CN104975039B - A kind of recombinant plasmid and its application in degraded cellulose raw material - Google Patents
A kind of recombinant plasmid and its application in degraded cellulose raw material Download PDFInfo
- Publication number
- CN104975039B CN104975039B CN201510354619.7A CN201510354619A CN104975039B CN 104975039 B CN104975039 B CN 104975039B CN 201510354619 A CN201510354619 A CN 201510354619A CN 104975039 B CN104975039 B CN 104975039B
- Authority
- CN
- China
- Prior art keywords
- application
- trichoderma reesei
- culture
- enzyme
- hph
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The present invention relates to a kind of recombinant plasmid and its application in degraded cellulose raw material.PUG6 plasmids are cut into linear plasmid using NotI enzymes, then encoding gene (Glucosidase) and terminator (Terminator), the encoding gene segment (HPH) of the hygromix phosphotransferase and trichoderma reesei xylan solution enzyme II terminators (XYN2downstream) of the trichoderma reesei xylan solution enzyme II promoters (XYN2upstream) of PCR amplification acquisition, β glucuroides are connected with above-mentioned linear plasmid successively, recombinant plasmid PUG6 XYN2 GLU HPH is made.The present invention constructs the recombinant plasmid for the beta glucuroides that can express high enzyme activity first, and the high enzyme activity beta glucuroides of the expression of recombinant plasmid can improve the efficiency of cellulose degraded lignocellulosic.
Description
Technical field
The present invention relates to a kind of recombinant plasmid and its application in degraded cellulose raw material, belongs to biotechnology technology neck
Domain.
Background technology
At present, due to the agricultural wastes such as the increasingly depleted of oil, maize straw, straw and bagasse change into crude oil can
The research and development for substituting liquid fuel (particularly bio-ethanol) production technology are paid much attention to.The technique, first using hydro-thermal process
The physico-chemical processes such as method, diluted a cid method, SPORL methods handle stalk, then digest pretreated raw material with cellulase preparation,
Fermentability monose is changed into, then adds the microbial fermentations such as yeast, clostridium into the liquid fuel such as ethanol, butanol/chemical industry production
Product.
However, commercially available enzyme preparation is largely fermented and is obtained from trichoderma reesei, beta- glucosides in enzyme system composition
Enzymatic activity is relatively low, causes enzymolysis process to produce more cellobiose, hinders effective degraded of cellulose, causes monose to convert
Rate is relatively low.Meanwhile yeast cannot utilize cellobiose, therefore cause final alcohol fermentation yield also not high.
Chinese patent literature CN102787104A (application number 201210260079.2) discloses a kind of compound fibre of high activity
The plain enzyme of dimension and its preparation and the application process in wood fibre enzymatic saccharification.Shaking flask is carried out using Java penicillium ZN-205
Fermentation production beta-glucosidase, optimal condition of enzyme production：Initial pH is 6.0, and peptone concentration 0.75%, microcrystalline cellulose is dense
Spend for 2.5%, the additive amount of Tween-80 is 0.05%, and cultivation temperature is 28 DEG C, and 250ml triangular flasks liquid amount is 100ml, is shaken
Bed rotating speed is 175r/min, inoculum concentration 5%；Highest beta-glucosidase enzyme activity is 2.312IU/ml.By Java penicillium ZN-
The beta-glucosidase of 205 productions and the cellulase progress enzyme system that trichoderma reesei Rut C-30 are produced are compound, obtain optimal
Beta-glucosidase enzyme activity/filter paper enzyme activity ratio is 1.4.This application needs to carry out production enzyme liquid using two kinds of different microorganisms,
Then it is compound to carry out enzyme system.It is unfavorable for industrialized production.
Chinese patent literature CN102286446A (application number 201110162149.6) discloses one kind and gives up for corncob
Slag conversion prepares the complex enzyme of monose, it includes：Cellulase 10~48FPU/g substrates, pectase 0~17.2IU/g substrates,
Surfactant 0~1% (v/v).The invention is cooperateed with using the compounding of separate sources cellulase and its with surfactant
Effect, reduces the conversion coefficient used enzyme cost, substantially increase corn cob residue in production, up to 74.8%.
Chinese patent literature CN102071223A (application number 200910172724.3) discloses a kind of stalk raw materials
Complex enzyme hydrolysis method, stalk raw materials first through dilute acid hydrolysis lignin degrading, then add zytase, cellulase, starch
Enzyme, pectase and 1,4 beta-glucanase, are 4.3~5.5 with acidic materials or alkaline matter adjustment mixture pH, then 40~
24~72h of enzymolysis is carried out at 55 DEG C.The present invention makes stalk enzymolysis be converted into reduced sugar using the method for complex enzyme, and selection is suitable
Enzyme ratio so that between enzyme produce interaction so that hydrolysis reach maximization, digest the concentration of reduced sugar of generation
Height, obtains sugared rate height, enzymatic hydrolysis condition is gentle, has no adverse effects to later stage fermentation, will not suppress the growth of later stage fermentation, fermentation
When ethanol production it is high.But above-mentioned technical proposal is needed several enzyme preparation zytases, cellulase, amylase, pectase
Enzyme system compounding is carried out with 1,4 beta-glucanase.
At present, prepare cellulase and hemicellulase is often produced using filamentous fungi, and transform filamentous fungi
Industrial strain, which improves cellulase and the method for hemicellulase enzyme activity, mutation breeding technologies, Protoplast Fusion Technique, base
Because of reordering technique etc..
The content of the invention
Answering in view of the deficiencies of the prior art, the present invention provides a kind of recombinant plasmid and its in degraded cellulose raw material
With.By transforming filamentous fungi industrial strain, beta- glucuroide enzymatic activitys in enzyme system are improved, improve the component of enzyme system, from
And improve the method that lignocellulosic prepares can ferment monose and ethanol production.
Technical solution of the present invention is as follows：
A kind of recombinant plasmid PUG6-XYN2-GLU-HPH, it is characterised in that be cut into pUG6 plasmids linearly using NotI enzymes
Plasmid, the trichoderma reesei xylan solution enzyme II promoters (XYN2upstream) for then obtaining PCR amplification, beta-glucosidase
Encoding gene (Glucosidase) and terminator (Terminator), the encoding gene segment of hygromix phosphotransferase
(HPH) it is connected, is made with above-mentioned linear plasmid successively with trichoderma reesei xylan solution enzyme II terminators (XYN2downstream)
Recombinant plasmid PUG6-XYN2-GLU-HPH (as shown in Figure 1)；
The encoding gene nucleotide sequence (Glucosidase) of the beta-glucosidase as shown in SEQ ID NO.1, its
Terminator (Terminator) is as shown in SEQ ID NO.5；The nucleotide sequence of trichoderma reesei xylan solution enzyme II promoters
(XYN2upstream) as shown in SEQ ID NO.2；The nucleotide sequence of trichoderma reesei xylan solution enzyme II terminators
(XYN2downstream) as shown in SEQ ID NO.3；The nucleotide sequence (HPH) of the encoding gene of hygromix phosphotransferase
As shown in SEQ ID NO.4.
Preferable according to the present invention, the connection uses the In-Fusion PCR Cloning kits of Clotech companies
Carry out.
Preferable according to the present invention, described recombinant plasmid PUG6-XYN2-GLU-HPH nucleotide sequences such as SEQ ID
Shown in NO.6.
One plant of recombination engineering, using trichoderma reesei (Trichoderma reesei) QM9414 or its strain that makes a variation to be original
Bacterium, is made after inverted above-mentioned recombinant plasmid PUG6-XYN2-GLU-HPH.
Preferable according to the present invention, trichoderma reesei (Trichoderma reesei) QM9414 derives from US mode
Culture collection warehousing (ATCC), culture presevation ATCC 26921.
Application of the above-mentioned recombination engineering in degraded cellulose raw material.
Preferable according to the present invention, described being degraded to prepares cellulase hydrolysis using above-mentioned recombination engineering after culture
Liquid, then handles cellulosic material using cellulase hydrolyte.
According to the present invention it is further preferred that the cellulase hydrolyte, prepares as follows：
(1) above-mentioned recombination engineering is taken, is inoculated in seed culture medium, after seed culture, seed liquor is made；
(2) seed liquor made from step (1) is inoculated in culture medium, fermented culture, zymotic fluid is made；
The culture medium, component is as follows, is weight percentage：
Maize cob meal 1.0~3.0%, peptone 0.5~2.0%, wheat bran 1.0~4.0%, microcrystalline cellulose 0~
1.0%, sodium nitrate 0~1.0%, ammonium sulfate 0.1~0.5%, potassium dihydrogen phosphate 0.1~0.5%, magnesium sulfate 0.04~0.1%,
Urea 0~0.4%, Tween 80 0~0.4%, excess water；
(3) zymotic fluid made from step (2) is taken supernatant, cellulase hydrolyte is made through separation of solid and liquid.
Seed culture medium in the step (1), component is as follows, is weight percentage：
Glucose 0.5~2.0%, peptone 0.5~2.0%, wheat bran 1.0~4.0%, sodium nitrate 0~1.0%, sulfuric acid
Ammonium 0.1~0.5%, potassium dihydrogen phosphate 0.1~0.5%, magnesium sulfate 0.04~0.1%, urea 0~0.4%, excess water.
In the step (1), seed culture condition is：Under conditions of 25~32 DEG C, when culture 20~30 is small.
In the step (2), it is inoculated with the ratio of percent by volume 5~10%.
In the step (2), fermentation culture conditions are：Under conditions of 25~30 DEG C, cultivate 5~7 days.
In the step (3), separation of solid and liquid is centrifugation, and condition centrifuges 12~18min for 10000~15000r/min.
According to the present invention it is further preferred that described the step of handling cellulosic material using cellulase hydrolyte is as follows：
(i) pre-treatment is carried out to the biomass material of containing cellulose, it is dense eventually by 15~25% (mass percent) solid contents
Degree is mixed the biomass material after pre-treatment and water, then adjusts pH value range to 5.0~6.0, then by every gram of over dry
The ratio addition cellulase hydrolyte of 8~15FPU of biomass material addition, 32~40h of oscillating reactions at a temperature of 45~50 DEG C,
Through separation of solid and liquid, hydrolyzate is made；
(ii) hydrolyzate made from step (i) is taken, thermotolerant yeast is inoculated with according to the ratio of mass percent 1~5%, 28
When~32 DEG C of progress anaerobic fermentation cultures 45~50 are small, purified separation, is made ethanol.
In the step (i), pre-treatment is acid treatment, alkali process, hydro-thermal process, subcritical water are handled, Crushing of Ultrafine is handled,
Boiling processing, drying process, sulphite processing, hydro-thermal process；It is preferred that sulphite processing, hydro-thermal process, at dilute sulfuric acid
Reason.
In the step (i), separation of solid and liquid centrifuges condition and centrifuges 30min for 8000rpm to centrifuge.
In the step (ii), purifies and separates are separated.
FPU refers to filter paper enzyme activity unit of force.50mg filter paper (making standard curve with glucose) is added into test tube,
1.5ml acetate buffer solutions (50mM, pH4.8), add 0.5ml enzyme liquids, 50 DEG C of water-bath 60min, and the rear 2.5ml DNS that add are terminated instead
Should, boil after ten minutes, constant volume to 25ml, shakes up rear OD540Measure absorbance.Interception discharges 2.0mg glucose in 60min
The reduced sugar (conversion ratio 4%) of equivalent calculates filter paper enzyme activity (FPA), and unit is represented with FPU.
Beneficial effect
1st, the present invention constructs the recombinant plasmid for the beta- glucuroides that can express high enzyme activity, the restructuring matter first
The high enzyme activity beta- glucuroides of grain expression can improve the efficiency of cellulose degraded lignocellulosic.
2nd, the recombinant plasmid of the beta- glucuroides for the high enzyme activity for building the present invention imports filamentous fungus T. reesei
In (Trichoderma reesei) QM9414 (ATCC26921), beta- glucuroide enzymatic activitys can be effectively improved, are changed
The component of kind enzyme system, improves the efficiency and ethanol production of cellulose degraded lignocellulosic.
Brief description of the drawings
Fig. 1 is the structure figure of trichoderma reesei recombinant expression carrier PUG6-XYN2-GLU-HPH；
Wherein：XYN2upstream is promoter；Glucosidase is the beta-glucosidase expression of enzymes from aspergillus niger
Gene；Terminator and XYN2downstream is terminator；HPH is hygromycin gene selection markers box；BamHI、
HindIII, BglII and NotI are restriction enzyme site；
Embodiment
Technical scheme is further elaborated below by embodiment, it should explanation, it is of the invention
Protection domain is not limited only to this.
Biological material source
Trichoderma reesei (Trichoderma reesei) QM6a is purchased from Unite States Standard biology product collection, culture presevation number
ATCC No.13631；
Trichoderma reesei (Trichoderma reesei) QM9414 is purchased from Unite States Standard biology product collection, culture presevation
Number ATCC No.26921
PET-32A plasmid vectors are purchased from Novagen companies.
Embodiment 1
Fungal cellulase enzyme activity controlling gene knocks out the acquisition of box：
(1) extraction of trichoderma reesei QM6a and aspergillus niger total serum IgE：
Trichoderma reesei QM6a and Aspergillus niger strain are cultivated 2 days in the MM culture mediums added with 2wt% microcrystalline celluloses, with filter
Mycelia is collected by filtration in paper.The mycelia of collection is put into the mortar of precooling and is ground, wherein adding liquid nitrogen during grinding.By what is be ground into
Mycelia powder is moved in 1.5ml centrifuge tubes, and add 1ml RNAiso (being purchased from Sheng Gong bioengineering Co., Ltd B6402-1) in
Shaken uniformly in oscillator, room temperature puts 5min.Then 12000rpm centrifuges 10min.Then by supernatant be drawn onto clean 1.5ml from
In heart pipe.Then 160 μ l chloroforms are added, concussion 15s is mixed, and room temperature places 5min, 12000rpm, 4 degree of centrifugation 5min.Then inhale
Supernatant is to new 1.5ml centrifuge tubes.Then 800 μ l isopropanols are added, are turned upside down 5 times.Room temperature places 10min,
12000rpm, 4 degree of centrifugation 10min, abandons supernatant.The 75% ethanol cleaning RNA of 1ml precoolings is added, 7500rpm is centrifuged after concussion
5min.The 50 processed water of μ l DEPC are added, dissolve RNA.
MM nutrient media componentses are as follows：Ammonium sulfate 3g, potassium dihydrogen phosphate 4.5g, magnesium sulfate 0.18g, calcium chloride dihydrate 0.24g
Urea 1.5g, 1000 × trace element (green-vitriol 5g/L, manganese sulfate monohydrate 1.6g/L, white vitriol 1.4g/L, chlorination
Cobalt 2g/L) 30 μ l, 300ml is supplied with water.
(2) clone of encoding gene total serum IgE：
Using trichoderma reesei QM6a and aspergillus niger total serum IgE as template, (takara reverse transcriptions are purchased from using reverse transcription synthesis cDNA
Kit BK1201)：
1. the removal reaction of genomic DNA
Reaction solution is prepared in the following proportions：
Above-mentioned reaction solution is reacted into 2min under the conditions of 42 degree, RNA solution is made.
2. reverse transcription reaction：
Reaction solution is prepared in the following proportions：
Above-mentioned reaction solution is reacted into 15min at 37 DEG C, then reacts 5s at 85 DEG C.Amplify bgl genes.
PCR reactions carry out in 50 μ l systems：2 × PCR Buffer, 25 μ l, 2mM dNTPs 10 μ l, 1.5 μ l of primer,
1 μ l, KOD FX polymerases of template DNA, 1 μ l, add distilled water to supply to 50 μ l.
The primer sequence is as follows：
The primer of SEQ ID NO.1：
Sense primer：ccgctcgagatgaggttcactttgatcga
Anti-sense primer：cccaagcttttagtgaacagtaggcagag
The primer of SEQ ID NO.2：
Sense primer：ccagtacttgctcgtgtcaatctcc
Anti-sense primer：aagcggccgcttggatcccggttgatgtcttcttgcttcagctagtagg
The primer of SEQ ID NO.3：
Sense primer：tgacactatagaacgcgcactctttgccttgtcctgtttgaca
Anti-sense primer：cggcagatccgcggccacagatgccaggttcgatcctcacca
The primer of SEQ ID NO.4：
Sense primer：ggaagatctggccgcgacgttaactgatattgaagg
Anti-sense primer：aaagggcccaacccaggggctggtgacg
The primer of SEQ ID NO.5：
Sense primer：cccaagcttgatgccgaccggatcgatccact
Anti-sense primer：ggaagatctaacccaggggctggtgacg
PCR response procedures are as follows：
94 DEG C of pre-degeneration 2min；98 DEG C of denaturation 10s, 60 DEG C of annealing 30s, 68 DEG C of extension 90s, 35 circulate；68 DEG C of extensions
10min。
Expand to obtain PCR fragment respectively using above-mentioned five pairs of primers, carry out gel extraction, obtain the DNA fragmentation of recycling；Through
Detection, nucleotide sequence is respectively as shown in SEQ ID NO.1~5；
(2) gene order of the trichoderma reesei xylan solution enzyme II promoters (xyn2) comprising secretion peptide sequence will be obtained
(SEQ ID NO.2)；The gene order (SEQ ID NO.3) of trichoderma reesei xylan solution enzyme II terminators (xyn2)；Hygromycin
The gene order (SEQ ID NO.4) of phosphotransferase；Gene order (the SEQ ID of the beta-glucosidase of Aspergillus niger origin
NO.1), its terminator (Terminator) is as shown in SEQ ID NO.5.
PUG6 plasmids are cut into linear plasmid using NotI enzymes, the trichoderma reesei xylan solution for then obtaining PCR amplification
The encoding gene (Glucosidase) and terminator of enzyme II promoters (XYN2upstream), beta-glucosidase
(Terminator), the encoding gene segment (HPH) of hygromix phosphotransferase and trichoderma reesei xylan solution enzyme II terminators
(XYN2downstream) using Clotech companies In-Fusion PCR Cloning kits and above-mentioned linear plasmid into
Row connection, is made recombinant plasmid PUG6-XYN2-GLU-HPH (as shown in Figure 1), nucleotide sequence is as shown in SEQ ID NO.6；
The PCR increases expansion, digestion with restriction enzyme is all this area Normal practice.
(3) Li's Trichoderma strains are converted
Li's Trichoderma strains are cultivated three days on bran mass, using physiological saline, lower spore are eluted, in wheat bran bran
One glassine paper of skin culture medium upper cover, and 100 μ l spore suspensions are added in the above, coating is uniform, and 30 DEG C of culture about 25h, are made
With the glassine paper for sprouting spore.
0.1g lyases (being purchased from sigma companies, trade name sigma#L-1412) is added to arrive (the 1.2M sorbs of 20ml solution 1
Alcohol, 0.1M KH2PO4) in, gently shake；2~3ml enzyme liquids are drawn into sterile petri dish, add one layer with the glass for sprouting spore
Glass paper, then add 2~3ml enzyme liquids, 10 layers are stacked successively.Culture dish holding is in 30 DEG C of incubators.After digesting about 90min, tweezer is used
Sub (sterile) picking glassine paper, remaining mycelium on glassine paper is washed out with liquid-transfering gun draw solution, is filtered with mineral wool funnel
Then protoplast suspension rinses mineral wool, then 2000rpm into the 50ml centrifuge tubes being placed on ice with several milliliters of solution 1,
4 DEG C of centrifugation 10min, remove supernatant and with 4ml solution 2 (1M sorbierites, 50mmol/L CaCl2, 10mmol/L TrisHCl)
Protoplast is resuspended, 2000rpm, 4 DEG C of centrifugation 10min, remove supernatant, with (4 DEG C) the resuspension plasms of 0.5~1.0ml solution 2
Body, places protoplast on ice, protoplast suspension is made.
