CN110669773A - The application of gene FoPDCD5 in regulating the pathogenicity of Fusarium oxysporum in banana - Google Patents

Abstract

The invention discloses an application of a gene FoPDCD5 in regulation and control of pathogenicity of banana vascular wilt, and belongs to the field of plant genetic engineering. The gene is knocked out from banana fusarium oxysporum by using a homologous recombination method to obtain a knock-out mutant delta Fopdcd 5; introducing a gene complementation vector into a delta Fopdcd5 protoplast by constructing the vector; the gene was complemented back into the knockout mutant by random insertion to obtain the complementing mutant Δ Fopdcd 5-com. Pathogenicity assays indicate that the pathogenicity of the knockout mutant Δ Fopdcd5 is significantly reduced; the pathogenicity of the anaplerotic mutant Δ Fopdcd5-com was restored to wild-type levels. The invention proves that the FoPDCD5 is necessary for generating conidia of the fusarium oxysporum f.sp.cubense, and coping with oxidative stress and pathogenicity. Contributes to deeply clarifying the pathogenic molecular mechanism of the banana fusarium wilt and provides a target gene for developing an effective bactericide.

Description

The application of gene FoPDCD5 in regulating the pathogenicity of Fusarium oxysporum in banana

technical field

The invention belongs to the field of plant genetic engineering, and particularly relates to the application of a gene FoPDCD5 in regulating the pathogenicity of Fusarium wilt of banana.

Background technique

Banana fusarium wilt is one of the most important diseases in banana production in my country, which seriously threatens the sustainable development of banana industry. The pathogen of banana fusarium wilt is Fusarium oxysporum f.sp.cubense (Foc), which can be divided into 3 physiological races according to their different susceptibility to the host, among which the 4th physiological race (Foc4) is the most serious and can damage almost all cultivars at present. At present, the control of banana fusarium wilt is mainly based on the selection of resistant varieties. However, because most cultivated bananas are triploid, highly sterile and have no seeds, conventional cross-breeding of bananas is very difficult. Fully excavating the pathogenic genes of Fusarium wilt and carrying out functional research will help to fully understand the pathogenic molecular mechanism of Fusarium wilt and provide a theoretical basis for the prevention and control of Fusarium wilt.

PDCD5 (Program Cell Death Protein 5) is an apoptosis-accelerating protein that contains a DNA-binding domain and is highly conserved in evolution. The current research on PDCD5 protein mainly focuses on human cancer cells, and its main role is to regulate programmed cell death and immune regulation. There is no report on the specific function of PDCD5 in phytopathogenic fungi. In a proteomic study of Fusarium wilt, we identified a predicted protein, ProgramCell Death Protein 5, predicted, whose function in Fusarium wilt is unknown.

SUMMARY OF THE INVENTION

In order to overcome the shortcomings and deficiencies of the prior art, the purpose of the present invention is to provide an application of a gene FoPDCD5 in regulating the pathogenicity of Fusarium wilt of banana.

The invention discloses a new function of a banana Fusarium wilt gene FoPDCD5 and its encoded protein PDCD5. The gene FoPDCD5 is the nucleotide sequence shown in SEQ ID NO: 1, and the encoded protein PDCD5 is the protein shown in SEQ ID NO: 2; the PDCD5 protein contains one DNA-binding domain. In the present invention, a gene knockout vector is constructed and introduced into the protoplast of Fusarium oxysporum wilt; the homologous recombination method is used to knock out the gene from Fusarium oxysporum wilt to obtain a knockout mutant ΔFopdcd5; The ΔFopdcd5 protoplast was introduced; the gene was backfilled into the knockout mutant by random insertion to obtain the complemented mutant ΔFopdcd5-com. Knockout mutants of this gene are defective in conidia production and response to oxidative stress. Pathogenicity assays showed that the pathogenicity of the knockout mutant ΔFopdcd5 was significantly reduced; the pathogenicity of the apoplectic mutant ΔFopdcd5-com was restored to the wild-type level. The above test proved that Fusarium oxysporum FoPDCD5 is a pathogenic related gene of Fusarium oxysporum.

The object of the present invention is achieved through the following technical solutions:

The invention provides the application of a gene FoPDCD5 in regulating the pathogenicity of Fusarium wilt of banana.

Further, the application of the gene FoPDCD5 in regulating the sporulation of Fusarium oxysporum.

Further, the application of the described gene FoPDCD5 in regulating the stress resistance of Fusarium wilt;

Preferably, the stress is oxidative stress.

The invention provides the application of a gene FoPDCD5 in preventing and treating banana fusarium wilt caused by Fusarium wilt of banana.

The present invention provides the application of a gene FoPDCD5 as a target for a plant disease control drug, wherein the plant disease is banana fusarium wilt caused by Fusarium oxysporum.

The present invention further provides a method for treating Fusarium wilt of banana caused by Fusarium wilt, comprising blocking or inhibiting the expression of gene FoPDCD5 in Fusarium wilt (for example, using antisense RNA or siRNA of the gene, etc.).

The application of an agent for blocking or inhibiting the expression of the gene FoPDCD5 in Fusarium oxysporum (for example, using antisense RNA or siRNA of the gene, etc.) in the preparation of a medicine for controlling Fusarium wilt disease of banana caused by Fusarium oxysporum.

Wherein, the Fusarium oxysporum gene FoPDCD5, its amino acid sequence is as shown in SEQ ID NO:2, or the amino acid sequence shown in SEQ ID NO:2 is obtained by one or more amino acid replacement, insertion, deletion An analog that still has the function of controlling the virulence of Fusarium wilt of banana;

Described gene FoPDCD5, its nucleotide sequence is one of following A, B, C:

A. The DNA sequence encoding the amino acid sequence shown in SEQ ID NO: 2;

B. DNA sequence as shown in SEQ ID NO: 1;

C, the above A and B obtained by base insertion, deletion or replacement and still have the analog that controls the virulence function of Fusarium oxysporum sp.;

Further, the banana Fusarium wilt is No. 4 physiological race (Foc4) of Fusarium oxysporum.

The application of the knockout vector and recombinant bacteria containing the above-mentioned gene FoPDCD5 in the above-mentioned aspects also belongs to the protection scope of the present invention.

Compared with the prior art, the present invention has the following advantages and effects:

The gene FoPDCD5 of Fusarium oxysporum provided by the present invention contains one DNA-binding domain, but its biological function in Fusarium oxysporum is not clear. The hygromycin phosphotransferase gene (hph) and the fluorescent protein gene (SGFP) were replaced by the gene FoPDCD5 encoding the protein PDCD5 to obtain the Foc4 knockout mutant ΔFopdcd5; the experiment proved that compared with the Foc4 wild type, the spore production of ΔFopdcd5 was significantly reduced, It is more sensitive to oxidative stress. The pathogenicity test shows that the deletion of FoPDCD5 significantly reduces the pathogenicity of Fusarium oxysporum. After the gene is replenished, its pathogenicity is restored. The present invention confirms that FoPDCD5 is necessary for conidium production of Fusarium oxysporum, coping with oxidative stress and pathogenicity. Our research helps to elucidate the pathogenic molecular mechanism of Fusarium wilt and provides target genes for the development of effective fungicides.

Description of drawings

Figure 1 is a schematic diagram of the construction of the Fusarium wilt gene FoPDCD5 knockout vector.

FIG. 2 is a schematic diagram of the construction of the FoPDCD5 complementing vector for the Fusarium wilt gene of banana.

Figure 3 shows the PCR amplification of the A-hph gene of some hygromycin-resistant transformants; M: Marker5000; lane 1: pCT74 plasmid; lanes 2-6: transformants 1, 2, 3, 4, and 5.

Figure 4 shows the PCR amplification of the target gene FoPDCD5 of some hygromycin-resistant transformants; M: Marker5000; lane wt: Foc4 wild type; lane 1-3: transformants 1, 2, and 5.

Figure 5 is a Southern blot analysis of Foc4 knockout transformants using the FoPDCD5 fragment as a probe;

Figure 6 is a Southern blot analysis of Foc4 knockout transformants using hph fragments as probes;

Figure 7 is the analysis of the knockout mutant ΔFopdcd5 under different stress conditions.

8 is a PCR analysis of the FoPDCD5 gene of some bleomycin-resistant transformants; M: Marker5000; lane 1: Foc4 wild type; lanes 2-5: transformants 1, 2, 5, and 7.

Figure 9 shows the pathogenicity analysis of the knockout mutant ΔFopdcd5 and the apoplectic mutant ΔFopdcd5-com.

Detailed ways

The present invention will be described in further detail below with reference to the embodiments and the accompanying drawings, but the embodiments of the present invention are not limited thereto.

The test methods that do not specify specific experimental conditions in the following examples are usually in accordance with conventional experimental conditions or in accordance with experimental conditions suggested by the manufacturer. The materials, reagents, etc. used, unless otherwise specified, are the reagents and materials obtained from commercial sources.

Example 1

1. Experimental materials

1.1 Test strains and plants

The tested strain was F. fusarium wilt No. 4 physiological race (Foc4), and the tested plant was Brazil banana (Cavendish, AAA) with 4-5 leaves.

1.2 Host bacteria and plasmid vector

The cloning vector is pMD18-T vector, the gene knockout vector is the filamentous fungal expression vector pCT74, and the gene complementing vector is pCTZN (which was transformed from the pCT74 plasmid in our laboratory, that is, the SGFP and hph genes on pCT74 were replaced with Bo lyomycin (Zeocin) gene).

2. Experimental method

2.1 Amplification of upstream and downstream homologous fragments of Fusarium oxysporum FoPDCD5

The construction of the Fusarium oxysporum FoPDCD5 gene knockout vector is shown in Figure 1. Sequences with a length of about 1500 bp (named as homology arm A fragment and homology arm B fragment respectively) were selected upstream and downstream of the FoPDCD5 gene, and primers were designed (Table 1).

Table 1 Amplification primers for the A and B fragments of the homology arm of the FoPDCD5 gene

primer name Primer sequence 5'-3' Restriction sites FoPDCD5-AF GG<u>GGTACC</u>GAACAGGGATTCTGTTAAGCAGTTC Kpn I FoPDCD5-AR CC<u>GGGCCC</u>GATCTTGATACGTGACGTTCTTTAA ApaI FoPDCD5-BF G<u>GAATTC</u>GAGGTGCTTGTGATACCATGGAATT EcoR I FoPDCD5BR G<u>ACTAGT</u>CGTCATGTCGTTTTTCGATCCCCTAT SpeI

Foc4 genomic DNA was extracted with a fungal DNA extraction kit (OMEGA Fungal DNA Kit); using the genomic DNA as a template, PCR amplification was performed with primers FoPDCD5-AF and FoPDCD5-AR to obtain the homology arm A fragment of the FoPDCD5 gene (FoPDCD5 -A); PCR amplification was performed with primers FoPDCD5-BF and FoPDCD5-BR to obtain the homology arm B fragment (FoPDCD5-B) of the FoPDCD5 gene.

The specific PCR reaction system is:

template DNA 1.0μL FoPDCD5-AF/BF(10μmol/L) 1.0μL FoPDCD5-AR/BR (10μmol/L) 1.0μL 10×Taq Buffer(Mg²⁺plus) 5.0μL dNTPs(2.5mmol/L) 4.0μL Taq(5U/μL) 0.5μL ddH₂O 37.5μL Total 50.0μL

PCR reaction conditions were: 94°C for 5 min; 94°C for 1 min, 67°C for 1 min, 72°C for 1 min, a total of 35 cycles; 72°C for 10 min. The PCR amplification products were cleaned and recovered using the OMEGA Cycle Pure Kit.

2.2 Construction of FoPDCD5 gene knockout vector

Referring to the instructions of the pMD 18-T Vector Cloning Kit (TakaRa Company), FoPDCD5-A and FoPDCD5-B were respectively ligated with T vector to obtain recombinant plasmids pMD18T-FoPDCD5-A and pMD18T-FoPDCD5-B. Specifically: take 1 μL of pMD 18-T vector, add 4 μL of the above PCR recovery product (homologous arm A fragment or homology arm B fragment) and 5 μL solution I respectively, and connect at 16°C overnight. Take 10 μL of the ligation product and add it to 100 μL of E. coli DH 5α competent cells, place on ice for 30 min; heat shock in a water bath at 42 °C for 90 s, and cool on ice for 5 min; add 800 μL of LB liquid medium, and shake at 37 °C and 150 rpm for 45 min; Centrifuge at 4000 rpm for 5 min, discard the supernatant, leave 100 μL of bacterial solution and mix with the precipitate, spread on LB solid medium (containing 50 μg/mL Amp), and culture at 37°C for 8-12 h.

The positive transformants with Amp resistance were picked, and the recombinant plasmid DNA was extracted and identified by sequencing. The pMD18T-FoPDCD5-A and pCT74 vectors were double digested with Kpn I and ApaI, respectively, and the A fragment and the pCT74 vector were recovered. The A fragment was ligated with pCT74 with T4 DNA ligase and transformed into E. coli DH5α; the recombinant plasmid pCT74-FoPDCD5-A was obtained. According to the same procedure, pMD18T-FoPDCD5-B and recombinant plasmid pCT74-FoPDCD5-A were double digested with EcoRI and SpeI, and the B fragment and recombinant plasmid were recovered. The B fragment was ligated with pCT74-FoPDCD5-A with T4 DNA ligase, and transformed into Escherichia coli DH5α; the gene knockout vector pCT74-FoPDCD5-KO was obtained by restriction enzyme digestion.

2.3 Amplification of FoPDCD5 complement fragment

Figure 2 shows the construction of the FoPDCD5 gene complementation vector of Fusarium oxysporum. A promoter sequence with a length of 1500 bp was selected upstream of the FoPDCD5 gene, a terminator sequence with a length of 500 bp was selected downstream, and primers were designed (Table 2).

Table 2 Amplification primers for the complemented fragment of the FoPDCD5 gene

primer name Primer sequence 5'-3' Restriction sites FoPDCD5-comF G<u>GAATTC</u> GCGCCATCACGGCCA EcoR I FoPDCD5-comR G<u>ACTAGT</u>TAGGCGTTCATTCATTATTTCCGT SpeI

Using the fungal DNA extraction kit (OMEGA Fungal DNA Kit), the genomic DNA of Fusarium oxysporum was extracted; using the genomic DNA as a template, PCR amplification was carried out with primers FoPDCD5-comF and FoPDCD5-comR to obtain the complement fragment of the FoPDCD5 gene (FoPDCD5 -com).

The specific PCR reaction system is:

template DNA 1.0μL FoPDCD5-comF (10μmol/L) 1.0μL FoPDCD5-comR (10μmol/L) 1.0μL 10×Taq Buffer(Mg²⁺plus) 5.0μL dNTPs(2.5mmol/L) 4.0μL ExTaq(5U/μL) 0.5μL ddH₂O 37.5μL Total 50.0μL

PCR reaction conditions were: 94°C for 5 min; 94°C for 1 min, 60°C for 1 min, 72°C for 4 min, a total of 30 cycles; 72°C for 10 min. The PCR amplification products were cleaned and recovered using the OMEGA Cycle Pure Kit.

2.4 Construction of FoPDCD5 gene complement vector

The FoPDCD5-com and pCTZN vectors were double digested with EcoR I and SpeI, respectively, and the FoPDCD5-com fragment and the pCTZN vector were recovered. The FoPDCD5-com fragment was ligated with pCTZN with T4 DNA ligase and transformed into E. coli DH5α; the recombinant plasmid pCTZN-FoPDCD5-com was obtained. The gene complement vector pCTZN-FoPDCD5-com was obtained by restriction enzyme digestion.

2.5 Preparation of Foc4 protoplasts

Foc4 was inoculated into Char's medium (FeSO ₄ .7H ₂ O 0.018g, KCl 0.5g, K ₂ HPO ₄ .3H ₂ O 1g, MgSO ₄ .7H ₂ O 0.5g, NaNO ₃ 3g, sucrose 30g, distilled water to 1 L), shake and culture at 28°C and 150 rpm for 3 days; filter the culture solution with a 200-mesh cell sieve, centrifuge at 10,000 × g for 10 min at 4°C, and discard the supernatant. Use NCM medium (glucose 10g, aspartic acid 4g, 20× nitrate 50mL, 1000×vitamin 1mL, 1000×trace element 1mL, 200×iron salt 5mL, make up to 1L, pH 6.5) to resuspend the pellet and carry out After dilution, a Foc4 conidia suspension was prepared. The prepared conidia suspension was inoculated into NCM medium, so that the final concentration of conidia was 1 × 10 ⁶ /mL; at 28 ° C, 120 rpm was shaken for 11 to 12 hours, filtered with a 200-mesh cell sieve, and the 0.8mol/L NaCl solution (osmotic pressure stabilizer) was washed 3 to 5 times to obtain fresh mycelium. According to the ratio of enzyme solution to mycelium (volume-to-mass ratio 10:1), an appropriate amount of 15g/L crash enzyme solution was added, and enzymatic hydrolysis was carried out at 30°C and 120 rpm for 3 hours to obtain protoplast enzymatic hydrolysis solution. Centrifuge at 400 × g for 10 min at 4°C and discard the supernatant. Add 1 mL of pre-cooled STC solution (containing 10 mmol/L Tris-HCl (pH 7.5), 1.2 mol/L sorbitol, 50 mmol/L CaCl ₂ ) to resuspend the pellet; centrifuge, and discard the supernatant. Then 10-20 mL of pre-cooled STC was added to resuspend the precipitate to obtain a Foc4 protoplast suspension, so that the final protoplast concentration was about 1×10 ⁷ /mL.

Fusarium wilt of banana knockout mutant protoplast is prepared by referring to the above-mentioned preparation steps of Fusarium wilt of banana protoplast.

2.6 Transformation of Foc4 knockout mutant protoplasts

The knockout vector pCT74-FoPDCD5-KO was double digested with Kpn I and SpeI to obtain the A-hph-sgfp-B fragment. Mix 5 μg of A-hph-sgfp-B fragment with 200 μL of protoplasts; alternatively, mix pCTZN-FoPDCD5-com plasmid with 200 μL of Fusarium wilt knockout mutant protoplasts; ice bath for 15 min; add 1 mL of PSTC dropwise Transformation buffer (40% PEG4000, 1.2 mol/L sorbitol, 50 mmol/L CaCl ₂ , 10 mmol/L Tris-HCl, pH 7.5), mix well and place on ice for 15 min; add 10 mL of pre-cooled STC, mix well ; Centrifuge at 4000 rpm for 15 min at 4 °C; remove 6 mL of supernatant, resuspend the pellet with 3 mL of PSB regeneration medium (200.0 g of potato, 273.6 g of sucrose, and dilute to 1 L with distilled water), and culture with shaking at 28 °C and 100 rpm for 12 h to 16 h. Centrifuge at 4000 rpm for 15 min at 4°C, remove 5 mL of supernatant, add 12 mL of PSA regeneration medium (add 1.5% agar powder, 150 μg/mL hygromycin or 200 μg/mL bleomycin to PSB regeneration medium), mix and pour plate, cultured at 28°C in the dark for 2-3 days; pick hygromycin (or bleomycin) resistant transformants and transfer to PDA containing 150 μg/mL hygromycin (or 200 μg/mL bleomycin) for culture base (containing 200.0 g of potato, 20.0 g of anhydrous glucose, 15.0 g of agar, and distilled water to 1 L), cultured at 28°C in the dark for 3-4 d, and picked a single colony for identification.

2.7 PCR validation analysis of Foc4 knockout mutants

According to the instructions of the fungal DNA extraction kit (OMEGA Fungal DNA Kit), the genomic DNA of the above-mentioned hygromycin-positive transformants was extracted and analyzed by PCR for verification. PCR amplification of A-hph gene fragment was performed with primers A-hph-F/A-hph-R respectively; PCR amplification analysis of FoPDCD5 gene fragment was performed with primers FoPDCD5-F/FoPDCD5-R.

A-hph-F: 5′-GCCTGAAGAAGTTCTGCTACCGCCG-3′,

A-hph-R: 5′-TGGCAAACTGTGATGGACGACACCG-3′,

FoPDCD5-F: 5′-ATGGATGACGCAGATTAGAACAGG-3′,

FoPDCD5-R: 5′-TTACAGATCCAAATCGTCATCATCG-3′;

The PCR reaction system is as follows:

template DNA 0.5μL FoPDCD5-F/A-hph-F (10μmol/L) 0.5μL FoPDCD5-R/A-hph-R (10μmol/L) 0.5μL 10×Taq Buffer(Mg²⁺plus) 2.5μL dNTPs(2.5mmol/L) 2.0μL Taq(5U/μL) 0.25μL ddH₂O 18.75μL Total 25.0μL

PCR reaction conditions were: 94°C for 5 min; 94°C for 1 min, 56°C for 1 min, 72°C for 1 min, a total of 30 cycles; 72°C for 10 min to obtain the amplified product.

2.8 Southern blot analysis of Foc4 knockout mutants

Southern blot hybridization was performed according to the instructions of DIG High Prime DNA Labeling and Detection Starter Kit I (Roche Company). Use primers FoPDCD5-F/FoPDCD5-R to amplify the target gene probe, and use hph-F/hph-R to amplify the hph gene probe.

FoPDCD5-F: 5′-ATGGATGACGCAGATTAGAACAGG-3′,

FoPDCD5-R: 5′-TTACAGATCCAAATCGTCATCATCG-3′,

hph-F: 5′-TGCTGCTCCATACAAGCCAA-3′,

hph-R: 5′-GACATTGGGGAGTTCAGCGA-3′;

The PCR amplification system of the DNA probe is as follows:

template DNA 1.0μL FoPDCD5-F/hph-F (20μmol/L) 1.0μL FoPDCD5-R/hph-R(20μmol/L) 1.0μL 10×Ex Taq Buffer(Mg²⁺plus) 5.0μL dNTPs(2.5mmol/L) 4.0μL Ex Taq (5U/μL) 0.5μL ddH₂O 37.5μL Total 50.0μL

PCR reaction conditions were: 94°C for 5 min; 94°C for 1 min, 56°C for 1 min, 72°C for 1 min, a total of 30 cycles; 72°C for 10 min to obtain the amplified product.

2.9 Phenotypic observation of Foc4 knockout mutants

(1) Observation of colony morphology and determination of growth rate. Foc4 wild-type and knockout mutant ΔFopdcd5 were inoculated on PDA medium and cultured at 28°C in the dark. Colony diameters were measured at 1d, 3d, 5d, and 7d, respectively, and the colony morphology was observed.

(2) The production and germination of conidia were observed. Fusarium wilt of banana was inoculated into Cha's medium, placed at 28°C and cultured with shaking at 120 rpm, and the spore production was counted after 7 days. The conidia suspension was inoculated into NCM medium, cultured with shaking at 28° C. and 120 rpm, and samples were taken at 11 h to observe the germination of conidia.

2.10 Stress resistance analysis of knockout mutant ΔFopdcd5

(1) Analysis of hyperosmotic stress

The Foc4 wild-type and ΔFopdcd5 were inoculated on PDA medium containing 1 mol/L NaCl and 1 mol/L sorbitol, respectively, and the colony growth of ΔFopdcd5 and wild-type strains was observed after culturing upside down in a 28°C incubator for 7 days.

(2) Analysis of oxidative stress

The wild-type and knockout mutant ΔFopdcd5 of Fusarium oxysporum were inoculated on PDA medium containing 50 mmol/LH ₂ O ₂ and cultured upside down in an incubator at 28°C for 7 days to observe the colony growth of ΔFoPdcd5 and wild-type strains.

(3) Analysis of cell wall integrity

The wild-type and knock-out mutant ΔFopdcd5 of Fusarium oxysporum were inoculated on PDA medium containing 0.02% SDS, respectively, and the colony growth of ΔFopdcd5 and wild-type strains was observed after culturing upside down in a 28°C incubator for 7 days.

2.11 PCR identification and phenotypic analysis of FoPDCD5 aplasia mutants

(1) PCR identification of FoPDCD5 apoplectic mutants

According to the instructions of the fungal DNA extraction kit (OMEGA Fungal DNA Kit), the genomic DNA of the above-mentioned bleomycin-positive transformants was extracted and analyzed by PCR. PCR amplification of the gene fragment FoPDCD5 was performed with primers FoPDCD5-F/FoPDCD5-R.

The PCR reaction system is as follows:

template DNA 0.5μL FoPDCD5-F (10μmol/L) 0.5μL FoPDCD5-R (10μmol/L) 0.5μL 10×Taq Buffer(Mg²⁺plus) 2.5μL dNTPs(2.5mmol/L) 2.0μL Taq(5U/μL) 0.25μL ddH₂O 18.75μL Total 25.0μL

PCR reaction conditions were: 94°C for 5 min; 94°C for 1 min, 56°C for 1 min, 72°C for 1 min, a total of 30 cycles; 72°C for 10 min to obtain the amplified product.

(2) Phenotypic analysis of FoPDCD5 complementation mutants

1) Observation of colony morphology. Foc4 wild-type, knockout mutants and complement mutants were inoculated on PDA medium and cultured at 28°C in the dark. The colony diameter was measured at 7d, and the colony morphology was observed.

2) Analysis of spore production. The wild-type, knockout mutant and apoplectic mutant of Fusarium oxysporum were inoculated into Chad's medium, placed at 28°C and cultured with shaking at 120 rpm, and the spore production was counted after 7 days.

2.12 Pathogenicity analysis of knockout mutant ΔFopdcd5 and apoplectic mutant ΔFopdcd5-com

Brazil bananas at the 4-leaf stage were taken, and the conidia (2×10 ⁵ /mL) suspensions of Foc4 wild type, knockout mutant ΔFopdcd5 and apoplectic mutant ΔFopdcd5-com were used for root immersion for 30 min, and then transplanted in In nutrient soil; cultivated in a plant culture room at 25±1°C, alternately cultured in light/dark 12h/12h, and observed the disease on leaves and bulbs of banana seedlings after 25d.

3 Results and Analysis

3.1 Construction of Fusarium oxysporum FoPDCD5 gene knockout vector

The PCR amplification method was used to clone and obtain the homology arm A fragment and homology arm B fragment of the FoPDCD5 gene. They were respectively connected to the T vector, and the recombinant plasmid was obtained after transformation of E. coli, Amp resistance screening, plasmid extraction and sequencing identification. pMD18T-FoPDCD5-A and pMD18T-FoPDCD5-B. The recombinant plasmid pCT74-FoPDCD5-A was obtained by ligating pMD18T-FoPDCD5-A with the pCT74 plasmid; it was double digested with pMD18T-FoPDCD5-B, and the gene knockout vector was obtained by DNA ligation, E. coli transformation, and enzyme digestion identification. pCT74-FoPDCD5-KO (Figure 1).

3.2 Construction of the FoPDCD5 gene complementation vector of Fusarium oxysporum

The FoPDCD5 gene complement fragment was cloned and obtained by PCR amplification; it was ligated with the pCTZN vector, and the recombinant plasmid pCTZN-FoPDCD5-com was obtained through E. coli transformation, Amp resistance screening, plasmid extraction and sequencing identification (Figure 2).

3.3 Screening of knockout mutant ΔFopdcd5

3.3.1 PCR verification of gene fragment A-hph

Using homologous recombination, the gene knockout vector was transformed into Fusarium oxysporum protoplasts, and 36 hygromycin-positive transformants were obtained. After DNA extraction, 36 hygromycin-positive transformants were analyzed by PCR using A-hph gene-specific primers. The results showed that the A-hph gene was amplified from the above 36 transformants (Fig. 3).

3.3.2 PCR verification of gene fragment FoPDCD5

Further, using FoPDCD5 gene-specific primers, 36 positive transformants amplified by the above PCR to A-hph gene were subjected to PCR verification analysis of FoPDCD5. The results showed that among the 36 transformants, 2 transformants did not amplify the FoPDCD5 gene, which further indicated that these 2 transformants were positive transformants (Fig. 4).

3.3.3 Southern blot validation of knockout mutants

Southern blot analysis was performed on the 2 positive transformants that amplified the A-hph gene but not the FoPDCD5 gene. The results showed that when the target gene was used as a probe for hybridization, neither of the two transformants had a hybridization band (Fig. 5). Hybridization was carried out with hph as a probe, and a single-copy band appeared in both transformants (Fig. 6). The above experiments further proved that these two transformants were positive transformants.

3.4 Determination of colony morphology and growth rate of knockout mutant △Fopdcd5

The knockout mutant △Fopdcd5 was inoculated in PDA medium, and its growth was observed at different times. The results showed that the colony morphology and growth rate of △Fopdcd5 were not significantly different from those of the wild type of Fusarium oxysporum.

3.5 Analysis of sporulation of knockout mutant △Fopdcd5

The knockout mutant △Fopdcd5 was inoculated in Chad's medium, and the spore production was analyzed after 7 days of culture. The results showed that the sporulation yield of the mutant ΔFopdcd5 was significantly lower than that of its wild type.

3.6 Observation of germination of conidia of knockout mutant △Fopdcd5

The conidia were inoculated in NCM medium, placed at 28°C, and cultured with shaking at 120 rpm; observation was performed after 11 h. The results showed that the germination of Foc4 wild-type conidia was not significantly different from that of the knockout mutant △Fopdcd5, indicating that the knockout of FoPDCD5 did not affect the conidia germination of F. wilt.

3.7 Analysis of knockout mutant △Fopdcd5 under different stress conditions

The knockout mutants (ΔFopdcd5-2 and ΔFopdcd5-5) were inoculated in PDA medium containing 1 mol/L NaCl, 1 mol/L sorbitol, 50 mmol/L H ₂ O ₂ or 0.02% SDS, respectively. Morphology and diameter were determined (Figure 7). The results showed that (1) in the PDA medium containing NaCl and sorbitol, there was no significant difference between △Fopdcd5 and the wild type, indicating that FoPDCD5 had no effect on the ability of Foc4 to resist hyperosmolarity. (2) In PDA medium containing 0.02% SDS, compared with wild type, the growth of mutant ΔFopdcd5 had no significant difference with wild type, indicating that knocking out FoPDCD5 had no effect on the cell wall integrity of Foc4. (3) Under the condition of oxidative stress, the colony growth of the ΔFopdcd5 mutant was slower than that of the wild type, indicating that FoPDCD5 plays an important role in the response of Foc4 to oxidative stress.

3.8 Identification and phenotypic analysis of the apoplastic mutant ΔFopdcd5-com

Using the method of random insertion, the gene complement vector pCTZN-FoPDCD5-com was transformed into protoplasts of Fusarium oxysporum △Fopdcd5, and 9 bleomycin-positive transformants were obtained. After the extraction of genomic DNA, the positive transformants were analyzed by PCR using FoPDCD5 gene-specific primers. The results showed that 4 positive transformants could be amplified to the target gene fragment, indicating that these 4 transformants contained the FoPDCD5 gene; it was confirmed that these 4 transformants were positive transformants (Fig. 8). The colony morphology observation and sporulation analysis of the apoplectic mutant ΔFopdcd5-com were carried out.

3.9 Pathogenicity analysis of knockout mutant ΔFopdcd5 and apoplectic mutant ΔFopdcd5-com

Using the wounded root inoculation method, Brazil bananas were inoculated with Foc4 wild-type, △Fopdcd5 and apoplastic mutant △Fopdcd5-com conidia respectively, and observed after 25 days. The results showed that none of the Brazilian banana seedlings in the clear water control group showed yellowing of leaves, and the bulbs did not change color; Browning occurred above; after △Fopdcd5 inoculation, only the lower leaves of banana plants appeared yellowing, and the discolored area of bulbs did not exceed 20%. After the inoculation of the apoplectic mutant ΔFopdcd5-com, the upper and lower leaves of the banana plant also showed extensive yellowing, and more than 50% of the bulb area was browned (Fig. 9). The disease index was further analyzed, and the results showed that the disease index of △Fopdcd5-com was similar to that of Foc4 wild-type, indicating that the pathogenicity of △Fopdcd5-com returned to the wild-type level; at the same time, the disease index of △Fopdcd5 was significantly lower than that of wild-type and Foc4. Complementing the mutants indicated that the virulence of Fusarium oxysporum decreased significantly after the FoPDCD5 gene was knocked out.

Therefore, the gene provided by the present invention can be used for the control of plant diseases, especially the banana fusarium wilt caused by Fusarium wilt. In addition, the gene provided by the present invention can be used as a target of a drug for plant disease control. Those skilled in the art can follow the teachings and inspirations of this specification to develop medicines for preventing and treating plant diseases, especially banana fusarium wilt.

The above-mentioned embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above-mentioned embodiments, and any other changes, modifications, substitutions, combinations, The simplification should be equivalent replacement manners, which are all included in the protection scope of the present invention.

sequence listing

<110> South China Agricultural University

Application of <120> gene FoPDCD5 in regulating the pathogenicity of Fusarium wilt of banana

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 495

<212> DNA

<213> Artificial Sequence

<220>

<223> Nucleotide sequence of gene FoPDCD5

<220>

<222> (25)..(77)

<223> Non-coding region 1

<220>

<222> (167)..(218)

<223> Non-coding region 2

<400> 1

atggatgacg cagagttaga acaggtagct cacttttgtg gattttatcg ggagtccatc 60

actgattttc ttcgcagtta cgaaaagctc gtctggagca actgaaggcc gaagctggtg 120

gcagtggagg cggttcttct ggtcaggaac aacaacagca gcgccagtca gttgtctcga 180

tccataccgt acgacattat cttactgacc ttgaataggc aacagcaaaa tgatgctcgc 240

caacacatcc tcaaccagat cctccatccc gaagccgccg accgtctagg ccgtatccga 300

cttgtgaaag aggagcgtgc cgccgatatc gagaaccgac ttatcacgct tgcacaaacc 360

ggtcaacttc gacagaaggt cactgaagcg caactcaagg agcttctgaa cgctatgtcg 420

gagagcaagg aggaggagaa gattgttgtg agcagacgca aggcgtggga cgatgatgac 480

gatttggatc tgtaa 495

<210> 2

<211> 129

<212> PRT

<213> Artificial Sequence

<220>

<223> Amino acid sequence of gene FoCWM

<400> 2

Met Asp Asp Ala Glu Leu Glu Gln Leu Arg Lys Ala Arg Leu Glu Gln

1 5 10 15

Leu Lys Ala Glu Ala Gly Gly Ser Gly Gly Gly Ser Ser Gly Gln Glu

20 25 30

Gln Gln Gln Gln Arg Gln Gln Gln Gln Asn Asp Ala Arg Gln His Ile

35 40 45

Leu Asn Gln Ile Leu His Pro Glu Ala Ala Asp Arg Leu Gly Arg Ile

50 55 60

Arg Leu Val Lys Glu Glu Arg Ala Ala Asp Ile Glu Asn Arg Leu Ile

65 70 75 80

Thr Leu Ala Gln Thr Gly Gln Leu Arg Gln Lys Val Thr Glu Ala Gln

85 90 95

Leu Lys Glu Leu Leu Asn Ala Met Ser Glu Ser Lys Glu Glu Glu Lys

100 105 110

Ile Val Val Ser Arg Arg Lys Ala Trp Asp Asp Asp Asp Asp Asp Leu Asp

115 120 125

Leu

<210> 3

<211> 33

<212> DNA

<213> Artificial Sequence

<220>

<223> FoPDCD5-AF

<400> 3

ggggtaccga acagggattc tgttaagcag ttc 33

<210> 4

<211> 33

<212> DNA

<213> Artificial Sequence

<220>

<223> FoPDCD5-AR

<400> 4

ccgggcccga tcttgatacg tgacgttctt taa 33

<210> 5

<211> 32

<212> DNA

<213> Artificial Sequence

<220>

<223> FoPDCD5-BF

<400> 5

ggaattcgag gtgcttgtga taccatggaa tt 32

<210> 6

<211> 32

<212> DNA

<213> Artificial Sequence

<220>

<223> FoPDCD5-BR

<400> 6

gactagtcgt catgtcgttt ttcgatccct at 32

<210> 7

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> FoPDCD5-comF

<400> 7

ggaattcgcg ccatcacggc ca 22

<210> 8

<211> 31

<212> DNA

<213> Artificial Sequence

<220>

<223> FoPDCD5-comR

<400> 8

gactagttag gcgttcattc attatttccg t 31

<210> 9

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> A-hph-F

<400> 9

gcctgaagaa gttctgctac cgccg 25

<210> 10

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> A-hph-R

<400> 10

tggcaaactg tgatggacga caccg 25

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> FoPDCD5-F

<400> 11

atggatgacg cagatagaa cagg 24

<210> 12

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> FoPDCD5-R

<400> 12

ttacagatcc aaatcgtcat catcg 25

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223>hph-F

<400> 13

tgctgctcca tacaagccaa 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223>hph-R

<400> 14

gacattgggg agttcagcga 20

Claims (10)

1. the application of gene FoPDCD5 in regulating the pathogenicity of Fusarium wilt of banana, is characterized in that: Described Fusarium oxysporum gene FoPDCD5, its amino acid sequence is as shown in SEQ ID NO: 2, or the amino acid sequence shown in SEQ ID NO: 2 is obtained by one or more amino acid replacement, insertion, deletion and still has control Analogues of the virulence function of Fusarium wilt of banana. 2. application according to claim 1, is characterized in that: The application of the gene FoPDCD5 in regulating the sporulation of Fusarium wilt of banana. 3. application according to claim 1, is characterized in that: The application of the gene FoPDCD5 in regulating the stress resistance of Fusarium oxysporum. 4. The application according to claim 3, wherein the stress is oxidative stress. 5. the application of the gene FoPDCD5 described in claim 1 in the control of banana fusarium wilt caused by Fusarium oxysporum. 6. The application of the gene FoPDCD5 according to claim 1 as a target for a plant disease prevention and control drug, wherein the plant disease is banana fusarium wilt caused by Fusarium oxysporum. 7. The application according to claim 1, 2, 3, 4, 5 or 6, characterized in that: Described gene FoPDCD5, its nucleotide sequence is one of following A, B, C: A. The DNA sequence encoding the amino acid sequence shown in SEQ ID NO: 2; B. The DNA sequence shown in SEQ ID NO: 1; C. The analogs of the above A and B obtained by base insertion, deletion, or substitution, which still have the function of controlling the pathogenicity of Fusarium oxysporum. 8. A method for the treatment of Fusarium wilt of banana caused by Fusarium oxysporum, characterized in that: comprising blocking or inhibiting the expression of the described gene FoPDCD5 of claim 1. 9. The application of the medicament that blocks or inhibits the expression of the gene FoPDCD5 according to claim 1 in the preparation of medicine, wherein the medicament is an antisense RNA or siRNA of the gene FoPDCD5 according to claim 1, and the medicament uses For the control of banana fusarium wilt caused by Fusarium wilt. 10. The application according to claim 9, characterized in that: Described gene FoPDCD5, its nucleotide sequence is one of following A, B, C: A. The DNA sequence encoding the amino acid sequence shown in SEQ ID NO: 2; B. The DNA sequence shown in SEQ ID NO: 1; C. The analogs of the above A and B obtained by base insertion, deletion, or substitution, which still have the function of controlling the pathogenicity of Fusarium oxysporum.

Images