtagcag gtaatgtgtt tgatctggtc5640

cttgaatgat gtggttcgtg gtaatgatga tgactgatga tgtttggctg aaaggagagc5700

agaaaaacgc taagagacaa ttattatgta cagtacaaga atgcagcgga gagagaggcg5760

aatgataaga aagtcagaag aaccatttcg tccttccatc cgtccatccc tccatcgcca5820

atgacataag aaaaccccgg gcaagagaaa aagaagagtt aaaatgaaga gatactggaa5880

cgaaagtgta ggaagggatc aatcaatcac tcaatcactc attcttctct ttcgaattcg5940

acccgaaacc caacaacgcc aacggacccc tctcgccgcg ctgctcacgc tcctgcatgc6000

gctgctcctt cgctcgacga cgttcctcct tatacttctc ccaggagacg ttcgcatcgt6060

agcccatgac ctcgccatta ttcttctcag cctggaattt aaggaagtgg cttagagagg6120

tctcctcgtc atgaggcgtc ctcacggcct gaggtaacgg acggacggca tcttcaccgg6180

catacgcacg gagtccggta tggaaggccc attcgacggc ctcttcgacg ggcttgtcga6240

ataggtaggg gaggaaaggc acgacggaga gaccgagcta gcaagtagta atttgcatgt6300

gttagcggaa taattctata ccgcaagcgg agaaacagaa ctcaccccga taggcgccca6360

agtacggaaa aagacactcc gggaattctt caacatgcgc ccagagtact tgaccaccga6420

gtggatggta aaggccggaa gacccatact ggcgataccc tggaacacgg cgcgctgggc6480

catgacggtg cggtagtctt cagctagggg gacgtgagtc gtgggccatg gcatcagcgt6540

atcgctgctg ctactgcctg ttaacgagcc ggcgatgttg ccggttacca tgcccttggc6600

gacttgctcg tgggtaaggt cgctggcatc tttgtaggcc tcgcagggag gcgctaggac6660

gcggcgattg cggaggtagg ctttgtagcc ttcgtgggcg acatcgccga ttagataggt6720

ccaggaaatg ccgtaggcgg 6740

<210>4

<211>1797

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gagagtccag aaccggtgac acgcaacgac agcaacgaaa gcaactccag tatcaaatag 60

