CN111454999A - Method for increasing content of cordyceps polysaccharide in cordyceps militaris - Google Patents
Method for increasing content of cordyceps polysaccharide in cordyceps militaris Download PDFInfo
- Publication number
- CN111454999A CN111454999A CN202010127415.0A CN202010127415A CN111454999A CN 111454999 A CN111454999 A CN 111454999A CN 202010127415 A CN202010127415 A CN 202010127415A CN 111454999 A CN111454999 A CN 111454999A
- Authority
- CN
- China
- Prior art keywords
- culture medium
- cordyceps militaris
- cordyceps
- gene
- agrobacterium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
- C12Y207/01002—Glucokinase (2.7.1.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
- C12Y207/0101—Phosphoglucokinase (2.7.1.10)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
- Botany (AREA)
- General Chemical & Material Sciences (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for improving the content of cordyceps polysaccharide in cordyceps militaris, which comprises the following steps: inoculating the cordyceps militaris recombinant strain containing the target gene into a fermentation culture medium, culturing at 22-25 ℃ and 120-180 rpm by using a shaking table to obtain fermentation liquor containing cordyceps polysaccharide; the target gene is glucokinase gene gk, phosphoglucomutase gene pgm or pyrophosphorylase gene ugp. The gene mutant strain of the cordyceps militaris is obtained by a transgenic technology, and compared with an original strain, the mutant strain has the advantage that the yield of cordyceps polysaccharide in fermentation liquor is 1.35 times, so that a foundation is laid for further screening of excellent varieties of the cordyceps militaris.
Description
(I) technical field
The invention relates to the field of cordyceps militaris cultivation, and particularly relates to a method for increasing the content of cordyceps polysaccharide in cordyceps militaris.
(II) background of the invention
As a traditional Chinese medicine, the research and application of cordyceps sinensis are always concerned. Cordyceps is a fungus-worm complex formed by parasitizing spores of fungi belonging to Ascomycoa, Hypocrea, Clavicipitaceae, Cordyceps (Cordyceps) on insect larvae and growing fruit bodies from the bodies in summer. Among them, most notably Cordyceps sinensis (Ophiococcus psinensis) parasitizing on larvae of mountain bat moth (Hepialus) and Cordyceps militaris (Cordyceps militaris) parasitizing on pupae of Lepidoptera. However, c.militaris is different from o.sinensis in that the fruiting body of c.militaris is easier to culture, and is a Cordyceps sinensis (cordyces) model strain, so it is often used as a main research object for various characteristics of Cordyceps sinensis by research teams. Natural active ingredients generated by cordyceps such as mannitol, nucleoside, amino acid, ergosterol, cordycepic acid, cordycepin, Cordyceps Polysaccharide (CP) and the like have high medicinal values for various organisms, and particularly, the cordyceps polysaccharide has the effects of protecting kidney and liver, reducing blood sugar, resisting bacteria, inflammation, tumors and arrhythmia, improving the immunity of the organism and relieving the fatigue of the organism. Cordyceps polysaccharides are divided into two distinct classes, homo-CPS and heteropolysaccharide (hetero-CPS), based on monosaccharide composition. However, wild or natural cordyceps sinensis becomes more and more scarce due to the influence of factors such as production without consequences, geographical restrictions and adverse weather conditions, so that the large-scale culture and production of cordyceps sinensis mycelia to develop cordyceps sinensis polysaccharide as a new drug with wide application is an inevitable trend.
gk. pgm and ugp are three genes on a metabolic pathway for reacting glucose in cordyceps militaris to generate activated nucleotide sugar, and the three genes are confirmed in a cordyceps militaris genome sequence. The gk, pgm and ugp genes are amplified in cordyceps militaris cells and are introduced into the genome DNA of wild cordyceps militaris, and the yield of cordyceps polysaccharide is improved by over-expressing a target gene by using a strong promoter.
The over-expression of the gene of the synthetic polysaccharide of the cordyceps militaris to improve the yield of the polysaccharide of the cordyceps militaris has not been reported in documents.
Disclosure of the invention
The invention aims to provide a method for improving the content of cordyceps polysaccharide in cordyceps militaris, a gene mutant strain of cordyceps militaris is obtained by a transgenic technology, and compared with an original strain, the mutant strain has the advantage that the yield of cordyceps polysaccharide in fermentation liquor is 1.35 times, so that a foundation is laid for further screening of excellent cordyceps militaris varieties.
The technical scheme adopted by the invention is as follows:
the invention provides a method for improving the content of cordyceps polysaccharide in cordyceps militaris, which comprises the following steps: inoculating the cordyceps militaris recombinant strain containing the target gene into a fermentation culture medium, culturing at 22-25 ℃ and 120-180 rpm by using a shaking table to obtain fermentation liquor containing cordyceps polysaccharide; the fermentation culture medium comprises the following components in percentage by weight: 2% glucose, 0.70% (NH)4)2SO4，0.05％K2HPO4·3H2O，0.05％KH2PO4，0.05％MgSO4·7H20.10 percent of L-glycine, distilled water as solvent and natural pH, wherein the target gene is glucokinase (glucokinase) gene gk, phosphoglucomutase (phosphoglucomutase) gene pgm or pyrophosphorylase (pyrophosphorylase) gene ugp.
Further, the nucleotide sequence of the glucokinase gene gk is shown as SEQ ID NO. 1; the nucleotide sequence of phosphoglucomutase gene pgm is shown as SEQ ID NO. 2; the nucleotide sequence of pyrophosphorylase gene ugp is shown in SEQ ID NO. 3.
Further, the recombinant cordyceps militaris strain containing the target gene is prepared by the following method: closely attaching a sterile cellulose film to the surface of a co-culture solid culture medium, mixing a cordyceps militaris spore suspension and an agrobacterium liquid containing a target gene in equal volume, coating the mixture on the sterile cellulose film, performing 24-DEG C constant-temperature dark co-culture for 48 hours, transferring the mixed liquid and the cellulose film to a selective culture medium, closely attaching the cellulose film to the sterile cellulose film without bubbles, pouring a layer of selective culture medium on the surface of the closely attached cellulose film, completely covering the cellulose film, and performing 22-25 ℃ (preferably 25 ℃) constant-temperature dark culture; transferring the mycelium penetrating through the upper layer selection culture medium into a subculture medium, and culturing at a constant temperature of 22-25 ℃ for 3-4 days in a dark place (preferably 25 ℃),4 days, passage 5 times), screening to obtain Cordyceps militaris containing target gene, wherein the co-culture solid medium is IM +200 mmol. L-1AS (acetosyringone), wherein the selective medium is IM (agar mass concentration is 1.5%) +200 mg. L-1Hyg B (hygromycin) +200 mg. L-1Cephalosporin +100mg L-1Kan (kanamycin), wherein the subculture medium is Sabouraud medium) +200 mg. L-1Hyg B。
Further, the cellulose film is selected from cellophane (cellophane), nitrocellulose film, etc., preferably cellophane.
Further, the cordyceps militaris spore suspension is glycerol low-temperature preservation spore suspension or freshly prepared spore suspension, and the concentration is 106～108·mL-1Preferably 106·mL-1。
Further, the cordyceps militaris spore suspension is prepared by the following method: inoculating Cordyceps militaris CM-001 (Cordycepsmithia) to PDA culture medium, culturing at 24 deg.C in dark for 7 days, repeatedly washing the surface of PDA culture medium with sterile water on a clean bench to obtain Cordyceps militaris suspension, and filtering with 4 layers of gauze to remove mycelium to obtain Cordyceps militaris spore suspension.
Further, the agrobacterium liquid OD600 of the agrobacterium liquid containing the target gene is 0.80, the agrobacterium liquid containing the target gene is prepared by the following method that the agrobacterium of the target gene is streaked and inoculated to a solid bacterial culture medium, constant-temperature culture is carried out at 28 ℃ for 48h, then a single colony is selected and inoculated to a liquid bacterial culture medium, constant-temperature culture is carried out at 180rpm and 28 ℃ for 36h, then the single colony is inoculated to an agrobacterium pre-culture liquid culture medium, constant-temperature culture is carried out at 180rpm and 28 ℃ for 6-8 h until the thallus concentration OD600 is 0.80, the agrobacterium liquid is obtained, and the solid bacterial culture medium is L B solid +25mg L-1Rif+50mg·L-1Kan (rifampicin), wherein the liquid bacterial culture medium is L B liquid plus 25 mg-L-1Rif+50mg·L-1Kan, wherein the liquid culture medium for the agrobacterium pre-culture is IM +200 mmol-L-1AS (acetosyringone).
Further, the Agrobacterium is Agrobacterium tumefaciens (Agrobacterium tumefaciens) AG L-1.
Furthermore, a layer of 1.5-2.5 mm (preferably 2.0mm) selective culture medium is arranged on the upper surface and the lower surface of the cellulose film.
Further, the cephalosporin is selected from any one of cefalotin sodium, cefalexin, ceftriaxone sodium and ampicillin.
Compared with the prior art, the invention has the following beneficial effects: the gene mutant strain of the cordyceps militaris is obtained by a transgenic technology, and compared with an original strain, the mutant strain has the advantage that the yield of cordyceps polysaccharide in fermentation liquor is 1.35 times, so that a foundation is laid for further screening of excellent varieties of the cordyceps militaris.
(IV) description of the drawings
FIG. 1 is a schematic diagram of the construction of the gene recombinant vector of the present invention.
FIG. 2 is a PCR identification diagram of the gene mutation strain of the invention, wherein M is marker, parallel 1-4 is gk, parallel 5-8 is pgm, parallel 9-12 is ugp, and WT is original strain.
FIG. 3 shows the contents of Cordyceps sinensis polysaccharides detected by the phenol sulfate method of the mutant strains and the original strain of the invention.
(V) detailed description of the preferred embodiments
The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:
the embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.
Example 1 recombinant Cordyceps militaris strains containing the Gene gk
TABLE 1 sources of materials
TABLE 2 respective culture Medium quantity Components
The PDA culture medium comprises 200 g/L g of potatoes, 20 g/L g of glucose, 15-20 g/L g of agar, distilled water as a solvent and natural pH.
The L B liquid culture medium comprises tryptone 10 g/L, yeast extract 5 g/L10 g/L, and solvent (distilled water) with pH of 7.0.
The L B solid culture medium comprises 10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl and 15-20 g/L of agar, and the solvent is distilled water and the pH value is 7.0.
The IM medium consists of: 0.145% KH2PO4，0.205％K2HPO4，0.06％MgSO4·7H2O，0.03％NaCl，0.01‰CaCl2，0.001‰FeSO4，0.05％NH4NO35m L/L glycerol, 0.2% glucose, 5m L/L microelement stock solution, 40m L/L MES buffer solution (1 mol/L, pH 5.5) and distilled water as solvent, wherein each 10ml of microelement stock solution comprises ZnSO4·7H2O 0.001g，CuSO4·5H2O 0.001g，H3BO40.001g，(NH4)2SO40.5g，MnSO4·H2O0.001g，NaMoO4·H20.001g of O, and the solvent is distilled water.
The Sha's medium comprises 10 g/L peptone, 20 g/L agar, 40 g/L glucose, distilled water as solvent, and natural pH.
1. Construction of recombinant vectors
Extracting Cordyceps militaris genome DNA, namely inoculating Cordyceps militaris (Cordyceps militaris) CGMCC 3.14242 into a PDA culture medium, carrying out inversion culture in a constant temperature incubator at 25 ℃ for 7d, adopting a fungus genome DNA rapid extraction kit (purchased from Biotechnology engineering (Shanghai) Co., Ltd., product number: B518229) and related operation instructions to extract genome DNA, namely ① taking 50-100mg of fresh fungus or 20mg of dry fruiting body or hypha, fully inverting the liquid nitrogen into powder, putting the powder into a centrifuge tube of 1.5m L, sequentially adding 400 mu L Buffer Digestion and 4 mu l β -mercaptoethanol, shaking and mixing uniformly, carrying out water bath at 65 ℃ for 1h until the cells are completely lysed, adding 200 mu l of Buffer PF into ②, fully inverting and mixing uniformly, placing in a refrigerator at 20 ℃ for 5min, carrying out centrifugation at room temperature ③ rpm for 5min, transferring supernatant (500-550 mu l) into a new centrifuge tube of 1.5ml, adding isopropanol at equal volume to 634, fully inverting PF 5min, placing for 5min, carrying out centrifugation at room temperature for 5min, standing for 5min at 10000, carrying out centrifugation at room temperature, carrying out centrifugation for 5min, carrying out centrifugation for 2min, adding ethanol extraction, carrying out centrifugation at room temperature, carrying out centrifugation for 2-10 rpm, discarding supernatant (90) for 2) for dissolving at room temperature, carrying out centrifugation, carrying out extraction, carrying out centrifugation, adding ethanol extraction, carrying out centrifugation, carrying.
PCR amplification is carried out by using the primer gk-F1/gk-R1 in Table 3 to obtain glucokinase gene gk (nucleotide is shown as SEQ ID NO. 1) on the genomic DNA of cordyceps militaris, and the nucleotide is used
The UniSeamless Cloning and Assembly Kit linked the target gene fragment to the vector PCAMBIA-PgpdA-Tcbh1-hph-PtrpC to obtain the recombinant vector PCAMBIA-PgpdA-gk-Tcbh1-hph-PtrpC, as shown in FIG. 1.
TABLE 3 primers
TABLE 4 PCR reaction System
Reaction procedure: pre-denaturation at 98 ℃ for 3min, denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 10s, extension at 72 ℃ for 30s, 3 cycles, denaturation at 98 ℃ for 10s, annealing at 65 ℃ for 10s, extension at 72 ℃ for 30s, 27 cycles, filling in at 72 ℃ for 10min, and low-temperature storage at 4 ℃.
2. Transformation of E.coli DH 5 α
Adding 6 mu L constructed recombinant vector into 100 mu L escherichia coli DH 5 α competence, placing on ice for 30min, carrying out heat shock in 42 ℃ water bath for 30s, cooling on ice for 2min, adding 800 mu L L B liquid culture medium into the competence, carrying out shake culture for 1h at 37 ℃ and 180rpm, centrifuging at 3500rpm for 10min, discarding supernatant on an ultra-clean bench, retaining 100 mu L bacterial liquid, coating the re-suspended bacterial liquid on the escherichia coli culture medium, carrying out culture for 24h at 37 ℃, picking single bacterial colony, carrying out PCR verification by using HF-check/HR-check primer, and checking whether transformation is successful or not.
Inoculating Escherichia coli positive clone into Escherichia coli liquid culture medium, extracting plasmid DNA with SanPrep column type plasmid DNA small amount extraction kit, extracting DNA with 35 μ L ddH2And dissolving the O. The extracted DNA can be immediately subjected to the next experiment or stored at-20 ℃.
3. Transformation of Agrobacterium tumefaciens
Adding 5 mu L plasmid DNA solution extracted in step 2 into 100 mu L Agrobacterium tumefaciens (Agrobacterium tumefaciens) AG L-1 competence, freezing the liquid nitrogen for 8s, carrying out water bath at 37 ℃ for 5min, adding 800 mu L L B liquid culture medium into the competence, carrying out shake culture for 1h at 28 ℃ and 180rpm, centrifuging the mixture for 10min at 3500rpm, removing supernatant on an ultra-clean bench, reserving 100 mu L bacterial solution, coating the re-suspended bacterial solution on an Agrobacterium tumefaciens culture medium, carrying out PCR verification on single colony by using HF-check/HR-check primer at 28 ℃ to verify whether the transformation is successful, and screening positive clones.
4. Transformation in homologous recombinant vector Cordyceps militaris
(1) Agrobacterium tumefaciens mediated genetic transformation of filamentous fungi
Single colonies were picked from the Agrobacterium culture medium of step 3 and inoculated into 3m L liquid L B medium (50mg L)-1Kan), 28 ℃, 180rpm, shake culture for 36 h. Transferring the strain into an agrobacterium tumefaciens pre-culture liquid culture medium, culturing at constant temperature of 28 ℃ for 6-8 h at 180rpm, and obtaining agrobacterium tumefaciens liquid with the thallus concentration OD600 being 0.80.
(2) Cordyceps militaris spore suspension
Inoculating Cordyceps militaris CM-001(Cordyceps militaris) to PDA culture medium, culturing at 24 deg.C in dark for 7 days, and repeatedly washing the surface of PDA culture medium with sterile water on a clean bench to obtain Cordyceps militaris suspension. Filtering the bacterial suspension with 4 layers of gauze to remove mycelium, and obtaining cordyceps militaris spore suspension. And (3) taking trace cordyceps militaris spore suspension, and determining the concentration of cordyceps militaris spores in the spore suspension by using a blood counting plate.
(3) Transformation of
The concentration of 200 mu L in the step (2) is 106And (3) uniformly mixing the/m L cordyceps militaris spore suspension and the agrobacterium tumefaciens bacterial liquid with OD600 of 0.80 in the step (1) in equal volume to obtain a mixed bacterial liquid.
Closely attaching sterile cellophane to the surface of a co-culture solid culture medium, uniformly coating the mixed bacteria liquid on the surface of the cellophane, carrying out constant-temperature and light-proof co-culture at 24 ℃ for 48h, transferring the mixed bacteria liquid together with the cellophane to the surface of a selection culture medium (the coating strain side is upward, the thickness of the culture medium is 2mm), pouring a layer of the selection culture medium on the surface of the cellophane to completely cover the cellophane (the thickness of the culture medium is 2mm), carrying out constant-temperature and light-proof culture at 25 ℃ for 4d, allowing the cordyceps militaris hygromycin-resistant strain hyphae to penetrate through the upper selection culture medium, picking up the hyphae penetrating through the selection culture medium, inoculating the hyphae to a subculture medium, carrying out constant-temperature and light-proof culture at 25 ℃ for 4d, carrying out transfer culture for the next generation after the hyphae grows out the subcu.
(4) Identification of hygromycin-resistant strain gene of cordyceps militaris
Extracting Cordyceps militaris hygromycin resistant strain genome DNA, and dissolving the obtained DNA with 50-100 mu l of TE Buffer. The extracted DNA can be immediately subjected to the next experiment or stored at-20 ℃. The extracted genomic DNA of the hygromycin-resistant strain of cordyceps militaris is taken, and is subjected to PCR (polymerase chain reaction) verification by using an HF-check/HR-check primer, and whether the transformation is successful is checked, wherein the result is shown in figure 2.
(5) Detection of polysaccharide content in transgenic strain
Collecting fresh spore suspension of CM-001 (WT in figure 3) and hygromycin-resistant strain of Cordyceps militaris at concentration of 106/m L, 500. mu. L were inoculatedThe fermentation medium was incubated at 25 ℃ and 120rpm for 7d with shaking.
The fermentation broth 20 μ L was diluted to 5m L with deionized water, and the total sugar content was determined by the sulfuric acid-phenol method (concentrated sulfuric acid 5m L, 5% phenol 1m L, sample 1m L) in triplicate.
Diluting 50 μ L of the fermentation broth with deionized water to 1m L, determining the concentration of glucose residue by DNS method (DNS reagent 0.5m L, water 0.25m L, sample 0.25m L, boiling water bath 5min, constant volume to 5m L), repeating the determination for three times, subtracting the content of glucose residue from the total sugar content to obtain the content of Cordyceps polysaccharide, wherein the content of Cordyceps polysaccharide is shown in Table 7 and FIG. 3.
Example 2 recombinant Cordyceps militaris strains containing the Gene pgm
The extraction of the genomic DNA of the Cordyceps militaris CGMCC 3.14242 is the same as that in example 1.
Amplifying by using primer pgm-F2/pgm-R2 to obtain phosphoglucose mutase gene pgm (SEQ ID NO.2) on Cordyceps militaris genome DNA, and using
The Uni Seamless Cloning and Assembly Kit links the target gene fragment with the plasmid to obtain the recombinant vector PCAMBIA-PgpdA-pgm-Tcbh 1-hph-PtrpC.
TABLE 5 primers
Other operations are the same as the example 1, a recombinant cordyceps militaris strain containing gene pgm is obtained, extracted genomic DNA of the hygromycin-resistant cordyceps militaris strain is taken, HF-check/HR-check primers are used for carrying out PCR verification, and whether the transformation is successful is checked, wherein the result is shown in a figure 2; and (3) measuring the total sugar content and the glucose residue concentration of the transgenic strain. The total sugar content minus the glucose residue content gave the cordycepic polysaccharide content, which is shown in table 7 and fig. 3.
Example 3 recombinant Cordyceps militaris Strain containing Gene ugp
The extraction of the genomic DNA of the Cordyceps militaris CGMCC 3.14242 is the same as that in example 1.
Amplifying by using primer ugp-F3/ugp-R3 to obtain pyrophosphorylase gene ugp on Cordyceps militaris genome DNA, and amplifying by using primer ugp-F3/ugp-R3
Linking the target gene fragment with the plasmid by the Uni SEAmless Cloning and Assembly Kit to obtain the recombinant vector PCAMBIA-PgpdA-ugp-Tcbh 1-hph-PtrpC.
TABLE 6 primers
| ugp-F3 | GCAGACATCACAATGGTTGTGGCAGGGGGGAGGAGGG |
| ugp-R3 | TTTCGCCACGGAGCTTAATGCTCAAGCAGGCGTAGCGAG |
| Plasmid-F | AGCTCCGTGGCGAAAGCCTGACGCA |
| Plasmid-R | CATTGTGATGTCTGCTCAAGCGGGGT |
| HF-check | CTATTCCTTTGCCCTCGGACGA |
| HR-check | ATGCCTGAACTCACCGCGACGT |
Other operations are the same as example 1, a recombinant cordyceps militaris strain containing gene ugp is obtained, extracted genomic DNA of the hygromycin-resistant cordyceps militaris strain is subjected to PCR verification by using HF-check/HR-check primers, and whether the transformation is successful is checked, wherein the result is shown in figure 2; and (3) measuring the total sugar content and the glucose residue concentration of the transgenic strain. The total sugar content minus the glucose residue content gave the cordycepic polysaccharide content, which is shown in table 7 and fig. 3.
TABLE 7 Cordyceps polysaccharide content of Cordyceps militaris transgenic strain and Cordyceps militaris original strain
| gk(g·L-1) | pgm(g·L-1) | ugp(g·L-1) | Cordyceps.militaris WT(g·L-1) |
| 4.25 | 4.68 | 3.91 | 3.67 |
| 3.72 | 4.85 | 3.53 | 3.31 |
| 4.05 | 4.39 | 3.75 | 3.39 |
Sequence listing
<110> Zhejiang industrial university
<120> method for increasing content of cordyceps polysaccharide in cordyceps militaris
<160>3
<170>SIPOSequenceListing 1.0
<210>1
<211>1650
<212>DNA
<213> Unknown (Unknown)
<400>1
atgggcctgc aagaagaaac caaaaaggtc gtgtcgcagt ttgaattctc cgacgcagac 60
atcaacatcc atgtcgccga attcattcag cagatgaaca ctggtctcga gcaggatggc 120
accagcgtta gccagatccc gacctacgtc actgccgtcc ccaatggcac tgaaaagggg 180
ctctatcttg ccgtcgacct cggtggcacc aacttccgcg tctgctccat catgctcaat 240
ggtgacacca ccttcaacct gacctacaac aaggttgcca tccccaagga actcatggtt 300
gccaagacag ccaaggagct ctttgctttc cttgctaagc agatcgagct cttccttcgc 360
gaacaccacg ccgatcactt cgaaagccac gtccgccgac gccacacggc cagcactccc 420
ctgggctacc gcgacgaaca cattttccgc cttggcttca cctttagctt ccctgtccag 480
cagcttggaa tcaataaggg taagcttatc cgatggacca agggcttcga tattcctgat 540
gccattggca aggatgtttg cgctctgctc caagacgaga ttgacagact gcgactcccc 600
gtcaaggtcg ctgcgctcgt caacgacact gtcggaaccc tcatggcccg ctcctatacc 660
tcagtcggca aacaccaatc gattctcggc gctatttttg gcaccggtac caatggtgcg 720
tacatggaaa agacttccaa gatcaagaag cccattaccg gcgaatacga cacttctact 780
ggtgaaatggttgtcaacac cgaatggggc tcgttcgaca accagctcaa cgttcttccc 840
gtcacacctt gggacaagaa gcttgaccag gatagtgtga acaaaggctt ccaaatgttt 900
gagaagcgca tctctggcat gtttctcggt gagattgtgc gattggctat cgtagacatg 960
cttgaaaata aatctaccgg ccttttccag gacaccaact ccagcttcaa cgatcgcgtc 1020
accaccacca gcattgaccc caagtctctg ctcttcaagc agtggggctt ggacagtgct 1080
gtcatgtcgg tcgccgccag cgacaacacc cctgagcttt ccaccctgcg acaggagttg 1140
gaaaatactt tgggcgtgta ctctgcctcg ctcgaggacg cgcaggcgtt caaggccatc 1200
tccaacgcag tcgcgcgccg cgccgctcga ctttctgctg tcgccattgg tgctattgcc 1260
atccagtccg gcaaacttga ggattctgag tgcgagctta tcgatatcgg tgtggatggt 1320
agtcttgttg agcactaccc cttcttccgc gacatgattt acgaagctct ccgagtgacg 1380
gacagcatcg gccctaaggg cgctgataag attcgcatcg gtattgccaa ggatggaagc 1440
ggtgttggcg ctgctttaat tgcgttggtt gctgctagcc gcgagcagcc tggcgatttc 1500
ctggccgact tgcgtaccga tatcaagcgc ggccttgacc gtcttcccca acacatcgag 1560
gagtcgcccc tgtcgaacaa tgctgtgctt gccattggcg ccgccgcagc cattggtgtt 1620
gcggcgttgt ggtactggag gcgtcattag 1650
<210>2
<211>1662
<212>DNA
<213> Unknown (Unknown)
<400>2
atggacgtca agactgttga gtttaagcct ttccaggacc aaaaggctgg cacctccggt 60
cttcgcaaga aggtcaccac cttccagcag gcccactaca gcgagtcttt cgttgccagc 120
cttctcctct ccatccccga aggtgtcgag ggatcctttc tcgtcatcgg tggtgatggc 180
cgctactgga accccgaggt gatccagctg attgccaaga ttggtgccgc gtacggcgtc 240
aagaagctcc tcatcggcca aaatggcatc ctgtcaaccc cggctgcgag ccatgtcatc 300
cgccttcgca aggctaccgg tggtatcctt ctgactgcca gtcacaaccc cggcggcccc 360
aaggaagact ttggcatcaa atacaacctg gccaacggtg gccccgcccc cgagtccgtg 420
acgaacaaga tctttgagac ttccaagact ttgacctcct ataagatcac ctctatcccc 480
gacattgaca ttgtcactat tggcacccag acctacggtg ctctcgaggt ggagattatt 540
gacagcacgg ccgactacgt cgctatgctc aaggacattt tcgactttgg caccatcaag 600
aagtttttcg cttcgcaccc cgacttcaag gttctctttg acggtcttca cggcgtcact 660
ggcccttatg gaaccgccat tttcgaaaag gagcttggtc ttactggcgc cacccagaac 720
tgcgtgccta gccccgactt caacggcggt caccccgatc ccaacctggt ctacgcccac 780
tctctcgtcg aagttgtcga caagcacaac attccctttg gcgccgcctc ggacggcgac 840
ggcgaccgca acatgattta cggtgccaat gcctttgtct cgcccggcga ctccctcgcc 900
atcatcgctc accacgccaa gctcattccc tacttccaga agcacggtgt taacggcctg 960
gcccgctcca tgcccacctc gggcgctgtt gacctcgtcg ccaaggcgca gggtctcgac 1020
tgctacgagg tccccaccgg ctggaagttc ttctgcgccc tctttgacgc caagaagctg 1080
tccatctgcg gcgaggagag cttcggcacg ggcagcgacc acattcgtga aaaggacggt 1140
ctctgggccg ttgtcgcctg gctcaacatc attgccgccc tcggtgtgca gaaccccgag 1200
tctacccctt ccatcaagca gatccaaaag gacttttgga cgcaatacgg acgcacattc 1260
ttcacccgct acgactacga gaatgttgac tccgacggtg ccaacaaggt tgttggcgag 1320
ctgcaggcgc tggtggctaa ccccaacact gtcggcagca agattggcga gcgcaccgtc 1380
actgccgctg gcaacttctc ctacaccgac ctcgacggct ccgtctcgtc taaccagggt 1440
ctctacgcca ccttttcctc tggcagccgc atcgtcgttc gtctctccgg caccggctcc 1500
tccggcgcga ccatccgtct ctacctcgag cagcacagca gcgaccccgc cacatacgac 1560
ctggatgccc aggacttcct caaggccgag gtcaagtttg ccacggagct tctcaagttc 1620
aaggagcatg tcggccgcga cgagcctaat gtccgcactt ga 1662
<210>3
<211>1659
<212>DNA
<213> Unknown (Unknown)
<400>3
atggttgtgg caggggggag gagggttaca gtgcagaaga gaatcacggc taccgatatc 60
tccaaacctc ccaaggtatt agttaggtac tccaagagtg ctcttccctc tcacctccgt 120
cctaccgcca ctggcaagga cgaggagaac aatggtttcg agaagcgtca tcacggcaag 180
acgcgcagcc acatggcctt tgagaacacc tctaccaatg ttgccgcggc ccagatgcgc 240
aatgccctca caaacctcgc cgagacggtc gaggacccca agcagaagaa gctcttcgaa 300
accgaaatgg acaacttctt cgctctcttc cgccgctact tgaacgacaa ggccaaggga 360
aacgtcgttg actgggaacg catccgcccc cctgctgccg gccaggtcgt cgactatgag 420
gacctcgcca actccgagtc agttcagttt ctcaacaagc ttgccgtcct caagctcaat 480
ggtggtctcg gtacctccat gggctgcgtt ggccccaagt ccgtcattga ggtccgcgac 540
ggcatgtcct tcctcgacct ttccgtccgt cagatcgagt tcctcaaccg cacatacgac 600
gtcaatgtcc ctttcctcct catgaactcg ttcaacacca acgacgatac cgctgccatc 660
atcaagaagt acgagggcca caacgtcgat atcctcacct tcaaccagtc ccgctacccc 720
agaatcttca aggactctca gctccctgtt cccagcaact acaactcggc cattagcgag 780
tggtaccctc ctggtcacgg tgacgtcttc gagtctctct acaactctgg tgttctagac 840
cagctcctcg agcgcggcat cgagatcatc ttcctctcca acgttgataa cctgggtgcc 900
gtagttgacc tgcgcatcct acagcacatg atggagacca aggccgagta cattatggaa 960
ctcaccaaca agaccaaggc cgacgttaag ggtggtacta ttatcgacta tgatggctcc 1020
gtccgcctgc tcgaaatcgc ccaggttccc aaggagcacg tgaatgactt caagtcgatt 1080
aagaagttca agtacttcaa caccaacaac atctggctca acctccgtgc tatcaagcgc 1140
gttgtcgaga acgacgagct tgagatggag attattccca atgccaagac catccctggc 1200
gacaagaagg gcgagtctga catttccatt atgcagctcg agactgctgt cggcgccgct 1260
attcgccact tcaaaaatgc ccacggtgtc aacgtccccc gtcgccgctt ccttcccgtc 1320
aagacatgct cggacctcat gctggtcaag tccgatctct acactctcaa gcacggtcag 1380
ctccagatga gcgccaaccg cttcggtgat gctcccctta tcaagcttgg tagcgacttc 1440
aagaaggtct ccgacttcca gaagcacatt ccttctatcc ccaaggttct cgagctggac 1500
cacctgacca tcaccggtgc tgtgaacctg ggccgtggtg tcacgctcaa gggcactgtt 1560
attattgtcg ccaccgaggg aagcaccatt gatatccccc ccggctctat tctcgaaaac 1620
gtcgtcgttc agggctcgct acgcctgctt gagcattaa 1659
Claims (8)
1. A method for improving the content of cordyceps polysaccharide in cordyceps militaris is characterized by comprising the following steps: inoculating the cordyceps militaris recombinant strain containing the target gene into a fermentation culture medium, culturing at 22-25 ℃ and 120-180 rpm by using a shaking table to obtain fermentation liquor containing cordyceps polysaccharide; the fermentation culture medium comprises the following components in percentage by weight: 2% glucose, 0.70% (NH)4)2SO4，0.05％K2HPO4·3H2O，0.05％KH2PO4，0.05％MgSO4·7H2O, 0.10 percent of L-glycine, distilled water as solvent, natural pH, and glucokinase gene gk, phosphoglucomutase gene pgm or pyrophosphorylase gene ugp as target genes.
2. The method according to claim 1, wherein the nucleotide sequence of glucokinase gene gk is shown in SEQ ID No. 1; the nucleotide sequence of phosphoglucomutase gene pgm is shown as SEQ ID NO. 2; the nucleotide sequence of pyrophosphorylase gene ugp is shown in SEQ ID NO. 3.
3. The method of claim 1, wherein the recombinant Cordyceps militaris strain containing a target gene is prepared by the following method:
closely attaching an aseptic cellulose film to the surface of a co-culture solid culture medium, mixing cordyceps militaris spore suspension and agrobacterium liquid containing a target gene in equal volume, coating the mixture on the aseptic cellulose film, carrying out 24-DEG C constant-temperature dark co-culture for 48 hours, transferring the mixed liquid and the cellulose film to a selective culture medium, closely attaching the cellulose film to a cellulose film without bubbles, pouring a layer of selective culture medium on the surface of the closely attached cellulose film, completely covering the cellulose film, carrying out 22-25-DEG C constant-temperature dark culture, transferring hyphae penetrating through an upper selective culture medium to a subculture medium, carrying out 22-25-DEG C constant-temperature dark culture for 3-4 days, and screening to obtain a cordyceps militaris recombinant bacterium containing the target gene, wherein the co-culture solid culture medium is IM +200 mmol-L-1The selective culture medium is IM +200 mg. L-1Hygromycin B +200 mg-L-1Cephalosporin +100mg L-1Kanamycin, wherein the subculture medium is a Sabouraud's medium +200 mg-L-1Hygromycin B.
4. The method of claim 3, wherein the Cordyceps militaris spore suspension has a concentration of 106～108·mL-1。
5. The method of claim 3, wherein the cordyceps militaris spore suspension is prepared as follows: inoculating Cordyceps militaris (Cordyceps militaris) to PDA culture medium, culturing at 24 deg.C in dark place for 7 days, repeatedly washing the surface of PDA culture medium with sterile water on a clean bench to obtain Cordyceps militaris suspension, and filtering the suspension with 4 layers of gauze to remove mycelium to obtain Cordyceps militaris spore suspension.
6. The method according to claim 3, wherein the Agrobacterium strain solution containing the target gene has an OD600 of 0.80.
7. The method of claim 3, wherein the Agrobacterium strain solution containing the target gene is prepared by streaking the Agrobacterium of the target gene into a solid bacterial culture medium, culturing at 28 ℃ for 48 hours, selecting a single colony, inoculating into a liquid bacterial culture medium, culturing at 180rpm and 28 ℃ for 36 hours, inoculating into an Agrobacterium pre-culture liquid culture medium, culturing at 180rpm and 28 ℃ for 6-8 hours until the cell concentration OD600 is 0.80, and obtaining the Agrobacterium strain solution, wherein the solid bacterial culture medium is L B solid +25mg L-1Rifampicin +50 mg-L-1Kan kanamycin, wherein the liquid bacterial culture medium is L B liquid plus 25mg L-1Rifampicin +50 mg-L-1Kanamycin, wherein the liquid culture medium for the agrobacterium preculture is IM +200 mmol-L-1Acetosyringone.
8. The method according to claim 3, wherein the Agrobacterium is Agrobacterium tumefaciens (Agrobacterium tumefaciens) AG L-1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010127415.0A CN111454999B (en) | 2020-02-28 | 2020-02-28 | Method for increasing content of cordyceps polysaccharide in cordyceps militaris |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010127415.0A CN111454999B (en) | 2020-02-28 | 2020-02-28 | Method for increasing content of cordyceps polysaccharide in cordyceps militaris |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111454999A true CN111454999A (en) | 2020-07-28 |
| CN111454999B CN111454999B (en) | 2022-12-09 |
Family
ID=71677821
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010127415.0A Active CN111454999B (en) | 2020-02-28 | 2020-02-28 | Method for increasing content of cordyceps polysaccharide in cordyceps militaris |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111454999B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111349648A (en) * | 2020-02-28 | 2020-06-30 | 浙江工业大学 | Method for introducing agrobacterium-mediated exogenous gene into cordyceps militaris cells |
| CN111518825A (en) * | 2020-04-30 | 2020-08-11 | 浙江工业大学 | Method for preparing cordyceps militaris polysaccharide through polygene combined expression |
| CN113151017A (en) * | 2021-03-30 | 2021-07-23 | 浙江工业大学 | Recombinant cordyceps militaris for over-expressing cordycepin |
| CN114426995A (en) * | 2022-01-26 | 2022-05-03 | 浙江工业大学 | Method for improving yield of cordyceps militaris extracellular polysaccharide by over-expression of hexokinase gene HK |
| CN111454999B (en) * | 2020-02-28 | 2022-12-09 | 浙江工业大学 | Method for increasing content of cordyceps polysaccharide in cordyceps militaris |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101691570A (en) * | 2009-02-26 | 2010-04-07 | 上海交通大学 | Cordyceps militaris glyceraldehyde-3-phosphate dehydrogenase gene promoter |
| CN104031850A (en) * | 2014-05-21 | 2014-09-10 | 广东省昆虫研究所 | Engineering bacteria with inactivated cordyceps militaris Rhf1 gene and application of cordyceps militaris Rhf1 gene |
| CN111518825A (en) * | 2020-04-30 | 2020-08-11 | 浙江工业大学 | Method for preparing cordyceps militaris polysaccharide through polygene combined expression |
| CN113151017A (en) * | 2021-03-30 | 2021-07-23 | 浙江工业大学 | Recombinant cordyceps militaris for over-expressing cordycepin |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111454999B (en) * | 2020-02-28 | 2022-12-09 | 浙江工业大学 | Method for increasing content of cordyceps polysaccharide in cordyceps militaris |
-
2020
- 2020-02-28 CN CN202010127415.0A patent/CN111454999B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101691570A (en) * | 2009-02-26 | 2010-04-07 | 上海交通大学 | Cordyceps militaris glyceraldehyde-3-phosphate dehydrogenase gene promoter |
| CN104031850A (en) * | 2014-05-21 | 2014-09-10 | 广东省昆虫研究所 | Engineering bacteria with inactivated cordyceps militaris Rhf1 gene and application of cordyceps militaris Rhf1 gene |
| CN111518825A (en) * | 2020-04-30 | 2020-08-11 | 浙江工业大学 | Method for preparing cordyceps militaris polysaccharide through polygene combined expression |
| CN113151017A (en) * | 2021-03-30 | 2021-07-23 | 浙江工业大学 | Recombinant cordyceps militaris for over-expressing cordycepin |
Non-Patent Citations (6)
| Title |
|---|
| NONE: "Cordyceps militaris CM01 phosphoglucomutase 2 (CCM_02278)，partial mRNA", 《GENBANK DATABASE》 * |
| NONE: "Cordyceps militaris CM01 UTP-glucose-1-phosphate uridylyltransferase (CCM_06235)，partial mRNA", 《GENBANK DATABASE》 * |
| WANG 等: "Homologous overexpression of genes in Cordyceps militaris improves the production of polysaccharides", 《FOOD RESEARCH INTERNATIONAL》 * |
| ZHU 等: "Influence of fermentation conditions on polysaccharide production and the activities of enzymes involved in the polysaccharide synthesis of Cordyceps militaris", 《APPL MICROBIOL BIOTECHNOL》 * |
| 乔宇琛 等: "蛹虫草的分子生物研究进展", 《食品科学》 * |
| 徐妍: "农杆菌介导蛹虫草多糖生物合成关键酶基因的克隆与表达", 《中国优秀博硕士学位论文全文数据库(硕士)工程科技Ⅰ辑》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111349648A (en) * | 2020-02-28 | 2020-06-30 | 浙江工业大学 | Method for introducing agrobacterium-mediated exogenous gene into cordyceps militaris cells |
| CN111454999B (en) * | 2020-02-28 | 2022-12-09 | 浙江工业大学 | Method for increasing content of cordyceps polysaccharide in cordyceps militaris |
| CN111518825A (en) * | 2020-04-30 | 2020-08-11 | 浙江工业大学 | Method for preparing cordyceps militaris polysaccharide through polygene combined expression |
| CN111518825B (en) * | 2020-04-30 | 2022-10-11 | 浙江工业大学 | Method for preparing cordyceps militaris polysaccharide through polygene combined expression |
| CN113151017A (en) * | 2021-03-30 | 2021-07-23 | 浙江工业大学 | Recombinant cordyceps militaris for over-expressing cordycepin |
| CN114426995A (en) * | 2022-01-26 | 2022-05-03 | 浙江工业大学 | Method for improving yield of cordyceps militaris extracellular polysaccharide by over-expression of hexokinase gene HK |
| CN114426995B (en) * | 2022-01-26 | 2024-03-26 | 浙江工业大学 | Method for improving yield of extracellular polysaccharide of cordyceps militaris by utilizing over-expressed hexokinase gene HK |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111454999B (en) | 2022-12-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111454999B (en) | Method for increasing content of cordyceps polysaccharide in cordyceps militaris | |
| CN111518825B (en) | Method for preparing cordyceps militaris polysaccharide through polygene combined expression | |
| CN113151017A (en) | Recombinant cordyceps militaris for over-expressing cordycepin | |
| Yamazaki et al. | A new acidophilic fungus Teratosphaeria acidotherma (Capnodiales, Ascomycota) from a hot spring | |
| CN111454924B (en) | Trichoderma viride histone acetylase encoding gene TvGCN5 and application thereof | |
| CN110669773A (en) | Application of gene FoPDCD5 in regulation and control of pathogenicity of banana fusarium oxysporum | |
| CN111534527A (en) | Application of gene FoPao in regulation and control of pathogenicity of banana vascular wilt | |
| CN107937297B (en) | Multi-inhibitor stress tolerance saccharomyces cerevisiae, and preparation method and application thereof | |
| CN114426995B (en) | Method for improving yield of extracellular polysaccharide of cordyceps militaris by utilizing over-expressed hexokinase gene HK | |
| Tan et al. | Diversity and high nitrogenase activity of endophytic diazotrophs isolated from Oryza rufipogon Griff. | |
| Li et al. | Establishment of an Agrobacterium tumefaciens-mediated transformation system for Tilletia foetida | |
| Liu et al. | Agrobacterium tumefaciens-mediated transformation: An efficient tool for insertional mutagenesis and targeted gene disruption in Harpophora oryzae | |
| Hashem et al. | Indigenous yeasts of the rotten date fruits and their potentiality in bioethanol and single-cell protein production. | |
| CN105349441B (en) | High sporogenic Trichoderma T23-Ovel1 bacterial strain and its construction method | |
| CN109609540B (en) | Recombinant saccharomyces cerevisiae strain and preparation method and application thereof | |
| CN109136100B (en) | Aspergillus tubingensis strain and application thereof in fermenting green brick tea | |
| Kemppainen et al. | Transformation of the mycorrhizal fungus Laccaria bicolor using Agrobacterium tumefaciens | |
| CN113174352B (en) | Bacillus subtilis HF1 mutant and construction method and application thereof | |
| CN110982715A (en) | Purple spore bacterium gene engineering bacterium delta PlflbD with high spore yield as well as construction method and application thereof | |
| CN112501053B (en) | Bacillus amyloliquefaciens HBNS-1, application thereof and agricultural fertilizer prepared from same | |
| YANG et al. | Establishment of Agrobacterium tumefaciens-mediated transformation system for rice sheath blight pathogen Rhizoctonia solani | |
| Kachalkin et al. | Zygotorulaspora dagestanica sp. nov., a novel ascomycetous yeast species associated with the Georgian honeysuckle (Lonicera iberica M. Bieb.) | |
| CN101525580B (en) | Amphiploid histidine auxotroph saccharomyces cerevisiae and constructing method thereof | |
| CN117448350B (en) | Application of Phellinus linteus Pb-bHLH9 gene in improving multiple stress resistance of Saccharomyces cerevisiae | |
| CN107129996A (en) | One plasmid vector and its construction method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |