CN114426995A

CN114426995A - Method for improving yield of cordyceps militaris extracellular polysaccharide by over-expression of hexokinase gene HK

Info

Publication number: CN114426995A
Application number: CN202210090690.9A
Authority: CN
Inventors: 季小康; 杨胜利; 孔潇慧; 徐晓倩; 徐德; 王逸峰; 张慧
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2022-01-26
Filing date: 2022-01-26
Publication date: 2022-05-03
Anticipated expiration: 2042-01-26
Also published as: CN114426995B

Abstract

The invention discloses a method for improving the yield of cordyceps militaris extracellular polysaccharide by over-expressing hexokinase gene HK, which comprises the steps of inoculating cordyceps militaris genetic engineering bacteria containing the hexokinase gene HK to a fermentation culture medium, performing shaking table fermentation culture at the temperature of 22-25 ℃ and the rpm of 120-180 to obtain fermentation liquor containing the cordyceps militaris extracellular polysaccharide, and separating and purifying the fermentation liquor to obtain the cordyceps militaris extracellular polysaccharide. The invention obtains the stable genetic recombinant Cordyceps militaris genetic engineering bacteria through the overexpression construction of the genetic engineering technology, compared with a wild strain, the yield of extracellular polysaccharide of Cordyceps militaris in fermentation liquor of the genetic engineering bacteria is 1.61 times, and compared with the wild strain, the yield of extracellular polysaccharide in the fermentation liquor of the mutant strain which also overexpresses mannose-1-uridine phosphate transferase gene MPG is 0.91 times, thus laying a foundation for further screening of excellent Cordyceps militaris varieties.

Description

Method for improving yield of cordyceps militaris extracellular polysaccharide by over-expression of hexokinase gene HK

(I) technical field

The invention belongs to the field of cordyceps militaris cultivation, and particularly relates to a method for improving the yield of extracellular polysaccharide of cordyceps militaris by using an over-expression hexokinase gene HK.

(II) background of the invention

Cordyceps militaris (cordyces militaris), also known as Cordyceps militaris, is a model species of Cordyceps, and has been artificially cultured in large scale. Cordyceps militaris has various natural active ingredients, such as cordycepin, mannitol, cordyceps polysaccharide and the like, and has high medicinal value. Cordyceps sinensis polysaccharide is one of main effective components in Cordyceps militaris, pure product is white flocculent powder, is easy to dissolve in water, and has multiple important biological activities such as antioxidation, antitumor, antibacterial, anti-inflammatory, blood sugar lowering, immunoregulation and kidney protection, so the Cordyceps sinensis polysaccharide has a higher application prospect in medicine production. However, due to environmental restrictions, the yield of wild or naturally cultured Cordyceps militaris cannot meet the production requirements, and thus it is important to increase the yield of artificially cultured Cordyceps militaris on a large scale.

Hexokinase gene HK and mannose-1-uridine phosphate transferase gene MPG are related enzyme genes in the biosynthesis pathway of Cordyceps militaris polysaccharide, and have been verified in the genome sequence of Cordyceps militaris. Cloning related enzyme genes and introducing the genes into a wild cordyceps militaris genome, and increasing the yield of extracellular polysaccharide of cordyceps militaris by an overexpression method.

Disclosure of the invention

The invention aims to provide a method for improving the yield of extracellular polysaccharide of cordyceps militaris by over-expressing hexokinase gene HK, which obtains a mutant strain of cordyceps militaris by a genetic engineering technology, wherein the yield of extracellular polysaccharide in a fermentation liquid of the mutant strain is 1.61 times compared with that of a wild strain, and the yield of extracellular polysaccharide in the fermentation liquid of the mutant strain is 0.91 times compared with that of the wild strain by over-expressing mannose-1-uridine phosphate transferase gene MPG, thereby laying a foundation for further screening excellent varieties of cordyceps militaris.

The technical scheme adopted by the invention is as follows:

the invention provides a method for improving the yield of cordyceps militaris extracellular polysaccharide by over-expressing hexokinase gene HK, which is characterized in that the content of cordyceps militaris extracellular polysaccharide is improved by over-expressing hexokinase gene HK in cordyceps militaris gene; the nucleotide sequence of the hexokinase gene HK is shown in SEQ ID NO. 1.

Preferably, the method comprises the following steps: constructing cordyceps militaris genetic engineering bacteria containing hexokinase gene HK, inoculating the cordyceps militaris genetic engineering bacteria into a fermentation culture medium, and performing shaking table fermentation culture at the temperature of 22-25 ℃ and at the rpm of 120-180 (preferably at the temperature of 25 ℃ and at the rpm of 180) to obtain fermentation liquor containing cordyceps militaris extracellular polysaccharide; the culture medium of the fermentation liquid comprises the following components: glucose 20g/L, (NH)₄)₂SO₄ 7g/L，K₂HPO₄·3H₂O 0.5g/L，KH₂PO₄ 0.5g/L，MgSO₄·7H₂0.5g/L of O, 1g/L of L-glycine and distilled water as a solvent, wherein the pH is natural.

Further, the cordyceps militaris genetic engineering bacteria are obtained by connecting hexokinase gene HK and binary vector pCAMBIA after seamless cloning to obtain a recombinant vector, transforming the recombinant vector into escherichia coli, extracting plasmids to transform agrobacterium and infecting cordyceps militaris with the agrobacterium. The Agrobacterium is Agrobacterium tumefaciens AGL-1.

Further, the cordyceps militaris genetic engineering bacteria are constructed according to the following method: (1) seamlessly cloning and connecting hexokinase gene HK and a linearized binary vector pCAMBIA to obtain a recombinant vector, transforming escherichia coli by using the recombinant vector, extracting plasmid to transform agrobacterium, inoculating to an IM (instant Messaging) culture medium containing 25 mu g/mL rifampicin and 50 mu g/mL kanamycin, culturing for 36h at 28 ℃, and screening to obtain an agrobacterium strain containing hexokinase gene HK; the IM medium consists of: KH (Perkin Elmer)₂PO₄ 1.45g/L，K₂HPO₄ 2.05g/L，MgSO₄·7H₂O 0.6g/L，NaCl 0.1g/L，CaCl₂ 0.01g/L，FeSO₄ 0.001g/L，NH₄NO₃0.5g/L, 5mL/L of glycerol, 40mL/L of 1mol/L MES buffer solution with the pH value of 5.5, 5mL/L of trace element stock solution, 2g/L of glucose and distilled water as a solvent; the microelement stock solution comprises the following components: ZnSO₄·7H₂O100mg/L，CuSO₄·5H₂O 100mg/L，H₃BO₃ 100mg/L，Na₂MoO₄·7H₂O100mg/L, and the solvent is water; (2) inoculating the agrobacterium strain containing hexokinase gene HK into a liquid LB culture medium containing 50mg/L kanamycin, and performing shake culture at 28 ℃ and 180rpm for 36 h; transferring the culture solution into liquid AIM medium at volume concentration of 1%, and culturing at constant temperature of 180rpm and 28 deg.C until the thallus concentration OD₆₀₀Obtaining agrobacterium tumefaciens liquid by the concentration of 0.60-0.80 percent; the AIM culture medium is prepared by adding 200 mu g/mL of Acetosyringone (AS) into an IM culture medium; (3) inoculating wild Cordyceps militaris (preferably Cordyceps militaris CM01) into solid Sabouraud's medium, culturing at 25 deg.C under constant temperature and dark condition for 7 days, repeatedly washing the surface of the solid culture medium with sterile water on an ultraclean bench to obtain Cordyceps militaris bacterial suspension, filtering the bacterial suspension with 4 layers of sterilized gauze to remove mycelium to obtain Cordyceps militaris spore suspension; solid saki medium: 40g/L of glucose, 10g/L of peptone, 20g/L of agar powder and distilled water as a solvent, wherein the pH value is natural; (4) mixing the agrobacterium liquid obtained in the step (2) and the cordyceps militaris spore suspension obtained in the step (3) in an equal volume manner to obtain a mixed bacterial liquid, coating the mixed bacterial liquid on the upper surface of sterile glass paper placed on the surface of a selective culture medium, carrying out constant-temperature light-proof upright culture at 25 ℃ for 48 hours, transferring the mixed bacterial liquid and the glass paper to the surface of a new selective culture medium (the coating bacterial surface is upward, the thickness of the culture medium is about 2mm), pouring a layer of selective culture medium on the upper surface of the glass paper to completely cover the glass paper (the thickness of the culture medium is about 2mm), carrying out constant-temperature light-proof culture at 25 ℃ for 4-5 days, selecting hyphae penetrating through the upper selective culture medium as potential positive clones, inoculating the hyphae to a Sabourdon solid culture medium containing 200 mu g/mL hygromycin B, carrying out constant-temperature light-proof culture at 25 ℃ for 4-5 days, carrying out subculture (preferably, transferring and culturing the next generation for five generations), obtaining stably inherited HK containing hexokinase geneCordyceps militaris gene engineering bacteria; the selection medium was IM medium containing 200. mu.g/mL hygromycin B, 100. mu.g/mL ceftriaxone sodium, and 50. mu.g/mL kanamycin.

Further, the concentration of the cordyceps militaris spore suspension is 10⁶～10⁸mL, preferably 10^6/mL。

Further, before fermentation, the cordyceps militaris genetic engineering bacteria containing the hexokinase gene HK are inoculated to a Sha's solid culture medium containing 200 mug/mL hygromycin B, are cultured at a constant temperature of 25 ℃ for 4-5 days in a dark place, and then colonies are picked and inoculated to the fermentation culture medium.

Compared with the prior art, the invention has the following beneficial effects: the cordyceps militaris gene mutant strain capable of stably inheriting and overexpressing hexokinase gene HK is constructed by a gene engineering technology, and compared with a wild strain, the mutant strain has the extracellular polysaccharide yield of 1.61 times in fermentation liquor, so that a foundation is laid for further screening of excellent cordyceps militaris varieties.

(IV) description of the drawings

FIG. 1 shows PCR results of Agrobacterium colonies containing HK gene of interest of example 1 and MPG gene of interest of example 3. Wherein, lane M: 5000DNA Marker, lane WT: control,

lanes

1 and 2 are replicates of PCR products from the Agrobacterium colony containing HK of the gene of interest of example 1, and lanes 3-7 are replicates of PCR products from the Agrobacterium colony containing MPG of the gene of interest of example 3.

FIG. 2 shows the identification results of hygromycin resistance genes of recombinant Cordyceps militaris in examples 2 and 3. Wherein, lane M: 5000DNA Marker, lanes 1-5 are parallel samples of PCR product for identifying hygromycin resistance gene of recombinant Cordyceps militaris containing target gene HK, lanes 6-10 are parallel samples of PCR product for identifying hygromycin resistance gene of recombinant Cordyceps militaris containing target gene MPG, and lane 11 is a control group.

FIG. 3 is a bar graph of extracellular polysaccharide content of wild type Cordyceps militaris strain and recombinant strain containing HK and MPG.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of protection of the invention is not limited thereto:

the embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.

Culture medium for cordyceps militaris strain

A Sabouraud medium: 40g/L of glucose, 10g/L of peptone, 20g/L of agar powder and distilled water as a solvent, wherein the pH is natural, and if a solid culture medium is prepared, 20g/L of agar powder is added.

Fermentation medium: glucose 20g/L, (NH)₄)₂SO₄ 7g/L，K₂HPO₄·3H₂O 0.5g/L，KH₂PO₄ 0.5g/L，MgSO₄·7H₂0.5g/L of O, 1g/L of L-glycine and distilled water as a solvent, wherein the pH is natural.

Culture medium for bacterial strains

LB culture medium: 10g/L of peptone, 5g/L of yeast extract, 10g/L of NaCl and distilled water as a solvent, and the pH value is 7.0. If a solid culture medium is prepared, 20g/L agar powder is added.

IM medium: KH (Perkin Elmer)₂PO₄ 1.45g/L，K₂HPO₄ 2.05g/L，MgSO₄·7H₂O 0.6g/L，NaCl 0.1g/L，CaCL₂ 0.01g/L，FeSO₄ 0.001g/L，NH₄NO₃0.5g/L, 5mL/L of glycerol, 40mL/L of MES buffer solution (1mol/L, pH5.5), 5mL/L of trace element stock solution, 2g/L of glucose and distilled water as a solvent; the microelement stock solution comprises the following components: ZnSO₄·7H₂O 100mg/L，CuSO₄·5H₂O100mg/L，H₃BO₃ 100mg/L，Na₂MoO₄·7H₂O100mg/L, and the solvent is water. In addition, the final glucose solubility of the IM solid culture medium is reduced to 1g/L, and the agar powder is reduced to 20 g/L.

AIM medium: IM medium with a final concentration of 200. mu. mol/L acetosyringone.

Selecting a culture medium: IM medium containing 200. mu.g/mL hygromycin B, 100. mu.g/mL ceftriaxone sodium, and 50. mu.g/mL kanamycin.

Example 1 construction of Agrobacterium containing hexokinase Gene HK

1. Construction of recombinant expression vectors

(1) Extracting cordyceps militaris genome DNA: inoculating wild type Cordyceps militaris (Cordyceps militaris) CM01 (purchased from Shandong Zhengda Mushroom Co., Ltd.) in solid Sabouraud's medium, and culturing in a constant temperature incubator at 25 deg.C for 7d in an inverted manner (or fermenting the culture medium liquid at 25 deg.C and 180rpm for five days in a shake flask, filtering with four layers of sterilized gauze to obtain mycelium). Scraping a proper amount of mycelium and sucking water, adopting a fungus genome DNA rapid extraction kit (purchased from Biotechnology engineering (Shanghai) GmbH, product number: B518229), extracting genome DNA according to the relevant operation instructions of the kit, and specifically: taking 50-100 mg of fresh fungi or 20mg of dried fruit bodies or hyphae, fully grinding the fungi or the dried fruit bodies or the hyphae in liquid nitrogen into powder, putting the powder into a 1.5mL centrifuge tube, sequentially adding 400 mu L of Buffer Digestion and 4 mu L of beta-mercaptoethanol, and shaking and uniformly mixing the materials. The cells were completely lysed by a water bath at 65 ℃ for 1 h. ② adding 200mL Buffer PF, fully reversing and mixing evenly, and placing for 5min in a refrigerator at-20 ℃. ③ centrifuging at room temperature and 10000rpm for 5min, and transferring the supernatant (500-550 mu L) to a new 1.5mL centrifuge tube. Adding isopropanol with the same volume, reversing for 5-8 times to fully mix the isopropanol with the isopropanol, and standing for 2-3 min at room temperature. Centrifuge at 10000rpm for 5min at room temperature, and discard the supernatant. Adding 1mL of 75% ethanol, reversely rinsing for 1-3 min, centrifuging at 10000rpm for 2min, and discarding the supernatant. Sixthly, repeating the step five times. And opening the cover, and inverting the cover for 5-10 min at room temperature until the residual ethanol is completely volatilized. The obtained DNA is dissolved in50 to 100. mu.L of TE Buffer. The extracted wild Cordyceps militaris DNA can be immediately subjected to the next experiment or stored at-20 deg.C.

(2) Target gene hexokinase gene HK amplification: the wild-type cordyceps militaris DNA extracted in the step (1) is subjected to PCR amplification through a PCR reaction system in a table 2 by using a primer HK-F/HK-R in a table 1 to obtain a target gene fragment, namely a hexokinase gene HK (nucleotide shown in SEQ ID NO. 1) on the cordyceps militaris genome DNA. PCR amplification procedure: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, annealing at 62 ℃ for 30s, extension at 72 ℃ for 1min50s, 3 cycles, denaturation at 94 ℃ for 30s, annealing at 70 ℃ for 30s, extension at 72 ℃ for 1min50s, 27 cycles, filling in at 72 ℃ for 10min, and low-temperature storage at 4 ℃.

SEQ ID NO.1

ATGGTTGGCCTAGGTCCTCGCGCTCCGCCCTCTAGAAAAGGTACGCCCCGGATACTGCTACTACGGCGGAAAAATATTGAATCGAACTTTGTCAACGTCTTTTCACCGATGCAAGACGCTCCTGGGATTGTGACGACCATCCGCTGCTGCACTAGAAGCTAACAACCACTGAGGGTCGAAAGCCGATGTTCCCAAGGACACCATGGAGGCGATCCGGAACATTGAGGAGCTCTTTACGGTCGACACTGCCAAGCTCAAGGCCATCACAGAGCACTTCGTCTCCGAGCTTACCAAGGGTTTGTGCCGCGCCCGAATTAAACCAGCCAGATTGCGCCAACCAACACCAGCCACTAACCGTCTTCTCAGGCCTCACCAAAGAGGGTGGCAGCATTGTAAGCATATATGAATCTACACCAACTACTGTAACTCAGGCTAACAGATCTCCAGCCCATGAACCCTACTTGGGTCATGTCGTATCCCGATGGCAATGAGACTGGCACCTTCCTCGCCCTCGACATGGGCGGCACCAACCTGCGCGTCTGCCAAATCACCCTTACAGATAAGAGGTCCGAGTTTGACATTATCCAGTCCAAGTACAAGATGCCTGAAGAGCTCAAGACTGGCAAGAGCGATGAGCTGTGGGAGTACATTGCCGACTGTCTCCACCAGTTCCTCGAAACCCACCATGGTGACACCAAGAACATTGGCACCTTGCCCTTGGGGTTCACCTTTTCTTACCCCGCTACCCAGAACTACATTGACGCGGGTATCTTGCAGCGATGGACCAAGGGCTTTGACATTGACGGCGTCGAGGGCCAGGATGTCGTTCCCATGTTCGAGGCTGCTCTTGCCAAGCGTGTATGTCTAATATGCCTCACTCTCTCGTACTCTGGTAGCTTGCTGACCTGTATGTAGGGTGTTCCCATTCAACTGACTGCTCTTATTAATGACACCACCGGAACGCTCATGGCCTCGGCCTATACTGACCCTACCATGAAGATTGGCTGCATCTTCGGCACCGGCTGCAACGCCGCGTACGTCGAACACTGCGGTTCGATCCCCAAGCTTGCCGACATGGGTCTACCTGATGACATGGAAATGGCCATCAACTGCGAGTGGGGTGCCTTTGACAATGAGCACAAGATTCTACCCCGTACCAAGTACGATGTCATCATTGATGAGGAGTCACCCCGCCCTGGCCAACAGGCGTTTGAGAAAATGATTGCAGGTCTCTACCTTGGCGAGATTTTCCGCCTTGCCCTTGTCGATCTGCATAACGAAAAGCACCTCTTTCAGGGACAGGACATCAACTGTCTGCGCAAGGCCTACAGCCTCGACGCTTCGTTCCTTTCGGCTATTGAGGAGTGAGTCACATCGTTCTGCTACTGAGGCATGCCGTCTAACTACCGGGCTCCAGGGATCCTTTCGAGAACTTACAGGAGACGTTCGACCTGTTTGCAAACAAGTTGCAAATCAATGTCACCGGCCCCGAGCTTGAGCTGATCCGCCGCCTCGCTGAGCTGATCGGTACCCGCGCCGCCCGTCTCGCTTCCTGCGGTGTCGCTGCCATTTGCAAGAAGAAGAACTTCAAGACCTGCCACGTCGGTGCCGACGGCTCCGTCTTCAATAAGTACCCTCACTTCAAGGCTCGTGGAGCGCAGGCCCTGAAGGAGATTCTTGACTGGCCCGACAAGACTGATGCCAAAGCCGAGGACCCGGTTGAAATTCTTGCCGCCGAAGACGGCAGTGGTGTCGGTGCCGCTCTGATTGCCGCCTTGACCCTGAAGCGTGCGCAGCAGGGCAACCTGGCGGGCATTCTTCACCCGGAGCGCTTCAAATAG 1841

TABLE 1 hexokinase Gene HK amplification primers

TABLE 2 amplification PCR reaction System

(3) Recombinant expression vector

Linearized vector pCAMBIA: the Vector pCAMBIA (commercially available) was subjected to PCR amplification using the primers Vector-F and Vector-R shown in Table 3 according to the PCR reaction system shown in Table 4. PCR amplification procedure: pre-denaturation at 94 ℃ for 5min, and cycle number of 1; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 6min, and cycle number of 25; final extension at 72 ℃ for 10min, cycle number 1. Adding 1 mu L of DpnI enzyme into the amplified product, cutting in water bath at 37 ℃ for 2h to remove the rest template DNA, and heating in water bath at 80 ℃ for 15min to inactivate the DpnI enzyme. And carrying out 1% agarose gel electrophoresis identification on the obtained product, and preliminarily judging whether the sequence is successfully amplified according to the length of the band. The PCR amplification product gel was recovered using a SanPrep column DNA gel recovery kit (purchased from Biotechnology engineering (Shanghai) Co., Ltd., product number: B518131), and the DNA solution of the linearized vector pCAMBIA was obtained according to the operation procedure of the gel recovery kit, and stored at-20 ℃.

TABLE 3 vector linearization primers

TABLE 4 linearized PCR reaction System

Recombinant expression vector: by using

UniSeamless Cloning and Assembly Kit (King, Cat.: CU101-02), hexokinase gene HK (Inserts) was gently mixed with linearized vectors pCAMBIA (Linear vector) and 2xAssembly Mix, according to Table 5, and reacted at 50 ℃ for 15 minutes. After the reaction is finished, the centrifugal tube is placed on ice to be cooled for several seconds to obtain a recombinant expression vector, and the recombinant expression vector is stored at the temperature of minus 20 ℃ or is directly used for transformation.

TABLE 5 seamless cloning reaction System

2. Transformation of E.coli DH5 alpha

Adding 6 mu L of the recombinant expression vector constructed in the step (3) in the step 1 into 100 mu L of escherichia coli DH5 alpha competence, and placing on ice for 30 min; heat shock is carried out in 42 ℃ water bath for 30s, and the mixture is cooled for 2min on ice; adding 800 mu LLB liquid culture medium into the competence, and performing shake culture at 37 ℃ and 180rpm for 1 h; centrifuging at 3500rpm for 10min, discarding supernatant on a super clean bench, and keeping 100 μ L of bacterial liquid; the resuspended bacterial liquid is spread on LB culture medium and cultured for 24h at 37 ℃. Single colonies were picked and verified by PCR using primers Ide-F/Ide-R of Table 6, and the success of the transformation was checked according to the reaction system (Table 7).

TABLE 6 colony PCR primers

TABLE 7 colony PCR reaction System

Amplification procedure of PCR: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 64 deg.C for 30s, extension at 72 deg.C for 1min, and cycle number of 30; filling up for 10min at 72 ℃. According to the result of the 1% agarose gel electrophoresis identification, whether the clone is a positive clone can be preliminarily judged, and whether the transformation is successful is checked.

The E.coli positive clone was inoculated into LB medium, plasmid DNA was extracted using SanPrep column type plasmid DNA miniprep kit (purchased from Biotechnology engineering, Shanghai, Ltd., product number: B518131), and 35. mu.L of ddH was used for the obtained DNA₂And dissolving the O. The extracted DNA can be immediately subjected to the next experiment or stored at-20 ℃.

3. Transformation of Agrobacterium tumefaciens

Adding 5 μ L of the plasmid DNA solution extracted in step 2 into 100 μ L of Agrobacterium tumefaciens AGL-1 (purchased from Shanghai Jiqi Biotech Co., Ltd.) competence, freezing with liquid nitrogen for 8s, and water-bathing at 37 deg.C for 5 min; adding 800 μ L LB liquid culture medium into the competence, culturing at 28 deg.C and 180rpm, shaking for 1 h; centrifuging at 3500rpm for 10min, discarding supernatant on a super clean bench, and keeping 100 μ L of bacterial liquid; the re-suspended bacterial liquid is coated on an IM culture medium containing 25 mu g/mL rifampicin and 50 mu g/mL kanamycin, and cultured for 36h at 28 ℃, and a single colony is selected to be the agrobacterium containing the hexokinase gene HK.

Selecting a single colony to perform colony PCR identification by using a primer Ide-F/Ide-R of Table 6, wherein a PCR reaction system is shown in a table 7, and the PCR amplification program comprises the following steps: pre-denaturation at 94 ℃ for 5min, and cycle number of 1; denaturation at 94 ℃ for 30s, annealing at 64 ℃ for 30s, extension at 72 ℃ for 1min, and cycle number of 30; final extension at 72 ℃ for 10min, cycle number 1. According to the result of the 1% agarose gel electrophoresis identification, whether the recombinant engineering bacteria is successfully transformed can be judged, and the result is shown in FIG. 1, wherein lanes 1-2 are parallel samples of the PCR product of the agrobacterium colony containing the target gene HK.

Example 2 transformation of homologous recombination vectors in Cordyceps militaris

1. Agrobacterium tumefaciens mediated genetic transformation of filamentous fungi

Single colonies of step 3 of example 1 were picked and inoculated into 3mL of liquid LB medium containing 50mg/L kanamycin (Kan), and shake-cultured at 28 ℃ and 180rpm for 36 hours. Transferring the culture solution into liquid AIM culture medium at volume concentration of 1%, and culturing at constant temperature of 180rpm and 28 deg.C for 6-8 hr to thallus concentration OD₆₀₀The agrobacterium liquid was obtained at 0.80 ℃.

2. Cordyceps militaris spore suspension

Inoculating wild Cordyceps militaris CM01 into a solid Sabouraud's medium, performing inverted culture at constant temperature of 25 deg.C in dark place for 7 days (spore suspension is generally prepared by slant or solid culture, liquid culture conditions are not favorable for producing spores or the concentration of spores is low), and repeatedly washing the surface of the solid medium with sterile water on an ultraclean workbench to obtain Cordyceps militaris suspension. Filtering the bacterial suspension with 4 layers of sterilized gauze to remove mycelium, and obtaining cordyceps militaris spore suspension. And (3) taking trace cordyceps militaris spore suspension, and determining the cordyceps militaris spore concentration in the spore suspension by using a blood counting plate.

3. Transformation of

200 μ L of the concentration prepared in step 2 was 10⁶/mL cordyceps militaris spore suspension and OD prepared in step 1₆₀₀And (3) uniformly mixing the agrobacterium tumefaciens bacterial liquid with the same volume as 0.80 to obtain a mixed bacterial liquid.

Tightly attaching the sterile cellophane to the surface of a Sabouraud's solid culture medium, uniformly coating the mixed bacteria liquid on the surface of the sterile cellophane, culturing at a constant temperature of 25 ℃ for 48h in a light-shielding and positive mode, transferring the mixed bacteria liquid and the cellophane to the surface of a new selective culture medium (the surface of a coated strain is upward, the thickness of the culture medium is about 2mm), then pouring a layer of selective culture medium on the surface of the glass paper to completely cover the glass paper (the thickness of the culture medium is about 2mm), culturing at the constant temperature of 25 ℃ for 4-5 days in a dark place, and (3) selecting hyphae penetrating through an upper layer selection culture medium as potential positive clones, inoculating the hyphae to a Sasa solid culture medium containing 200 mu g/mL hygromycin B, culturing at the constant temperature of 25 ℃ for 4-5 days in a dark place, transferring and culturing the hyphae to the next generation after the hyphae grow out, and culturing for five generations to obtain the stably inherited recombinant cordyceps militaris hygromycin resistant strain containing the hexokinase gene HK (shown in SEQ ID NO. 1).

4. Identification of hygromycin-resistant strain gene of cordyceps militaris

Extracting recombinant Cordyceps militaris hygromycin resistant strain genome DNA, and dissolving the obtained DNA with 50-100 mu L of TE Buffer. The extracted DNA can be immediately subjected to the next experiment or stored at-20 ℃. Taking the extracted genome DNA of the hygromycin-resistant strain of the cordyceps militaris, carrying out PCR verification by using a hph-F/hph-R primer, and checking whether the transformation is successful or not. The primers for positive PCR identification are shown in Table 8, and the reaction system is shown in Table 9. The result of the 1% agarose gel electrophoresis identification can be used to judge whether the clone is a positive clone, the result is shown in figure 2, and lanes 1-5 are parallel samples of the recombinant cordyceps militaris hygromycin resistance gene identification PCR product of the target gene HK. And (5) storing the transformant with positive identification result.

TABLE 8 hygromycin identification primers

TABLE 9 hygromycin identification PCR reaction System

Amplification procedure of PCR: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 30s, and cycle number of 30; final extension at 72 ℃ for 10 min.

5. Detection of content of polysaccharide in hygromycin-resistant cordyceps militaris strain

Respectively inoculating wild Cordyceps militaris CM01 and the recombinant Cordyceps militaris hygromycin-resistant strain prepared by the method in step 3 to a Sabouraud solid culture medium containing 200 mug/mL hygromycin B, culturing at 25 ℃ in a dark place for 4-5 days, selecting bacterial blocks with the same size, inoculating to a fermentation culture medium, and culturing for 7 days at 25 ℃ in a constant-temperature shaking table at 180 rpm.

10 μ L of the fermentation broth was diluted to 2mL with deionized water, and the total sugar content was determined by the sulfuric acid-phenol method (concentrated sulfuric acid 5mL, 5% phenol 1mL, sample 1mL) and the determination was repeated three times.

Diluting 100 μ L fermentation liquid with deionized water to 500 μ L, measuring glucose residue concentration with biosensor analyzer, and repeating the measurement for three times. The content of extracellular polysaccharide of Cordyceps militaris is obtained by subtracting the content of glucose residue from the total sugar content, and is shown in Table 10 and FIG. 3.

TABLE 10 extracellular polysaccharide content of wild-type Cordyceps militaris and Cordyceps militaris hygromycin-resistant strains

Example 3 construction of engineered Cordyceps militaris Strain containing mannose-1-uridine-phosphate transferase MPG

Amplifying with primers MPG-F/MPG-R in Table 11 to obtain mannose-1-uridine-phosphate transferase gene PGM (SEQ ID NO.2) on Cordyceps militaris genomic DNA, and amplifying with primers MPG-F/MPG-R

UniSeamless Cloning and Assembly Kit (Kyoto Seiki Kagaku Co., Ltd., catalog No.: CU101-02) linked the target gene fragment with plasmid pCAMBIA to obtain recombinant vector pCAMBIA-PgpdA-MPG-Tcbh 1-hph-PtrpC.

TABLE 11 amplification primers for mannose-1-phosphate uridine transferase MPG

Other operations are the same as those in examples 1 and 2, recombinant cordyceps militaris engineering bacteria containing gene MPG are obtained, extracted cordyceps militaris hygromycin resistant strain genome DNA is taken, a PCR verification is carried out by using a primer hph-F/hph-R of Table 8, whether the transformation is successful or not is checked, the result is shown in figure 2, lanes 6-10 are recombinant cordyceps militaris hygromycin resistant genes of the target gene MPG, a parallel sample of PCR products is identified, and transformants with positive identification results are stored; the total sugar content of the transgenic strains, the concentration of glucose residues, and the content of cordyceps polysaccharide obtained by subtracting the content of glucose residues from the total sugar content are measured, and the content of cordyceps polysaccharide is shown in table 10 and figure 3. The result shows that not all enzyme genes related to the biosynthesis of cordyceps militaris polysaccharide can be over-expressed to improve the yield of extracellular polysaccharide.

SEQ ID NO.2

ATGGCGTCCGTTTCCGAGTCGGCTCTGGTCGCCATTGCCGCCCAGCTCAGCCAGGTCATGGGCGCTCTCGAGAAGCAGGTGGGTTGCGTCTTATGTACTTTGTTTGTGCCGCCGAGGGGTTGTCGGAGTCGCTTCGCCGTTGCGCGCCGTGCCAGCCCTACGCGCGCGCAGGTCTCAATGGCGAGATGAACTAATGTGCCATAGAATTCCGAGCTCTCTGAGCTTCGTGTCGAGTGCTCTGCTCTGCGCACCCAGAATACCAACATGGAGCGCCTCCTCCAGGATAACGTGGTAGGTGATGCCCAACTCCTTTCTCGATATTGAGGCTCCACTCGTCAATTCCAGCTGGGCCTGGATTGTCTGCACCTCACTCATTGAGCGAGTGTAGACTGCATCCCACAGGAATCAATCGCACATGCAGTCGCTCTCGCTTATACTCGGCCTATTCATGATCCATTCTCCCCTGCTGCCTCATACTGATCCGTCACAGCACAAGTACGACAACCGCAACCTCAGCCTCTCCCACCCCTCCCCGGGCCTTGAGACCTCGTCGCCTTTCCTCTCCGCCACCTCTCTCCCCCGCGTGGCCTCTACTCTCACCTTTAACCCTCTTGGTGATCAGCCTCTTTTCACCACCGCCTCCCCCGCCTATGAAATTCCCGGCTTCTATGTCGTCATTCCCGCTGGTGGTGCTGGTACCCGTCTCTGGCCCCTGTCCCGCAAGAACCATCCCAAGTTCCTGCTCGATGTCTCGCTTTCAGGCCGCTCCATGCTGCAGTCTACCTGGAACCGTCTTGTTCCCCTGACTGGTTCCTCTCGCATGACTGTCGTCGCCGGTCCTGCTCACTCCGAGGCCATCAAGGGCCAGCTCCCCCAGCTCGAGGACAACAACCTGTTCACTGAGCCTGGTCCCAAGGACTCCATGGCCGCCATTGGTCTCGCCGCCGCCATTCTCGCCGAGCGTGATCCCGATGCCATTATTGGTTCCTTCGCCGCCGATCACATGATTTCCGGTGAAGATGCTTTCCTCGGCGCCGTCCGTGAAGCTGCCAACGTCGCCAAGGCTGGCTATCTCGTTACTATTGGTATCGCGCCGTCTCACCCTGCGACCGGCTTCGGTTACGTACAGCTCGGAAAGGCCCTCAACGGCCACAACGCTCCCACCGCCCGTCTCGTCAGCTCCTTCAAGGAGAAGCCCGATGCCCGCACCGCCGCCAAGTACCTCGCCTCCGGTGAGTACCGCTGGAACGCTGGTATGTTCGTCACGCGCGCAGCTACCCTCATGGAGCTTGTACTAGAGCACCGCCCCGAGATCCACGCTGGTCTCGTCAAAATCGCCAAGGTCTGGGACAACGAGCCTGAGCGTCTTGCTGTTCTCGCCGAGATTTGGCCTACTCTCGAGACAATTGCCATTGACCATGCTATTGCGGAGCCTGCCGCTGCCGAGGGTAAGGTTGCCGTCATTCCCGCCACTTTCGGTTGGGACGATGTAGGTGACTTTTCGTCCCTTGCTGAAATGCTTCCCGCCGAAGCCAACTCCCCTCGCGTTCTCGGTGACAGCGATCTCGTCGTTTCCGAGCAGACCTTTGGTGGTATCATTGTTCCCGGTTCCGGCCGTCTTGTTGCTTGCCTGGGTGTTGACGATCTGGTCATCGTCGATCTGCCCGATGCGCTCATGATCACCACCCGCGCTCGTTCGCAAGAAGTCAAGACGCTTGTGAAGAAGGCCCAGCGGGCTGGTTTCGGGAGCCTTATGTAG 1759

Sequence listing

<110> Zhejiang industrial university

<120> method for improving yield of extracellular polysaccharide of cordyceps militaris by over-expressing hexokinase gene HK

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1841

<212> DNA

<213> Unknown (Unknown)

<400> 1

atggttggcc taggtcctcg cgctccgccc tctagaaaag gtacgccccg gatactgcta 60

ctacggcgga aaaatattga atcgaacttt gtcaacgtct tttcaccgat gcaagacgct 120

cctgggattg tgacgaccat ccgctgctgc actagaagct aacaaccact gagggtcgaa 180

agccgatgtt cccaaggaca ccatggaggc gatccggaac attgaggagc tctttacggt 240

cgacactgcc aagctcaagg ccatcacaga gcacttcgtc tccgagctta ccaagggttt 300

gtgccgcgcc cgaattaaac cagccagatt gcgccaacca acaccagcca ctaaccgtct 360

tctcaggcct caccaaagag ggtggcagca ttgtaagcat atatgaatct acaccaacta 420

ctgtaactca ggctaacaga tctccagccc atgaacccta cttgggtcat gtcgtatccc 480

gatggcaatg agactggcac cttcctcgcc ctcgacatgg gcggcaccaa cctgcgcgtc 540

tgccaaatca cccttacaga taagaggtcc gagtttgaca ttatccagtc caagtacaag 600

atgcctgaag agctcaagac tggcaagagc gatgagctgt gggagtacat tgccgactgt 660

ctccaccagt tcctcgaaac ccaccatggt gacaccaaga acattggcac cttgcccttg 720

gggttcacct tttcttaccc cgctacccag aactacattg acgcgggtat cttgcagcga 780

tggaccaagg gctttgacat tgacggcgtc gagggccagg atgtcgttcc catgttcgag 840

gctgctcttg ccaagcgtgt atgtctaata tgcctcactc tctcgtactc tggtagcttg 900

ctgacctgta tgtagggtgt tcccattcaa ctgactgctc ttattaatga caccaccgga 960

acgctcatgg cctcggccta tactgaccct accatgaaga ttggctgcat cttcggcacc 1020

ggctgcaacg ccgcgtacgt cgaacactgc ggttcgatcc ccaagcttgc cgacatgggt 1080

ctacctgatg acatggaaat ggccatcaac tgcgagtggg gtgcctttga caatgagcac 1140

aagattctac cccgtaccaa gtacgatgtc atcattgatg aggagtcacc ccgccctggc 1200

caacaggcgt ttgagaaaat gattgcaggt ctctaccttg gcgagatttt ccgccttgcc 1260

cttgtcgatc tgcataacga aaagcacctc tttcagggac aggacatcaa ctgtctgcgc 1320

aaggcctaca gcctcgacgc ttcgttcctt tcggctattg aggagtgagt cacatcgttc 1380

tgctactgag gcatgccgtc taactaccgg gctccaggga tcctttcgag aacttacagg 1440

agacgttcga cctgtttgca aacaagttgc aaatcaatgt caccggcccc gagcttgagc 1500

tgatccgccg cctcgctgag ctgatcggta cccgcgccgc ccgtctcgct tcctgcggtg 1560

tcgctgccat ttgcaagaag aagaacttca agacctgcca cgtcggtgcc gacggctccg 1620

tcttcaataa gtaccctcac ttcaaggctc gtggagcgca ggccctgaag gagattcttg 1680

actggcccga caagactgat gccaaagccg aggacccggt tgaaattctt gccgccgaag 1740

acggcagtgg tgtcggtgcc gctctgattg ccgccttgac cctgaagcgt gcgcagcagg 1800

gcaacctggc gggcattctt cacccggagc gcttcaaata g 1841

<210> 2

<211> 1759

<212> DNA

<213> Unknown (Unknown)

<400> 2

atggcgtccg tttccgagtc ggctctggtc gccattgccg cccagctcag ccaggtcatg 60

ggcgctctcg agaagcaggt gggttgcgtc ttatgtactt tgtttgtgcc gccgaggggt 120

tgtcggagtc gcttcgccgt tgcgcgccgt gccagcccta cgcgcgcgca ggtctcaatg 180

gcgagatgaa ctaatgtgcc atagaattcc gagctctctg agcttcgtgt cgagtgctct 240

gctctgcgca cccagaatac caacatggag cgcctcctcc aggataacgt ggtaggtgat 300

gcccaactcc tttctcgata ttgaggctcc actcgtcaat tccagctggg cctggattgt 360

ctgcacctca ctcattgagc gagtgtagac tgcatcccac aggaatcaat cgcacatgca 420

gtcgctctcg cttatactcg gcctattcat gatccattct cccctgctgc ctcatactga 480

tccgtcacag cacaagtacg acaaccgcaa cctcagcctc tcccacccct ccccgggcct 540

tgagacctcg tcgcctttcc tctccgccac ctctctcccc cgcgtggcct ctactctcac 600

ctttaaccct cttggtgatc agcctctttt caccaccgcc tcccccgcct atgaaattcc 660

cggcttctat gtcgtcattc ccgctggtgg tgctggtacc cgtctctggc ccctgtcccg 720

caagaaccat cccaagttcc tgctcgatgt ctcgctttca ggccgctcca tgctgcagtc 780

tacctggaac cgtcttgttc ccctgactgg ttcctctcgc atgactgtcg tcgccggtcc 840

tgctcactcc gaggccatca agggccagct cccccagctc gaggacaaca acctgttcac 900

tgagcctggt cccaaggact ccatggccgc cattggtctc gccgccgcca ttctcgccga 960

gcgtgatccc gatgccatta ttggttcctt cgccgccgat cacatgattt ccggtgaaga 1020

tgctttcctc ggcgccgtcc gtgaagctgc caacgtcgcc aaggctggct atctcgttac 1080

tattggtatc gcgccgtctc accctgcgac cggcttcggt tacgtacagc tcggaaaggc 1140

cctcaacggc cacaacgctc ccaccgcccg tctcgtcagc tccttcaagg agaagcccga 1200

tgcccgcacc gccgccaagt acctcgcctc cggtgagtac cgctggaacg ctggtatgtt 1260

cgtcacgcgc gcagctaccc tcatggagct tgtactagag caccgccccg agatccacgc 1320

tggtctcgtc aaaatcgcca aggtctggga caacgagcct gagcgtcttg ctgttctcgc 1380

cgagatttgg cctactctcg agacaattgc cattgaccat gctattgcgg agcctgccgc 1440

tgccgagggt aaggttgccg tcattcccgc cactttcggt tgggacgatg taggtgactt 1500

ttcgtccctt gctgaaatgc ttcccgccga agccaactcc cctcgcgttc tcggtgacag 1560

cgatctcgtc gtttccgagc agacctttgg tggtatcatt gttcccggtt ccggccgtct 1620

tgttgcttgc ctgggtgttg acgatctggt catcgtcgat ctgcccgatg cgctcatgat 1680

caccacccgc gctcgttcgc aagaagtcaa gacgcttgtg aagaaggccc agcgggctgg 1740

tttcgggagc cttatgtag 1759

Claims

1. A method for improving the yield of extracellular polysaccharide of Cordyceps militaris by over-expressing hexokinase gene HK is characterized in that the method realizes the improvement of the content of extracellular polysaccharide of Cordyceps militaris by over-expressing hexokinase gene HK in Cordyceps militaris gene; the nucleotide sequence of the hexokinase gene HK is shown in SEQ ID NO. 1.

2. The method of claim 1, wherein the method is: constructing cordyceps militaris genetic engineering bacteria containing hexokinase gene HK, inoculating the cordyceps militaris genetic engineering bacteria into a fermentation culture medium, and performing shaking table fermentation culture at the temperature of 22-25 ℃ and the rpm of 120-180 to obtain fermentation liquor containing cordyceps militaris extracellular polysaccharide; the culture medium of the fermentation liquid comprises the following components: glucose 20g/L, (NH)₄)₂SO₄ 7g/L，K₂HPO₄·3H₂O 0.5g/L，KH₂PO₄ 0.5g/L，MgSO₄·7H₂0.5g/L of O, 1g/L of L-glycine and distilled water as a solvent, wherein the pH is natural.

3. The application of claim 2, wherein the Cordyceps militaris genetic engineering bacteria is prepared by seamlessly cloning and connecting hexokinase gene HK and binary vector pCAMBIA to obtain a recombinant vector, and transforming the recombinant vector into a farm pole; then the strain is obtained by infecting cordyceps militaris with agrobacterium.

4. Use according to claim 3, wherein the Agrobacterium is Agrobacterium tumefaciens AGL-1.

5. The application of claim 3, wherein the Cordyceps militaris genetically engineered bacterium is constructed by the following method: (1) seamlessly cloning hexokinase gene HK and linearized binary vector pCAMBIA, connecting to obtain recombinant vector, transforming Agrobacterium, inoculating to IM culture medium containing 25 μ g/mL rifampicin and 50 μ g/mL kanamycin, culturing at 28 deg.C for 36h, and screening to obtain recombinant vectorAgrobacterium strain containing hexokinase gene HK; the IM medium: KH (Perkin Elmer)₂PO₄ 1.45g/L，K₂HPO₄2.05g/L，MgSO₄·7H₂O 0.6g/L，NaCl 0.1g/L，CaCl₂ 0.01g/L，FeSO₄ 0.001g/L，NH₄NO₃0.5g/L, 5mL/L of glycerol, 40mL/L of 1mol/L MES buffer solution with the pH value of 5.5, 5mL/L of trace element stock solution, 2g/L of glucose and distilled water as a solvent; the microelement stock solution comprises the following components: ZnSO₄·7H₂O100mg/L，CuSO₄·5H₂O 100mg/L，H₃BO₃100mg/L，Na₂MoO₄·7H₂O100mg/L, and the solvent is water; (2) inoculating the agrobacterium strain containing hexokinase gene HK into a liquid LB culture medium containing 50mg/L kanamycin, and performing shake culture at 28 ℃ and 180rpm for 36 h; transferring the culture solution into liquid AIM medium at volume concentration of 1%, and culturing at constant temperature of 180rpm and 28 deg.C until the thallus concentration OD₆₀₀Obtaining agrobacterium tumefaciens liquid by the concentration of 0.60-0.80 percent; the AIM culture medium is prepared by adding 200 mu g/mL acetosyringone into an IM culture medium; (3) inoculating wild Cordyceps militaris into a solid Sabouraud's medium, performing inverted culture at constant temperature of 25 deg.C in dark place for 7 days, repeatedly washing the surface of the solid medium with sterile water on a clean bench to obtain Cordyceps militaris bacterial suspension, and filtering the bacterial suspension to remove mycelia to obtain Cordyceps militaris spore suspension; solid saki medium: 40g/L of glucose, 10g/L of peptone, 20g/L of agar powder and distilled water as a solvent, wherein the pH value is natural; (4) mixing the agrobacterium liquid obtained in the step (2) and the cordyceps militaris spore suspension obtained in the step (3) in an equal volume manner to obtain a mixed bacterial liquid, coating the mixed bacterial liquid on the upper surface of sterile glass paper placed on the surface of a selective culture medium, carrying out constant-temperature light-shielding upright culture at 25 ℃ for 48 hours, transferring the mixed bacterial liquid and the glass paper to the surface of a new selective culture medium, pouring a layer of selective culture medium on the upper surface of the glass paper, and carrying out constant-temperature light-shielding culture at 25 ℃ for 4-5 days; selecting hypha penetrating through an upper layer selection culture medium, inoculating the hypha to a Sasa solid culture medium containing 200 mu g/mL hygromycin B, culturing at the constant temperature of 25 ℃ for 4-5 days in a dark place, and continuously carrying out subculture to obtain stably inherited cordyceps militaris genetic engineering bacteria containing hexokinase gene HK; the selective culture medium contains 200 mu g/mL hygromycin B,IM medium with 100. mu.g/mL ceftriaxone sodium and 50. mu.g/mL kanamycin.

6. The method of claim 5, wherein the Cordyceps militaris spore suspension concentration is 10⁶～10⁸/mL。

7. The method of claim 2, wherein before fermentation, the Cordyceps militaris genetically engineered bacterium containing the hexokinase gene HK is inoculated to a Sabouraud solid culture medium containing 200 μ g/mL hygromycin B, is cultured at a constant temperature of 25 ℃ for 4-5 days in a dark place, and then is picked and inoculated to the fermentation culture medium.