caaagaccta gaacatgctc aaccccaggt tgttgcgggc atttgtcgtc agtgagtgag 120

caaatgtgca attgggctaa tgaggatgcg aggtgaagat acggcaacca aggtacaata 180

ccgtacggca agaggtggga caaagtggaa gggggcccac ctctacccgg tgcgtgtagt 240

ttatggcctt gtcatggggt ggttggcatt gtagccacgg ccttttcctt tgcttttccc 300

gcgtgcttcc tgccttttcc cccctctgct ttggtgtgcc tcgtttttcc cctgccgtgc 360

ctttttccct tccttccctc ctcccccccc ttttttccag tggtaccaaa ccacaactcc 420

cacagcccaa cccggaaatc caagtggtgg tggtaagagc taagtaaagt aaagtaaagt 480

caaaaagtaa aagccgggcc ccaaaataat caaatctacc aaaaaaaggc gatgacacgg 540

accggcaaac caactaagcc aaactaatcc aaaccgccag ccagaagtaa tctccccttc 600

cctctcactc tcctttcatt cattttagtg ctgttgttat tattactgtt cctaattact 660

accaccattt ttttgatttt gatttttccc gtccttcctt tggtattatt attattattc 720

ttctgcttct tcactttgca tcgcctatct ttcttttcat tctttactat catcctttcc 780

ctcttcctcc tctctcttcc tctctctttc cccccctctt cgccccgttt ttgcttcgcc 840

agcgccggtg cttcgttgac gtagcccacc tgcgaacacc ttttctacgt caacgagccg 900

ttgggacttg ccaattcatc ctcagccttt ctctccttgc atcccatccc cctcccacgg 960

tcgcgcgccc tcttcaggta ctaccaccac ctccaaccgc cgttcaccat aacaacccac1020

ccccctcctc cactaccattaccacctcca cctcctccct ccctctccac ggccgttttt1080

ctcacttaac atccctttct tagatcttgt cgctcgctcc ttaccgcctc tacattcgtt1140

attgttttgt ttgctggtag tttttcgtga ggggttactg ttggtttctc gtcgaccaca1200

ccccctgccg ctctttgaac ccgctttgtt tataccgaac tcccgccgtt ggtgcgcgca1260

catccatccg tcagctgtca gtgcactatt agagcttgtc gctttcgata cttttgattc1320

ggagattttt ttggtgatat agttttgtga tatctgcaaa ctttctggtt gtttgttcga1380

ctcaatatac caggaagctt accgaccgtt gtcatcgcat ccccagccgt cgaccgattc1440

gggatatcgc catcgctcgc gccatccttc gattgagata ggttcgcttc aagtggttca1500

aatcgtggag aggtggatat acgaaaacgc cgggaatagg acatctatat agcccggggg1560

ttagactatt cgaatttcca accaccgacc ccatgcatca gcaatcttaa cgactggctt1620

tgatccttga cgtttgaata ctccgtgcct agggatattt ggttttggag gttcccatct1680

gagccttcgc tctgtccatt catttcagca ttgttacggt cttttcgacc acctgaccac1740

tctttatcgc ctgctattgt tacccaacca ttcgaatcaa ttaaaatccg ccgcctc 1797

<210>5

<211>1930

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gcccactcca catctccact cgagcccatc agtatttctc ctataaacca tggatcgtgt 60

actttgttca atactagaca gggccaaaat ataagccgaa gccatgacgc aacgctctag 120

agaggttgtt gggggcgttg ggcccctaat ctgtgtggaa tacataccaa gcgttgttga 180

tgttgccatt tgttcccaac tgtattcaca ttttatcttg atatgccatc gcgtcctcat 240

ttccctggca tttgtttgat tatatccttt ttctttttct tttctactct tcttattccc 300

cacacgtttt gtgccatttt ccactacctt ttcatccatt ccattcttac tctccttatg 360

gtgacacaga aaaagacctg ccaccgcaat cactttttta ctcttcttct atcccatttt 420

ctatatcttc tttccatcct ctccatatga cctatcccat cttccctcag ccatggatct 480

acctatccct cctgactgaa ctcaccccat cccctacgct ttcttaatga ttgggtggta 540

ggtatctgct gtgacgagtg aacgccgtgc tatactctcc taccccgcgt tttgttttct 600

acctctttgt ccgtcctttt ttatctcgct atgtgtacag atgtatattt ctcttttctt 660

atttttcaag tagatcgaaa tgcaagcatg caaagctagc tatttagctt agcccagcta 720

gttggattaa atctgactcg gttgggttgg gctgaatgaa aatgttcaaa tgtggttgat 780

tcttttgtag agatgtagga gtagttctct gattgttttg atgtgtgaag gtatttttga 840

accgggacct aggtagggat tgtttctgtt gataggcaaa tgcggaggac cgatgagtag 900

caggtaatgt gtttgatctg gtccttgaat gatgtggttc gtggtaatga tgatgactga 960

tgatgtttgg ctgaaaggag agcagaaaaa cgctaagaga caattattat gtacagtaca1020

agaatgcagc ggagagagag gcgaatgata agaaagtcag aagaaccatt tcgtccttcc1080

atccgtccat ccctccatcg ccaatgacat aagaaaaccc cgggcaagag aaaaagaaga1140

gttaaaatga agagatactg gaacgaaagt gtaggaaggg atcaatcaat cactcaatca1200

ctcattcttc tctttcgaat tcgacccgaa acccaacaac gccaacggac ccctctcgcc1260

gcgctgctca cgctcctgca tgcgctgctc cttcgctcga cgacgttcct ccttatactt1320

ctcccaggag acgttcgcat cgtagcccat gacctcgcca ttattcttct cagcctggaa1380

tttaaggaag tggcttagag aggtctcctc gtcatgaggc gtcctcacgg cctgaggtaa1440

cggacggacg gcatcttcac cggcatacgc acggagtccg gtatggaagg cccattcgac1500

ggcctcttcg acgggcttgt cgaataggta ggggaggaaa ggcacgacgg agagaccgag1560

ctagcaagta gtaatttgca tgtgttagcg gaataattct ataccgcaag cggagaaaca1620

gaactcaccc cgataggcgc ccaagtacgg aaaaagacac tccgggaatt cttcaacatg1680

cgcccagagt acttgaccac cgagtggatg gtaaaggccg gaagacccat actggcgata1740

ccctggaaca cggcgcgctg ggccatgacg gtgcggtagt cttcagctag ggggacgtga1800

gtcgtgggcc atggcatcag cgtatcgctg ctgctactgc ctgttaacga gccggcgatg1860

ttgccggtta ccatgccctt ggcgacttgc tcgtgggtaa ggtcgctggc atctttgtag1920

gcctcgcagg 1930

<210>6

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

gagagtccag aaccggtgac 20

<210>7

<211>45

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gaggcggcgg attttaattg attcgaatgg ttgggtaaca atagc 45

<210>8

<211>45

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

gctattgtta cccaaccatt cgaatcaatt aaaatccgcc gcctc 45

<210>9

<211>52

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

catggtttat aggagaaata ctgatgggct cgagtggaga tgtggagtgg gc 52

<210>10

<211>52

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

gcccactcca catctccact cgagcccatc agtatttctc ctataaacca tg 52

<210>11

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

cctgcgaggc ctacaaagat 20

<210>12

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

cgctctgtcc attcatttca gc 22

<210>13

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

atggcaacat caacaacgct 20

Claims (6)

1. An Aspergillus niger genetically engineered bacterium for producing xylanase is characterized in that the strain is Aspergillus niger SJ1 with Msb2 gene inactivated, the Aspergillus niger SJ1 is preserved in China center for type culture collection (CCTCC NO: M2019115) in 2019, 02 and 28 days;

the nucleotide sequence of the Msb2 gene is shown as SEQ ID NO.1, and the nucleotide sequence of the inactivated Msb2 gene is shown as SEQ ID NO. 2.

2. The method for constructing the xylanase producing aspergillus niger genetically engineered bacteria of claim 1, which is characterized by comprising the following steps:

(1) extracting an Aspergillus niger SJ1 genome;

(2) constructing a gene knockout fragment delta Msb2, wherein the nucleotide sequence of the gene knockout fragment is shown as SEQ ID NO. 3;

(3) preparing an Aspergillus niger protoplast;

(4) and (3) introducing the gene knockout segment into a protoplast for homologous recombination to obtain the Msb2 gene inactivated Aspergillus niger genetically engineered bacterium.

3. Use of a xylanase producing Aspergillus niger genetically engineered bacterium of claim 1 in the preparation of xylanase.

4. Use according to claim 3, characterized in that it comprises the following steps: aspergillus niger genetically engineered bacteria for producing xylan are used as a fermentation microbial inoculum, porous fiber materials are used as an immobilized carrier, and xylanase is prepared by fermentation, wherein the immobilized carrier is polyurethane.

5. The use according to claim 4, wherein the immobilization carrier is pretreated by:

soaking the immobilized carrier in 0.5-2M NaOH for 30min-2h, washing with water until the pH value is neutral, soaking in 0.5-2M HCl for 30min-2h, washing with water until the pH value is neutral, and drying to obtain the pretreated immobilized carrier.

6. The use according to claim 4, wherein the fermentation is carried out under the following conditions:

the fermentation medium is xylan 10-70 g/L, NaNO₃2~6 g/L、KH₂PO₄0.3~2 g/L、MgSO₄·7H₂0.1-0.8 g/L of O and 800.1-0.8 g/L of Tween-and is prepared by bran extract;

the bran leachate is prepared by the following method: weighing 15-60 g/L bran, adding 800mL water, boiling for 30min-2h, filtering to obtain filtrate, and diluting to a constant volume of 1L with water;

the fermentation conditions were as follows: culturing at 28-32 ℃ and 150-300 r/min for 3-6 days.

Images