By transformation system (200 μ l protoplast suspensions, 10 μ l purifying pE, 50 μ l molecular weight polyethylene glycols (5000-
7000) 20min) is placed on ice, adds 2ml PEG (room temperature) afterwards, gently mixes, 20 DEG C of placement 5min, add 4ml solution 2, mix
It is even；In the upper strata culture medium for drawing 0.2~1ml to 4ml pre-incubations, gently mix, be poured on down the tablet for being covered with lower floor's culture medium
On, after waiting culture medium to solidify, put 30 DEG C of cultures.After cultivating 3~4d on screening and culturing medium, with transfer needle picking transformant to choosing
Culture medium is selected, cultivates raw spore.
(cultivated 3 days) after passing for two generations, spore is transferred in minimal medium, after extraction chromosome is verified, become
Different bacterial strain.
Embodiment 2
The preparation of cellulase and hemicellulase and measure：
Trichoderma reesei (Trichoderma reesei) QM9414 and dissociant are taken, is inoculated in seed culture medium,
Cultivate 1 day, then transfer by 10% volume ratio in culture medium, in 28 DEG C, the condition of 180rpm under conditions of 30 DEG C
Lower fermented and cultured 6 days, is made microbial culture medium.Nutrient solution 12000r/min is centrifuged into 15min, Aspirate supernatant is thick enzyme
Liquid.
Above-mentioned seed culture medium component is as follows, is weight percentage：
Glucose 1%, peptone 1%, wheat bran 1%, sodium nitrate 0.1%, ammonium sulfate 0.1%, potassium dihydrogen phosphate 0.1%,
Magnesium sulfate 0.04%, urea 0.15%, excess water.
Above-mentioned culture medium component is as follows, is weight percentage：
Maize cob meal 3%, peptone 1%, wheat bran 3%, microcrystalline cellulose 0.4%, sodium nitrate 0.1%, ammonium sulfate
0.1%, potassium dihydrogen phosphate 0.1%, magnesium sulfate 0.04%, urea 0.15%, Tween 80 0.2%, excess water.
Extracellular protein content：In 5ml centrifuge tubes add 0.1ml dilution after sample (using 0.1ml pure water as compare,
Standard curve is made with bovine serum albumin).Add the 1mol/L NaOH solutions of 0.2ml.Add the first reagent (2% of 2ml
NaCO3:0.5%CuSO4：1% sodium potassium tartrate tetrahydrate (KNa4H2O)=50：1：1), place at room temperature about 10 minutes.10 minutes anti-
Should after, add the second reagent (Folin phenol reagents+isometric pure water) of 0.3ml.Place at room temperature about 30 minutes.660nm
Absorbance is measured under wavelength.
Filter paper enzyme activity：50mg filter paper (making standard curve with glucose), 1.5ml acetate buffer solutions are added into test tube
(50mM, pH4.8), adds 0.5ml enzyme liquids, 50 DEG C of water-bath 60min, and the rear 2.5ml DNS that add terminate reaction, boil 10 minutes
Afterwards, constant volume shakes up rear OD to 25ml540Measure absorbance.Intercept the reduced sugar in 60min release 2.0mg glucose equivalents
(conversion ratio 4%) calculates filter paper enzyme activity (FPA), and unit is represented with FPU.
Other enzyme activity units in crude enzyme liquid produce 1 μm of ol reduced sugar or p-nitrophenol to hydrolyze substrate in one minute
Required enzyme amount is defined as 1 enzyme activity unit (IU).
Assay method is as follows：
Xylanase activity：The oat xylan suspension of 1mL 1%, the enzyme liquid after 0.5mL dilutions, 50 DEG C of enzymolysis 30min.
Endo-glucanase enzyme activity：The CMC-Na solution of 1mL 1%, the enzyme liquid after 0.5mL dilutions, 50 DEG C of enzymolysis 30min.
In both the above enzyme activity determination, the reduction sugar amount in enzymolysis liquid is measured with DNS methods.
Beta- glucuroides or exoglucanase enzyme activity：Crude enzyme liquid after 0.5mL dilutions, adds 50 μ L pNPG
Or pNPC (1mg/mL), 50 DEG C of insulation 30min；Add 150 μ L 10%Na2CO3Terminate reaction.
Experimental result is as shown in table 1.The change of extracellular protein content and filter paper enzyme activity is little, and endoglucanase and wood gather
Carbohydrase enzyme activity has declined, but beta- glucuroides and exoglucanase enzyme activity increase substantially.
After 1 embodiment Spawn incubation of table in zymotic fluid various enzyme activity comparison
Embodiment 3
1) preparation method (hydro-thermal process) of pretreated maize straw
By maize straw (containing cellulose 10wt%) dipping in water, stir while carrying out 120 minutes height at 190 DEG C
Kettle processing is pressed, material previously treated is obtained through solid/liquid separation after high-concentration paste mill mechanical treatment.
2) preparation method (dilute acid pretreatment) of pretreated wheat stalk
Wheat stalk (containing cellulose 10wt%) is immersed in the sulfuric acid solution of 1wt%, is stirred while at 180 DEG C
Carry out 20 minutes autoclave process.
3) preparation method (sulphite processing) of pretreated rice straw
Rice straw (containing cellulose 10wt%) is immersed in the sulfurous acid or sulfurous acid ammonia sodium solution of 2wt%, while stirring
Mix while 30 minutes autoclave process are carried out at 160 DEG C, through the pre- place of solid/liquid separation acquisition after high-concentration paste mill mechanical treatment
Manage material.Above-mentioned processing for details, reference can be made to《Disulfate pre-processes the influence to Factor of Enzymolysis Corn Stalk》(Liu Yunyun, Wang Gao
Rise, the general spring just, Liu Zhiya,《Chemistry of forest product and industry》, the 4th phase of volume 30,73-77 pages).
As the pre-treating method of stalk, above-mentioned three kinds of processing methods are not limited to, can also be used：Acid treatment, alkali process,
Subcritical water processing, Crushing of Ultrafine processing, boiling processing, drying process etc.；Wherein, sulphite processing, hydro-thermal process, dilute sulfuric acid
Processing or alkali process, compared with other methods, enzymatic conversion efficiency is excellent, enzyme usage amount is less to complete, thus in the present invention
In preferably sulphite processing, hydro-thermal process, dilute sulfuric acid handle.
Embodiment 4
(i) 8 mass parts microcrystalline celluloses, pretreated maize straw, pretreated wheat stalk or pre- place are taken
Rice straw after reason, it is 4.8 to be added to 89 parts of pH, and ionic strength is in the NaAc_HAc buffer solution of 50mmol/L, adds 3
The cellulase of mass parts oscillating reactions 36h at a temperature of 45-50 DEG C.After reaction, separation of solid and liquid (8000rpm, 30min
Centrifugation), saccharide compound hydrolyzate is obtained, passes through hplc determination glucose content；
(ii) 0.01 mass parts thermotolerant yeast is accessed into hydrolyzate made from step (i), in 30 DEG C of quiescent cultures, into
When row alcohol fermentation 48 is small, then separated through distillation purifying, ethanol is made, passes through hplc determination glucose content.
Experimental result is as shown in table 2 and table 3.With microcrystalline cellulose, pretreated maize straw, pretreated wheat
Stalk or pretreated rice straw are substrate, and the glucose yield obtained after genetic engineering transformation is respectively increased before relatively transforming
99%th, 76%.Add alcohol getting rate after yeast ferments and be respectively increased 105%, 69% before relatively transforming.Although improved enzyme liquid
Xylanase activity has declined (table 1), but it was found from table 2 to the result of table 7, the yield of xylose is not affected.
The comparison of 2 hydro-thermal process saccharification yield of table
The comparison of fermenting alcohol yield after the saccharification of 3 hydro-thermal process of table
The comparison of 4 dilute acid pretreatment saccharification yield of table
The comparison of fermenting alcohol yield after the saccharification of 5 dilute acid pretreatment of table
6 sulphite of table handles the comparison of saccharification yield
The comparison of fermenting alcohol yield after the processing saccharification of 7 sulphite of table
Above-described embodiment is the preferable embodiment of the present invention, but embodiments of the present invention and from above-described embodiment
Limitation, other any Spirit Essences without departing from the present invention with made under principle change, modification, replacement, combine, simplification,
Equivalent substitute mode is should be, is included within protection scope of the present invention.
Claims (15)
1. application of one plant of recombination engineering in degraded cellulose raw material；
The recombination engineering is with trichoderma reesei（Trichoderma reesei）QM9414 or its strain that makes a variation are original bacteria, warp
It is made after converting recombinant plasmid PUG6-XYN2-GLU-HPH；
The recombinant plasmid PUG6-XYN2-GLU-HPH is prepared as follows：PUG6 plasmids are cut into linearly using NotI enzymes
Plasmid, the trichoderma reesei xylan solution enzyme II promoters for then obtaining PCR amplification（XYN2upstream）, beta-glucosidase
The encoding gene (Glucosidase) and terminator of enzyme（Terminator）, hygromix phosphotransferase encoding gene piece
Section（HPH）With trichoderma reesei xylan solution enzyme II terminators（XYN2downstream）It is connected, makes with above-mentioned linear plasmid successively
Obtain recombinant plasmid PUG6-XYN2-GLU-HPH；
As shown in SEQ ID NO.1, it is terminated the encoding gene nucleotide sequence (Glucosidase) of the beta-glucosidase
Son（Terminator）As shown in SEQ ID NO.5；The nucleotide sequence of trichoderma reesei xylan solution enzyme II promoters
（XYN2upstream）As shown in SEQ ID NO.2；The nucleotide sequence of trichoderma reesei xylan solution enzyme II terminators
（XYN2downstream）As shown in SEQ ID NO.3；The nucleotide sequence of the encoding gene of hygromix phosphotransferase（HPH）
As shown in SEQ ID NO.4.
2. application as claimed in claim 1, it is characterised in that the trichoderma reesei（Trichoderma reesei）QM9414
From American Type Culture collection warehousing, culture presevation ATCC 26921.
3. application as claimed in claim 1, it is characterised in that the nucleotide sequence of recombinant plasmid PUG6-XYN2-GLU-HPH is such as
Shown in SEQ ID NO.6.
4. application as claimed in claim 1, it is characterised in that described is degraded to using above-mentioned recombination engineering after culture
Cellulase hydrolyte is prepared, then handles cellulosic material using cellulase hydrolyte.
5. application as claimed in claim 4, it is characterised in that the cellulase hydrolyte, prepares as follows：
（1）Above-mentioned recombination engineering is taken, is inoculated in seed culture medium, after seed culture, seed liquor is made；
（2）By step（1）Obtained seed liquor is inoculated in culture medium, fermented culture, and zymotic fluid is made；
The culture medium, component is as follows, is weight percentage：
Maize cob meal 1.0~3.0%, peptone 0.5~2.0%, wheat bran 1.0~4.0%, microcrystalline cellulose 0~1.0%, sodium nitrate 0
~1.0%, ammonium sulfate 0.1~0.5%, potassium dihydrogen phosphate 0.1~0.5%, magnesium sulfate 0.04~0.1%, urea 0~0.4%, tween
80 0~0.4%, excess water；
（3）By step（2）Obtained zymotic fluid takes supernatant, cellulase hydrolyte is made through separation of solid and liquid.
6. application as claimed in claim 5, it is characterised in that the step（1）In seed culture medium, component is as follows,
It is weight percentage：
Glucose 0.5~2.0%, peptone 0.5~2.0%, wheat bran 1.0~4.0%, sodium nitrate 0~1.0%, ammonium sulfate 0.1~
0.5%, potassium dihydrogen phosphate 0.1~0.5%, magnesium sulfate 0.04~0.1%, urea 0~0.4%, excess water.
7. application as claimed in claim 5, it is characterised in that the step（1）In, seed culture condition is：25~32
Under conditions of DEG C, when culture 20~30 is small.
8. application as claimed in claim 5, it is characterised in that the step（2）In, in the ratio of percent by volume 5~10%
It is inoculated with.
9. application as claimed in claim 5, it is characterised in that the step（2）In, fermentation culture conditions are：25~30
Under conditions of DEG C, cultivate 5~7 days.
10. application as claimed in claim 5, it is characterised in that the step（3）In, separation of solid and liquid is centrifugation, and condition is
10000~15000 r/min centrifuge 12~18min.
11. application as claimed in claim 4, it is characterised in that described to handle cellulosic material using cellulase hydrolyte
Step is as follows：
（i）Pre-treatment is carried out to the biomass material of containing cellulose, 15~25% solid content final concentrations are by preceding place by mass percentage
Biomass material and water after reason are mixed, and then adjust pH value range to 5.0~6.0, then former by every gram of over dry biomass
The ratio of 8~15 FPU of material addition adds cellulase hydrolyte, 32~40h of oscillating reactions at a temperature of 45~50 DEG C, through solid-liquid
Separation, is made hydrolyzate；
（ii）Take step（i）Obtained hydrolyzate, is inoculated with thermotolerant yeast, 28~32 according to the ratio of mass percent 1~5%
DEG C carry out anaerobic fermentation culture 45~50 it is small when, purified separation, is made ethanol.
12. application as claimed in claim 11, it is characterised in that the step（i）In, pre-treatment for acid treatment, alkali process,
Subcritical water processing, Crushing of Ultrafine processing, boiling processing, drying process, hydro-thermal process.
13. application as claimed in claim 12, it is characterised in that the step（i）In, pre-treatment for sulphite processing,
Hydro-thermal process, dilute sulfuric acid processing.
14. application as claimed in claim 11, it is characterised in that the step（i）In, separation of solid and liquid is centrifugation, from
Heart separation condition centrifuges 30 min for 8000 rpm.
15. application as claimed in claim 11, it is characterised in that the step（ii）In, purifies and separates are separated.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510354619.7A CN104975039B (en) | 2015-06-24 | 2015-06-24 | A kind of recombinant plasmid and its application in degraded cellulose raw material |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510354619.7A CN104975039B (en) | 2015-06-24 | 2015-06-24 | A kind of recombinant plasmid and its application in degraded cellulose raw material |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104975039A CN104975039A (en) | 2015-10-14 |
| CN104975039B true CN104975039B (en) | 2018-05-11 |
Family
ID=54272004
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510354619.7A Active CN104975039B (en) | 2015-06-24 | 2015-06-24 | A kind of recombinant plasmid and its application in degraded cellulose raw material |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104975039B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PL3296401T3 (en) * | 2016-09-20 | 2020-07-27 | Clariant International Ltd | Method for selective carbon source-independent expression of protein-encoding sequences in a filamentous fungus cell |
| CN107012102B (en) * | 2017-01-13 | 2020-06-30 | 东南大学 | Trichoderma reesei genetic engineering bacterium capable of producing cellulase at high yield under induction of soluble and non-soluble carbon sources, and construction method and application thereof |
| CN107058267B (en) * | 2017-03-23 | 2020-12-01 | 山东恒鲁生物科技有限公司 | Modified lignocellulose and application thereof |
| CN109022534B (en) * | 2018-08-01 | 2020-06-30 | 淮阴师范学院 | Method for producing bacterial cellulose membrane by using corn straws and corn straw degradation product fuel cell |
| CN109392831B (en) * | 2018-10-30 | 2021-04-13 | 中国科学院青岛生物能源与过程研究所 | Nutrition enhancer for producing DHA-ARA eggs suitable for infants and application |
| CN112852873B (en) * | 2021-02-04 | 2023-03-24 | 华中农业大学 | Construction method of porcine delta coronavirus infectious clone plasmid |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1836038A (en) * | 2003-05-02 | 2006-09-20 | 诺维信股份有限公司 | Methods for producing secreted polypeptides |
| CN101654680A (en) * | 2009-09-10 | 2010-02-24 | 安徽丰原发酵技术工程研究有限公司 | Preparation method for recombination strains for generating Beta glucosaccharase |
| CN102154344A (en) * | 2011-02-09 | 2011-08-17 | 天津大学 | Gene for coding beta-glucosidase, recombinant expression vector, recombinant saccharomyces cerevisiae expression strain and application |
| CN102399803A (en) * | 2011-09-30 | 2012-04-04 | 南京林业大学 | Improved beta-glucosidase gene and preparation of recombinase thereof |
| CN103571809A (en) * | 2012-07-24 | 2014-02-12 | 中国科学院上海生命科学研究院 | Novel beta-glucosidase, coding gene thereof and applications thereof |
| CN104450651A (en) * | 2014-12-09 | 2015-03-25 | 青岛蔚蓝生物集团有限公司 | Beta-glucosidase mutant and application thereof |
-
2015
- 2015-06-24 CN CN201510354619.7A patent/CN104975039B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1836038A (en) * | 2003-05-02 | 2006-09-20 | 诺维信股份有限公司 | Methods for producing secreted polypeptides |
| CN101654680A (en) * | 2009-09-10 | 2010-02-24 | 安徽丰原发酵技术工程研究有限公司 | Preparation method for recombination strains for generating Beta glucosaccharase |
| CN102154344A (en) * | 2011-02-09 | 2011-08-17 | 天津大学 | Gene for coding beta-glucosidase, recombinant expression vector, recombinant saccharomyces cerevisiae expression strain and application |
| CN102399803A (en) * | 2011-09-30 | 2012-04-04 | 南京林业大学 | Improved beta-glucosidase gene and preparation of recombinase thereof |
| CN103571809A (en) * | 2012-07-24 | 2014-02-12 | 中国科学院上海生命科学研究院 | Novel beta-glucosidase, coding gene thereof and applications thereof |
| CN104450651A (en) * | 2014-12-09 | 2015-03-25 | 青岛蔚蓝生物集团有限公司 | Beta-glucosidase mutant and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104975039A (en) | 2015-10-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104975039B (en) | A kind of recombinant plasmid and its application in degraded cellulose raw material | |
| JP5498642B2 (en) | Method for producing cellulose-degradable and hemicellulose-degradable enzymes using distillation residues from ethanol fermentation of hydrolysates by enzymes of (ligno) cellulose materials | |
| EP2197893B1 (en) | Novel fungal enzymes | |
| US8790894B2 (en) | Mutant cellobiohydrolase | |
| KR20120106774A (en) | Methods for improving the efficiency of simultaneous saccharification and fermentation reactions | |
| JP2010536390A (en) | Method for producing cellulase | |
| Pathania et al. | Utilization of horticultural waste (Apple Pomace) for multiple carbohydrase production from Rhizopus delemar F2 under solid state fermentation | |
| CN105018448B (en) | The heat-resisting acidic cellulase and its gene of a kind of originated from fungus and application | |
| US10457925B2 (en) | Process for the production of cellulolytic and/or hemicellulolytic enzymes | |
| WO2012018691A2 (en) | Novel fungal enzymes | |
| CN107075533A (en) | The method of enzymatic hydrolysis ligno-cellulosic materials and sugar fermentation | |
| CN108048473B (en) | Feruloyl esterase gene, genetic engineering strain, preparation method and application | |
| JP5718899B2 (en) | Changes in enzyme balance depending on fermentation conditions | |
| Fadel et al. | Cellulases and animal feed production by solid-state fermentation by Aspergillus fumigatus NRCF-122 mutant | |
| JP6950873B2 (en) | Mutant strain Aspergillus acreatus for producing cellulase and xylanase and its preparation method | |
| Lin et al. | Ethanol production using the whole solid-state fermented sugarcane bagasse cultivated by Trichoderma reesei RUT-C30 supplemented with commercial cellulase | |
| JP2013544086A (en) | Enzymes and their use | |
| CN107236680B (en) | Pichia pastoris recombinant bacterium for expressing Streptomyces sp.FA1-derived xylanase | |
| CN109554355A (en) | Enhance active polypeptide and its application with cellulose degradation | |
| CN112646797B (en) | Method for heterogeneously expressing stropharia rugoso-annulata beta-glucosidase gene | |
| CN110229795B (en) | Polypeptide with cellulolytic activity enhancing function and encoding gene and application thereof | |
| CN102816752B (en) | Cellobiohydrolase Tccel7A as well as encoding gene and application thereof | |
| CN113544280A (en) | Method for producing a fermentation broth | |
| CN113980939B (en) | Glucose-resistant beta-glucosidase, and expression gene and application thereof | |
| Doelle | Microbial cultures in the utilization of cellulosic materials |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |