CN104893993B

CN104893993B - Verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 purposes

Info

Publication number: CN104893993B
Application number: CN201510297266.1A
Authority: CN
Inventors: 高峰; 毛建才
Original assignee: Shihezi University
Current assignee: Shihezi University
Priority date: 2015-06-02
Filing date: 2015-06-02
Publication date: 2017-12-08
Anticipated expiration: 2035-06-02
Also published as: CN104893993A

Abstract

The invention discloses verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 purposes.The VdpdaA2 knock out mutants bodies sporulation quantity obtained after VdpdaA2 gene knockouts in verticillium dahliae wild-type strain V592 bacterial strains is significantly lower than verticillium dahliae wild-type strain V592 bacterial strains, shows that VdpdaA2 genes take part in conidial formation.First identified of the present invention and verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 and its gene, basis is provided to further elucidate the pathogenesis of verticillium dahliae, the verticillium dahliae mutant that the VdpdaA2 gene knockouts of wild type verticillium dahliae are obtained provides pathogen resource for the interaction study mechanism of verticillium dahliae and host, and the new cotton variety of preventing and treating and cultivation anti-verticillium dahliae of the present invention to cotton verticillium wilt has important application value.

Description

Verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 purposes

Technical field

The present invention relates to the purposes of verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 in biological technical field.

Background technology

Cotton verticillium wilt is the fibrovascular system disease that a kind of soil passes, and is as caused by verticillium dahliae, it is to cotton Production causes serious harm.From nineteen thirty-five, cotton verticillium wilt incoming China with the introduction of cotton seeds, then just open Begin gradually to spread the whole nation.Especially after the 1990s, cotton verticillium wilt is extremely rapid in China's extension sprawling, wherein Cotton verticillium wilt is the most serious within 1993, and onset area is up to 266.67 ten thousand hm², then 1995,1996,1999,2000, 2002nd, continuously broken out in the whole country within 2003, loss is extremely serious, and cotton verticillium wilt is produced and can held to Cotton in China Supervention exhibition forms great threat.

Cotton verticillium wilt is by Deuteromycotina (Deutermycotina) light color Cordycepps (Mmonilaceae) Verticillium dahliae category (Verticillium) fungi causes, and has several kinds in category, wherein endanger cotton have verticillium dahliae (V.dahliae) and Two kinds of verticilliumalbo-atrum (V.albo-atum).Cotton in China verticillium wilt is mainly as caused by verticillium dahliae.Big beautiful wheel branch Bacterium does not have host speciality, can endanger various plants, from annual herbaceous plant to perennial xylophyta.Big beautiful wheel Branch bacterium can form a kind of dormancy structure for being called black Microsclerotia, survival can be up to the several years in the soil for lacking host.

Verticillium dahliae is mainly survived the winter in the form of Microsclerotia, Microsclerotia as its most important primary infection inoculum, by To plant root secretion stimulation when will sprout.Mycelia typically from plant root invade, with plant transpiration to Extend, be colonized in the cauline leaf of plant, finally infect whole plant.Typically it can all be shown by the plant that verticillium dahliae infected Wilt, dry up, vein is eclipsed, the symptom such as necrosis, and vascular bundle browning is the most typical symptom of verticillium wilt.

The research of field multitude etc. think cotton verticillium wilt occurrence and development and Microsclerotia in soil quantity it is closely related.It is big beautiful The number of Verticillium dahliae Microsclerotia is generally related to its pathogenicity and resistance.There is studies have shown that to work as Verticillium Dahliae in soil micro- When sclerotium reaches 0.03/g soil, it may result in cotton and wilting symptom occur, when Microsclerotia content reaches 0.3/g soil in soil During~1.0/g soil, 20%~50% cotton plants morbidity is just had, when Microsclerotia content reaches 3.5/g soil in soil More than, cotton plants can all fall ill.Separately there are some researches show when Microsclerotia content reaches 0.5/g soil to cause cotton in soil The critical value of morbidity.Face down on the farm, when Huang wither bacterium infect lettuce after, the germ nuclear volume in soil is at least 50/g soil, and The very heavy field of disease, Microsclerotia number are up to 2400/g soil.

Cotton is the maximum insutrial crop of cultivated area in the world at present, is be only second to grain second largest in China Crops.Cotton verticillium wilt is most destructive fungal disease in current Cotton in China production process.Due to not yet grinding so far The pesticide control and disease-resistant variety of significant effect are made, is referred to as " cancer " of cotton, therefore how to control the wildness of verticillium wilt Harm, it has also become the key issue of Cotton Production sustainable development.In this case, the pathogenic machine of verticillium dahliae is studied Reason, the interaction mechanism for understanding verticillium dahliae and host just seem even more important.

The content of the invention

The technical problems to be solved by the invention are to provide a kind of verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 or its gene.

In order to solve the above technical problems, present invention firstly provides a kind of restructuring for preparing conidium yield reduction is beautiful greatly The method of Verticillium dahliae.

A kind of method of restructuring verticillium dahliae for preparing conidium yield reduction provided by the present invention, it is to suppress mesh Verticillium dahliae in verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 gene expression, obtain conidium Yield is less than the restructuring verticillium dahliae of the purpose verticillium dahliae；

The verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 is a) or b)：

A) amino acid sequence is the protein shown in SEQ ID No.1；

B) amino acid sequence shown in SEQ ID No.1 by the substitution of one or several amino acid residues and/or is lacked Lose and/or what addition obtained has the active eggs as derived from a) of verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 White matter.

Wherein, SEQ ID No.1 are made up of 395 amino acid residues.

It is above-mentioned b) described in one or several amino acid residues substitution and/or missing and/or be added to no more than 10 The substitution of amino acid residue and/or missing and/or addition.

It is above-mentioned b) described in protein can be artificial synthesized, also can first synthesize its encoding gene, then carry out biological expression and obtain.

It is above-mentioned b) described in the encoding gene of protein can be by the way that one will be lacked in the DNA sequence dna shown in SEQ ID No.2 The codon of individual or several amino acid residues, and/or carry out what the missense mutation of one or several base-pairs obtained.

In the above method, the conidium yield of the restructuring verticillium dahliae of the conidium yield reduction is less than described Purpose verticillium dahliae；The purpose verticillium dahliae is to contain the verticillium dahliae conidium yield GAP-associated protein GAP The verticillium dahliae of VdpdaA2 gene, such as verticillium dahliae wild-type strain V592.

In the above method, verticillium dahliae conidium yield GAP-associated protein GAP described in the suppression purpose verticillium dahliae The expression of VdpdaA2 gene is by by the clpp gene of the verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 What the mode removed was realized.

In the above method, the gene knockout can be realized by homologous recombination.

What the method for the restructuring verticillium dahliae provided by the invention using the preparation conidium yield reduction obtained The restructuring verticillium dahliae of conidium yield reduction falls within the scope of protection of the invention.

The thing provided by the present invention for suppressing the verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 expression Matter, suppress the verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 gene expression material or reduce described big Application of the material of beautiful Verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 activity in anti-verticillium dahliae plant is cultivated Belong to the scope of protection of the invention.

In above-mentioned application, the anti-verticillium dahliae plant can be genetically modified plants.

In above-mentioned application, the plant can be the host of verticillium dahliae；The host of the verticillium dahliae can be Shuangzi Leaf plant or monocotyledon；The dicotyledon can be cotton, tomato, sunflower, cucumber etc.；The monocotyledon can For rice, corn, sorghum, wheat class, millet etc.；The host of the verticillium dahliae concretely cotton.

The thing provided by the present invention for suppressing the verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 expression Matter, suppress the verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 gene expression material or reduce described big Application of the material of beautiful Verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 activity in verticillium dahliae inhibitor is prepared Belong to the scope of protection of the invention.

In above-mentioned application, the verticillium dahliae inhibitor can pass through the verticillium dahliae conidium yield correlation egg White VdpdaA2 or described verticillium dahliae conidium yield GAP-associated protein GAPs VdpdaA2 gene is screened for target spot.

Above, the material of the gene expression for suppressing verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 Can be the material of interference verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 gene expression, as microRNA, The RNA of the antisense gene expression of VdpdaA2 gene.

Present invention also offers the verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2, or the big beautiful wheel Biomaterial related branch bacterium conidium yield GAP-associated protein GAP VdpdaA2 is in verticillium dahliae conidium yield is regulated and controled Using；

Biomaterial related the verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 is following A 1) extremely Any of A20)：

A1) nucleic acid molecules；The nucleic acid molecules are coding verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2's Nucleic acid molecules；

A2 A1) is contained) expression cassettes of the nucleic acid molecules；

A3 A1) is contained) recombinant vectors of the nucleic acid molecules；

A4 A2) is contained) recombinant vector of the expression cassette；

A5 A1) is contained) recombinant microorganisms of the nucleic acid molecules；

A6 A2) is contained) recombinant microorganism of the expression cassette；

A7 A3) is contained) recombinant microorganism of the recombinant vector；

A8 A4) is contained) recombinant microorganism of the recombinant vector；

A9 A1) is contained) the transgenic plant cells systems of the nucleic acid molecules；

A10 A2) is contained) the transgenic plant cells system of the expression cassette；

A11 A3) is contained) the transgenic plant cells system of the recombinant vector；

A12 A4) is contained) the transgenic plant cells system of the recombinant vector；

A13 A1) is contained) Transgenic plant tissues of the nucleic acid molecules；

A14 A2) is contained) Transgenic plant tissue of the expression cassette；

A15 A3) is contained) Transgenic plant tissue of the recombinant vector；

A16 A4) is contained) Transgenic plant tissue of the recombinant vector；

A17 A1) is contained) the genetically modified plants organs of the nucleic acid molecules；

A18 A2) is contained) the genetically modified plants organ of the expression cassette；

A19 A3) is contained) the genetically modified plants organ of the recombinant vector；

A20 A4) is contained) the genetically modified plants organ of the recombinant vector.

In above-mentioned application, the regulation and control verticillium dahliae conidium yield can be to reduce the production of verticillium dahliae conidium Amount.

In above-mentioned application, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid point Son can also be RNA, such as mRNA or hnRNA.

The nucleic acid molecules are following 1) -5) in it is any shown in gene：

1) its coded sequence is SEQ ID No.2 cDNA molecule or DNA molecular；

2) sequence is SEQ ID No.3 cDNA molecule or DNA molecular；

3) nucleotide sequence with 1) limiting has 75% or more than 75% homogeneity, and encodes the verticillium dahliae point Raw spore output GAP-associated protein GAP VdpdaA2 cDNA molecules or genomic DNA molecule；

4) nucleotide sequence with 2) limiting has 75% or more than 75% homogeneity, and encodes the verticillium dahliae point Raw spore output GAP-associated protein GAP VdpdaA2 cDNA molecules or genomic DNA molecule；

1) or 2) or 3) or 4) 5) and the big beautiful wheel branch is encoded with the nucleotide sequence hybridization limited under strict conditions Bacterium conidium yield GAP-associated protein GAP VdpdaA2 cDNA molecules or genomic DNA molecule.

The above-mentioned nucleic acid molecules for being used to encode the verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2, ability Domain those of ordinary skill can be easily using known method, such as orthogenesis and the method for point mutation, to the present invention The coding verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 nucleotide sequence of nucleic acid molecules dashed forward Become.Those are by manually modified, egg related to the coding verticillium dahliae conidium yield that the present invention is isolated The nucleotide sequence of white VdpdaA2 nucleic acid molecules have 75% or higher homogeneity and the coding verticillium dahliae it is mitogenetic Spore output GAP-associated protein GAP VdpdaA2, it is the nucleotide sequence derived from the present invention and is equal to the sequence of the present invention.

Term " homogeneity " used herein refers to the sequence similarity with native sequence nucleic acid." homogeneity " includes and this hair DNA molecular or cDNA molecules shown in bright SEQ ID No.2 1-1188 positions nucleotides have 75% or higher, or 85% Or it is higher, or 90% or higher, or the nucleotide sequence of 95% or higher homogeneity.With the of the SEQ ID No.3 of the present invention DNA molecular or cDNA molecules shown in the nucleotides of 1-1359 positions have 75% or higher, or 85% or higher, or 90% or more Height, or the nucleotide sequence of 95% or higher homogeneity.Homogeneity can with the naked eye or computer software is evaluated.Use meter Calculation machine software, the homogeneity between two or more sequences can use percentage (%) to represent, it can be used for evaluating related sequence Homogeneity between row.

The stringent condition is in 2 × SSC, 0.1%SDS solution, hybridizes at 68 DEG C and washes film 2 times, every time 5min, and in 0.5 × SSC, 0.1%SDS solution, hybridize at 68 DEG C and wash film 2 times, each 15min.

Above-mentioned 75% or more than 75% homogeneity, can be 80%, 85%, 90% or more than 95% homogeneity.

Wherein, SEQ ID No.2 are made up of 1188 nucleotides, and its coded sequence is 1-1188 positions, coding SEQ ID Protein shown in No.1.

It is described in the above-mentioned biomaterial related to the verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 Expression cassette is to refer to express corresponding protein DNA in host cell, and the DNA not only may include to start related gene transcription Promoter, the terminator for terminating related gene transcription is may also include, such as A2) as described in containing encoding the verticillium dahliae point Raw spore output GAP-associated protein GAP VdpdaA2 expression cassette, be refer to express the verticillium dahliae in host cell it is mitogenetic Spore output GAP-associated protein GAP VdpdaA2 DNA.

In the above-mentioned biomaterial related to the verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2, A5)- A8 any recombinant microorganism concretely bacterium, yeast, algae and fungi in).Wherein, bacterium may be from Escherichia (Escherichia), Erwinia (Erwinia), Agrobacterium tumefaciems category (Agrobacterium), Flavobacterium (Flavobacterium), Alcaligenes (Alcaligenes), pseudomonas (Pseudomonas), Bacillus (Bacillus) etc..A9)-A12) in any described transgenic cell line, A13)-A16) in any described genetically modified plants Tissue, A17)-A20) in any described genetically modified plants organ do not include the propagating materials of plant.

It is demonstrated experimentally that it will obtain after the VdpdaA2 gene knockouts in verticillium dahliae wild-type strain V592 bacterial strains VdpdaA2 knock out mutants bodies sporulation quantity is significantly lower than verticillium dahliae wild-type strain V592 bacterial strains, VdpdaA2 genes with Conidium yield is related, shows that VdpdaA2 genes take part in conidial formation.In actual applications, can be in purpose Material (such as antisense gene of microRNA, VdpdaA2 gene of expression interference VdpdaA2 gene expressions in plant (such as cotton) The RNA of expression) resistance of the purpose plant to verticillium dahliae is improved, it can will specifically disturb the DNA of VdpdaA2 gene expressions (such as antisense gene of VdpdaA2 genes), which is imported in recipient plant, obtains the genetically modified plants improved to verticillium dahliae resistance. In actual applications, can also be using verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 or its gene as Sites Screening Prevent and treat the medicine of verticillium dahliae.First identified of the present invention and verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 And its gene, basis is provided to further elucidate the pathogenesis of verticillium dahliae, by the VdpdaA2 of wild type verticillium dahliae The verticillium dahliae mutant that gene knockout obtains provides pathogen money for the interaction study mechanism of verticillium dahliae and host Source, the new cotton variety of preventing and treating and cultivation anti-verticillium dahliae of the present invention to cotton verticillium wilt have important application value.

Brief description of the drawings

Fig. 1 is pRF-HU2 carrier structure schematic diagrames.

Fig. 2 is recombinant vector pRF-HU2-PDA2 structure flow chart.

Fig. 3 is the construction strategy figure of knockout carrier.

Fig. 4 is the phenotype and Southern hybridization verification results of verticillium dahliae VdpdaA2 knockout mutations bodies.Wherein, A is The phenotype of verticillium dahliae VdpdaA2 knockout mutations bodies；B is that the Southern of verticillium dahliae VdpdaA2 knockout mutations bodies is miscellaneous Deliver for a check card collection of illustrative plates：Swimming lane 1 is verticillium dahliae wild-type strain V592, and swimming lane 2 and 3 is respectively that verticillium dahliae VdpdaA2 strikes Except mutant △ VdpdaA2-a and △ VdpdaA2-b.

Fig. 5 is that VdpdaA2 genes turn in verticillium dahliae wild-type strain V592 sclerotium, mycelia and conidium Record is horizontal.Wherein, 1 is conidium, and 2 be mycelia, and 3 be sclerotium.

Fig. 6 is the biological character of verticillium dahliae VdpdaA2 knockout mutations bodies.Wherein, it is phenotypic results to scheme A；Scheming B is The measurement result of conidium yield；Figure C is hypha form result；WT and V592 is verticillium dahliae wild-type strain V592, △ VdpdaA2 are knockout mutations body △ VdpdaA2-a, and EC2 is knockout mutations body VdpdaA2-a complementary transformant.

Fig. 7 is the conidial sproutings of knockout mutations body △ VdpdaA2.WT is verticillium dahliae wild-type strain V592, △ VdpdaA2 are knockout mutations body △ VdpdaA2-a.

Fig. 8 is to enter performing PCR to the genomic DNAs of V592 bacterial strains by primer pair of PDA2-s and PDA2-x to expand what is obtained The agarose gel electrophoresis figure of pcr amplification product.Wherein, swimming lane M is marker2000；Swimming lane 1 is negative control, swimming lane 2-7 It is the pcr amplification product of VdpdaA2 full length genes.

Fig. 9 is carrier pSULPH-mut-RG#PB structural representation.

Figure 10 is the phenotype of complementary transformant.

Embodiment

The present invention is further described in detail with reference to embodiment, the embodiment provided is only for explaining The bright present invention, the scope being not intended to be limiting of the invention.

Experimental method in following embodiments, it is conventional method unless otherwise specified.

Material used, reagent etc., unless otherwise specified, are commercially obtained in following embodiments.

In following embodiments cotton verticillium wilt bacterial strain verticillium dahliae (V.dahliae) wild-type strain V592 (Peng Shan, Research [J] Cotton Sciences of a kind of new cotton yellows of the such as Lv Xuelian, peak, the quick inoculation method of droop, 2008,20 (3): 174~178.) public can be obtained from Shihezi Univ, and the biomaterial is only attached most importance to used in the related experiment of duplicate invention, can not Used as other purposes.

In following embodiments carrier pRF-HU2 (Ronnie de Jonge, H.Peter van Esse, Karunakaran Maruthachalam, et al.Tomato immune receptor Ve1recognizes effector of multiple fungal pathogens uncovered by genome and RNA sequencing[J].PNAS, 2012,4(27):5110~5115.) public can obtain from Shihezi Univ, the biomaterial only attach most importance to duplicate invention correlation Used in experiment, it can not be used as other purposes.There are two digestion positions not having in any fungal organism genome on the carrier Point PacI and Nt.BbvCI, also containing fungi selected marker-Hygromycin marker and bacterial selectable marker-kanamycins (Kan) mark, the schematic diagram of the carrier is as shown in Figure 1.

Agrobacterium tumefaciems EHA105 (Feng Gao, Bang-Jun Zhou, Guo-Ying Li, et in following embodiments al.A Glutamic Acid-Rich Protein Identified in Verticillium dahliae from an Insertional Mutagenesis Affects icrosclerotial Formation and Pathogenicity [J].PLos One,2010,12(5)：E15319) public can obtain from Shihezi Univ, the biomaterial only attach most importance to duplicate hair Used in bright related experiment, it can not be used as other purposes.

Cotton is the husband of cotton variety 108 (Gossypium hirsutum L.) (Peng Shan, Lv Xuelian, height in following embodiments Research [J] Cotton Sciences of a kind of new cotton yellows of the such as peak, the quick inoculation method of droop, 2008,20 (3):174~ 178.) public can be obtained from Shihezi Univ, and the biomaterial is only attached most importance to used in the related experiment of duplicate invention, can not be used as it Its purposes uses.

USER enzyme mix in following embodiments are NEB Products.

Associated antibiotic solution in following embodiments is formulated as follows：

The μ g/mL of hygromycin (Hyg, Roche Holding Ag) working concentration 100, cephalosporin (Cef) working concentration are 300 μ g/mL, Kanamycins (Kan) working concentration is 50 μ g/mL, and rifampin (Rif) working concentration is 10 μ g/mL；

Acetosyringone (AS, 10mM)：Weigh 19.62mg acetosyringones, with 10mL distilled water dissolve, use concentration for 5M KOH solution adjusts pH to 8, and -20 DEG C preserve after filtration sterilization.

2-N- agate beautiful jade ethyl sulfonic acids (MES, 1M)：19.52g MES are weighed, is dissolved with 80mL distilled water, uses concentration as 5M's KOH solution adjust pH to 5.3, be then settled to 100mL and use filter filtration sterilization, -20 DEG C preserve.

10% (v/v) glycerine：10mL pure glycerins, 90mL distilled water, mix.

20% (v/v) glycerine：20mL pure glycerins, 80mL distilled water, mix.

50mM altheine：6.6g altheines are dissolved into 1L distilled water, filtration sterilization.

200×Trace solution for Vogels salts:5g citric acids, 5gZnSO₄·7H₂O, 1g Fe (NH₄)₂(SO₄)₂·6H₂O, 0.25g CuSO₄·5H₂O, 0.05g MgSO₄·H₂O, 0.05g H₃BO₃, 0.05g Na₂Mo O₄·2H₂O, 1000mL distilled water, filtration sterilization.

50×Vogels salts：125g C₆H₉Na₃O₉, 250g KH₂PO₄, 9.3g MgSO₄·6H₂O, 5g CaCl₂· 2H₂O, 5mL 200 × Trace solution, are settled to 1000mL, filtration sterilization.

1000×Trace elements for DFM medium：40mg Na₂B₄O₇·10H₂O, 400mg CuSO₄· 5H₂O, 1.2g FeSO₄·7H₂O, 700mg MnSO₄·H₂O, 800mg Na₂MoO₄·2H₂O, 10g ZnSO₄·7H₂O, 1000mL distilled water, filtration sterilization.

2.5×Salt solution：3.625g KH₂PO₄, 5.125g K₂HPO₄, 0.375g NaCl, 1.160g MgSO₄·6H₂O, 0.165g CaCl₂·2H₂O, 0.0062g FeSO₄·7H₂O, 1.250g (NH₄)₂SO₄, 1000mL distilled water, Filtration sterilization.Every kind of component need to weigh a dissolving one and avoid the formation of insoluble matter.

RA culture mediums：50g sodium succinates (C₄H ₄O₄Na₂·6H₂O), 12.1g NaNO₃, 50 × Vogels of 20mL Salts (- N ,-C), 950mL distilled water, autoclaving, with adding the Portugal that the sterilized concentration of 50mL is 20g/100mL before Grape sugar aqueous solution.

Water agar IMAS culture mediums：6g agar powders and 146mL distilled water are mixed, autoclaving preserves.With when it is micro- Ripple stove adds other compositions of IMAS culture mediums after melting.

IMAS solid mediums：By 2.5 × Salt of 120.0mL solution (60 DEG C of preheatings), 7mL concentration is 20g/ 100mL D/W, 7.5mL 20% (v/v) glycerine and 146mL water agar IMAS culture mediums mixing so that mixing The ultimate density 2g/100mL of agar powder in liquid.When liquid to be mixed is cooled to 55 DEG C, 12.0mL MES (concentration 1M) are added, 6.0mL acetosyringones (concentration 10mM).

IMAS fluid nutrient mediums：2.5 × Salt of 120.0mL solution (60 DEG C of preheatings), 7mL concentration is 20g/ 100mL D/W, 7.5mL 20% (v/v) glycerine, 12.0mL MES (concentration 1M), 6.0mL acetyl cloves Ketone (concentration 10mM).

Water agar DFM culture mediums：10g agar powders and 358mL distilled water are mixed, autoclaving preserves.With when it is micro- Ripple stove adds other compositions of DFM culture mediums after melting.

DFM solid mediums：By the D/W that 31.25mL concentration is 20g/100mL, 100.0mL concentration is 50mM altheine (60 DEG C of preheatings), 5.0mL concentration is 210mM MgSO₄, 5.0mL solution As (pH value of solution A is 6, It is made up of solvent and solute, solvent is water, and solute and its concentration are：1.12M KH₂PO₄With 0.7M KCL), 0.5mL 1000 × Trace elements and 358mL water agar DFM culture mediums mixing so that the final concentration of 2g/ of agar in mixed liquor 100mL.Liquid to be mixed is cooled to 55 DEG C and adds required antibiotic.

1% (w/v) water agar:1g agar powder and 99mL distilled water are mixed, autoclaving preserves.

Cha Shi fluid nutrient mediums：2g NaNO₃, 1g K₂HPO₄, 0.5g KCl, 0.5g MgSO₄·7H₂O, 0.01g FeSO₄·7H₂O, 30g sucrose, distilled water are settled to 1000mL；Autoclaving.

Table 1, primer sequence (underscore expression restriction enzyme site)

Primer	Sequence (5 ' → 3 ')
		PDA2up-s	GGTCTTAAUTAGAGCCCATCGACGAGGAGC
PDA2up-x	GGCATTAAUGAATATGTAGAGAGTGACTGAGGG
		PDA2down-s	GGACTTAAUTGTAGTTCTTGCGCGCTCCTC
PDA2down-x	GGGTTTAAUACACTGATGCCGCGTTTGCAA
		PDA2-s	ACGCGTCGACATGCAACTCTCACGTTCTCTCAAG
PDA2-x	GGACTAGTCTAAGCGCAGACGCCAAAGG

PDA2-qs	TCAAGACGGTGCTGGTG
		PDA2-qx	CACAGAACTGGCGATGC
PDA2-ts	CTCTCAAGACGGTGCTGGTGT
		PDA2-tx	ACGTGATCCGTAAAGCTGAAAGGG
β-tubline-f	TCACCAGCCGTGGCAAGGTTG
		β-tubline-r	AGCAAAGGGCGGTCTGGACGTTG

The preparation of embodiment 1, verticillium dahliae VdpdaA2 knockout mutations bodies

First, recombinational agrobacterium pRF-HU2::PDA2 preparation

With cotton verticillium wilt bacterial strain verticillium dahliae (V.dahliae) wild-type strain V592 (abbreviation V592 bacterial strains) base Because group DNA is template, enters performing PCR amplification by primer of PDA2up-s and PDA2up-x, obtain pcr amplification product, named For the left homology arm fragment of VdpdaA2 genes；

Using the genomic DNA of V592 bacterial strains as template, performing PCR is entered as primer using PDA2down-s and PDA2down-x and expanded Increase, obtain pcr amplification product, be named as the right homology arm fragment of VdpdaA2 genes.

PRF-HU2 carriers are obtained using PacI and Nt.BbvCI restriction enzymes double zyme cutting pRF-HU2 carriers (Fig. 1) Two linearized fragments.

By the left homology arm fragment of VdpdaA2 genes, the right homology arm fragment of VdpdaA2 genes and the pRF-HU2 carriers obtained Two linearized fragments be attached, linked system is as shown in table 2,37 DEG C be incubated 20min, then 25 DEG C incubation 20min, that is, recombinant vector is obtained, be named as recombinant vector pRF-HU2-PDA2 (Fig. 2).Recombinant vector pRF-HU2-PDA2 is entered Row sequencing, as a result correctly, shows that the left homology arm fragment of VdpdaA2 genes and the right homology arm fragment of VdpdaA2 genes are inserted respectively PRF-HU2 carriers are arrived.The nucleotide sequence such as SEQ ID of the left homology arm fragment of VdpdaA2 genes in pRF-HU2-PDA2 Shown in NO.4, the nucleotide sequence of the right homology arm fragment of VdpdaA2 genes is as shown in SEQ ID NO.5.

Recombinant vector pRF-HU2-PDA2 is transformed into Agrobacterium tumefaciems EHA105, obtains recombinational agrobacterium, is ordered Entitled recombinational agrobacterium pRF-HU2::PDA2.

Table 2, USER clone's systems

2nd, the preparation of verticillium dahliae VdpdaA2 knockout mutationss body

1st, the conidial acquisition of verticillium dahliae

Cultured V592 bacterial strains are beaten to bacteria cake is some, and are inoculated in the 1L triangular flasks containing 250mL RA culture mediums, Training 5d is shaken on 26 DEG C, 200rpm horizontal shaker, obtains the culture of V592 bacterial strains.With sterilized micropore filter-cloth filtering Then filtrate is centrifuged 40min by the culture of V592 bacterial strains into sterile 50mL centrifuge tubes under the conditions of 14000g, 4 DEG C, Supernatant is abandoned, collects bacterial sediment.With 10mL ddH₂0 again suspension thalline precipitate, then centrifuged again under the conditions of 14000g, 4 DEG C 40min, supernatant is abandoned, collect bacterial sediment；With 5mL ddH₂0 again suspension thalline precipitate, obtain the conidium of V592 bacterial strains Suspension.It is dense using the conidium in the conidial suspension of light microscope and blood counting chamber measure V592 bacterial strains Degree, after the conidial suspension of V592 bacterial strains then is centrifuged into 30min under the conditions of 14000g, 8 DEG C, collect conidium and sink Form sediment, the conidium for the precipitation that suspended again with 10% (v/v) glycerine, the conidium concentration finally given is 1 × 10⁸cfu/ ML conidial suspension.Conidial suspension is placed in -80 DEG C of preservations with every part of 1mL, can be preserved 1 year, treats that the used time is used Conidium concentration is adjusted to 1 × 10 by IMAS fluid nutrient mediums⁷cfu/mL。

2nd, the culture of recombinational agrobacterium

Recombinational agrobacterium pRF-HU2 prepared by step 1::PDA2 single bacterium colony is inoculated in 50mL triangular flasks, is equipped with 10mL contains the LB fluid nutrient mediums that concentration is 50 μ g/mL Kan (kanamycins) and concentration is 10 μ g/mL Rif (rifampin), 1-2d is cultivated under the conditions of 28 DEG C, 100rpm, obtains recombinational agrobacterium pRF-HU2::PDA2 seed liquor；100 μ L are recombinated into agriculture Bacillus pRF-HU2::PDA2 seed liquor is inoculated in 50mL conical flasks, and it is 50 μ g/mL Kan's to contain concentration equipped with 10mL IMAS fluid nutrient mediums, training is shaken under the conditions of 28 DEG C, 100rpm to OD₆₀₀Reach 0.5-0.7 (typically by second day), obtain To recombinational agrobacterium pRF-HU2::PDA2 bacterium solutions.

3rd, the recombinational agrobacterium pRF-HU2 for obtaining step 2::The conidium concentration of PDA2 bacterium solutions and step 1 for 1 × 10⁷Cfu/mL conidial suspension is well mixed in equal volume, obtains mixed liquor.Draw 200 μ L mixed liquors and using coating It is uniformly coated on the IMAS solid mediums for being covered with NC films by device, then in 26 DEG C of light cultures 36 hours.Culture terminates NC films are aseptically transferred to from IMAS solid mediums to DFM afterwards, and (hygromycin concentration is 150mg/mL, cephalosporin Concentration is 300mg/mL) 6-8d is cultivated on solid medium, transformant is transferred to PDA (hygromycin again after transformant is grown Concentration is 150mg/mL, and cephalosporin concentration is 300mg/mL) continue to cultivate in culture medium, its construction strategy such as Fig. 3.Select 2 Individual transformant is respectively designated as △ VdpdaA2-a and △ VdpdaA2-b, and its phenotype is as shown in A in Fig. 4.△ VdpdaA2-a and △ VdpdaA2-b is by gene (the abbreviation VdpdaA2 bases of the verticillium dahliae pathogen-relatedprotein VdpdaA2 in V592 bacterial strains Cause) knock out obtained restructuring verticillium dahliae.Verticillium dahliae pathogen-relatedprotein VdpdaA2 amino acid sequence such as SEQ Shown in ID No.1, verticillium dahliae pathogen-relatedprotein VdpdaA2 genomic gene is big beautiful as shown in SEQ ID No.3 Verticillium dahliae pathogen-relatedprotein VdpdaA2 cDNA genes are as shown in SEQ ID No.2.

3rd, the checking of verticillium dahliae VdpdaA2 knockout mutationss body

Using the genomic DNA of V592 bacterial strains as template, enter performing PCR amplification by primer of PDA2-ts and PDA2-tx, obtain The PCR primer of V592 bacterial strains, by the PCR primer of V592 bacterial strains (the 17th in SEQ ID NO.3 to the nucleosides shown in 422 Acid sequence) DNA probe is used as, with reference to Riboprobe Systtem-SP6 probes labelling kit (for Promega products, product Catalog number (Cat.No.) is P1420) specification, using α-[³²P] dCTP carry out DNA probe mark.What extraction step two obtained respectively turns The genomic DNA of beggar (△ VdpdaA2-a and △ VdpdaA2-b), using PDA2-ts and PDA2-tx as primer, carry out Whether Southern hybridization verifications, the VdpdaA2 genes detected in transformant are knocked.

B result shows in Fig. 4, can hybridize to obtain a bright band, the i.e. mesh of VdpdaA2 genes in V592 bacterial strains Fragment, and do not hybridize in corresponding position accordingly in two knockout mutations body △ VdpdaA2-a and △ VdpdaA2-b Band, this result illustrate that the VdpdaA2 genes in knockout mutations body △ VdpdaA2-a and △ VdpdaA2-b have been knocked.

4th, expression analysis of the VdpdaA2 genes in V592 bacterial strains

Sclerotium, mycelia and the conidial RNA of V592 bacterial strains are extracted respectively, and reverse transcription is cDNA, respectively with cDNA For template, using PDA2-qs and PDA2-qx as primer, fluorescent quantitation qRT-PCR is carried out.With β-tubline genes (DQ266153) As reference gene, β-tubline-f and β-tubline-r are used as primer.

Result shows in Fig. 5, and transcriptional level of the VdpdaA2 genes in the mycelia of V592 bacterial strains is apparently higher than in mitogenetic spore Transcriptional level in son and sclerotium, the transcriptional level in sclerotium is minimum, shows expression of the VdpdaA2 genes in V592 bacterial strains With tissue specificity.

5th, the biological character of verticillium dahliae VdpdaA2 knockout mutationss body

Verticillium dahliae VdpdaA2 knockout mutations body △ VdpdaA2-a and the △ VdpdaA2-b that step 2 is obtained first It is transplanted to respectively in common PDA culture medium, cultivates 10d at 26 DEG C, following biological characteristicses then are carried out to each bacterial strain respectively Observation and measure, using V592 bacterial strains as control.

1st, cultural colony is observed

The bacteria cake for taking a diameter of 1cm is beaten in bacterial strain colony edge with card punch, by pure culture biscuits involvng inoculation in PDA culture medium flat board Centre, in 26 DEG C of light culture 10d, according to the colonial morphology of mutant strain and black Microsclerotia number etc. feature mutant strain is entered Row phenotype classification of type, criteria for classification bibliography：A kind of new cotton yellows of the such as Peng Shan, Lv Xuelian, peak, droop are quick Research [J] Cotton Sciences of inoculation method, 2008,20 (3):174~178.As a result such as A in Fig. 6, knockout mutations body △ is shown Phenotypes of the VdpdaA2-a and △ VdpdaA2-b in PDA culture medium is sclerotium type, is all produced in the front and back of culture medium The Microsclerotia of raw black, does not have obvious difference with V592 bacterial strains.

2nd, colony growth rate determines

The bacteria cake for taking a diameter of 1cm is beaten in bacterial strain colony edge with card punch, by pure culture biscuits involvng inoculation in PDA culture medium flat board Centre, 26 DEG C of light cultures, the colony diameter of each bacterial strain is measured with crossing method, measured a bacterium daily from the 3rd day to the 9th day Falling diameter, survey 7 times altogether, each bacterial strain sets three repetitions, and each colony diameter of every kind of bacterial strain is the average value of its three repetitions, Colony growth rate=(five days diameters of the 9th day diameter-the) ÷ 4.

Colony growth rate measurement result is shown：

A. on common PDA culture medium flat board, the speed of growth of V592 bacterial strains is 3.667mm/d, knockout mutations body △ VdpdaA2-a and △ VdpdaA2-b respectively 3.83mm/d, 3.82mm/d, knockout mutations body △ VdpdaA2-a and △ VdpdaA2-b colony growth rate is faster than the colony growth rate of wild-type strain.

Colony diameter of the B.V592 bacterial strains at the 9th day is 37mm, knockout mutations body △ VdpdaA2-a and △ That VdpdaA2-b is respectively 39mm, 39mm, more than the colony diameter of V592 bacterial strains.

3rd, sporulation quantity determines

The bacteria cake for taking 10 a diameter of 1cm is beaten in bacterial strain colony edge with card punch, by pure culture biscuits involvng inoculation in equipped with Cha Shi liquid In the conical flask of body culture medium, training 5 days is shaken under the conditions of 26 DEG C, 200rpm, with sterile micropore filter-cloth filtering culture to nothing In the centrifuge tube of bacterium, then with the ultrapure washing conical flasks of 250mL and with micropore filter-cloth filtering into new sterile centrifugation tube, collection point Raw spore.The conidium of collection is centrifuged 30 minutes under the conditions of 4 DEG C, 1200rpm, abandons supernatant, with 10mL ultra-pure waters again Suspend precipitation, is transferred to sterile centrifugation tube, is centrifuged 30 minutes under the conditions of 4 DEG C, 1200rpm, abandons supernatant, collects precipitation, obtains Conidium.The conidium concentration of collection is adjusted to 1 × 10 with sterilized water⁶Cfu/mL, then accurately draw 1mL conidiums Suspension, it is seeded in the triangular flask of the 150mL equipped with 100mL Cha Shi fluid nutrient mediums, at 26 DEG C, is secretly trained under the conditions of 200rpm Support.Conidium concentration is measured with blood counting chamber under the microscope, measured 1 mitogenetic spore per 24h from second day to the 9th day Sub- concentration, survey 8 times altogether, each bacterial strain sets three repetitions, and each conidium concentration of every kind of bacterial strain is the flat of its three repetitions Average.

As a result show since the 3rd day, knockout mutations body △ VdpdaA2-a and △ VdpdaA2-b sporulation quantity are obvious Less than V592 bacterial strains (B in Fig. 6), production spores of knockout mutations body △ VdpdaA2-a and the △ VdpdaA2-b in each detection time point Amount is not significantly different, and this shows that VdpdaA2 genes are related to conidium yield, and VdpdaA2 genes take part in conidium Formation.

4th, conidium and hypha form observation

Conidium form is observed：Collect knockout mutations body △ VdpdaA2-a, △ under contemporaneity same culture conditions The conidium of VdpdaA2-b and V592 bacterial strains is observed under the microscope, using V592 bacterial strains as control, observation knockout mutations body Difference between conidium and V592 bacterial strains.

Conidium form observes result：Knockout mutations body △ VdpdaA2-a and △ VdpdaA2-b conidium form Mostly oval, there is oil droplet most of the insides, no difference compared with V592 bacterial strains.

Hypha form is observed：Using the method (slide cultivation) of cell culture, the form of bacterial strain mycelia is seen To examine, i.e., beat the bacteria cake for taking diameter to be about 5mm in bacterial strain colony edge with the toothpick of sterilizing, inversion is placed on sterile slide, Slide is placed in the culture dish of moisturizing, 26 DEG C of light cultures 3 days, takes out slide and observe knockout mutations body under the microscope Mycelia and the mycelia microstructure of V592 bacterial strains.

As a result show after being cultivated 3 days in the culture dish of moisturizing, knockout mutations body △ VdpdaA2-a and △ VdpdaA2- The hypha form and the hypha form no significant difference (C in Fig. 6) of V592 bacterial strains that b is formed.

5th, the conidial sprouting situation of microexamination knockout mutations body

The bacteria cake of knockout mutations body △ VdpdaA2-a, △ VdpdaA2-b and V592 bacterial strains is seeded in Cha Shi cultures respectively In base, 24h is cultivated in 26 DEG C, 200rpm shaking table, conidial suspension is collected with sterile filter cloth, is drawn with liquid-transfering gun Quantitative conidial suspension, the situation of conidia germination is observed under the microscope.

As a result show, V592 bacterial strains and knockout mutations body △ VdpdaA2-a and △ VdpdaA2-b conidia germination are simultaneously There is no notable difference (Fig. 7).

The phenotype of embodiment 2, complemented mutant body

First, the structure of complementing vector

1st, using the genomic DNA of V592 bacterial strains as template, enter performing PCR amplification by primer of PDA2-s and PDA2-x, obtain Pcr amplification product, pcr amplification product are accredited as VdpdaA2 genes (Fig. 8) through agarose gel electrophoresis, include initiation codon ATG and terminator codon TAG, size 1359bp.Using water as template, above-mentioned experiment is carried out, as negative control.The PCR is produced The nucleotide sequence of thing is the nucleotide sequence shown in the 1st-the 1359 of SEQ ID No.3.

2nd, the PCR amplification productions of the VdpdaA2 genes obtained using restriction enzyme SalI and SpeI double digestion step 1 Thing, obtain target gene fragment；By target gene fragment insertion vector pSULPH-mut-RG#PB (its nucleotide sequence such as SEQ Shown in ID No.6) SalI and SpeI recognition sites between, keep carrier pSULPH-mut-RG#PB other sequences constant, obtain To recombinant vector, recombinant vector VdpdaA2 is named as::pSULPH-mut-RG#PB.By recombinant vector VdpdaA2:: PSULPH-mut-RG#PB is sequenced, the results showed that recombinant vector VdpdaA2::PSULPH-mut-RG#PB is upper from 5 ' ends 12617bp is played to the gene order (VdpdaA2 shown in coding SEQ ID No.1) that 13976bp positions are VdpdaA2, should Gene between ToxA promoters and its terminator, insert successfully by target gene fragment.

2nd, the acquisition of complemented mutant body and phenotypic evaluation

Step 1 is obtained into recombinant vector VdpdaA2::PSULPH-mut-RG#PB is converted by electric shocking method and is imported crown gall agriculture Bacillus EHA105, obtain recombinational agrobacterium pSULPH-mut-RG#PB::PDA2.According to the method for embodiment 1, agriculture bar will be recombinated Bacterium pSULPH-mut-RG#PB::PDA2 co-cultures with the knockout mutations body △ VdpdaA2-a in embodiment 1, obtains knockout mutations Body △ VdpdaA2-a complementary transformant (hereinafter referred to as complementary transformant).By complementary transformant and knockout mutations body △ VdpdaA2-a and △ VdpdaA2-b are cultivated on PDA solid mediums respectively, carry out Phenotypic Observation.As a result such as Figure 10 institutes Show, compared with knockout mutations body △ VdpdaA2-a and △ VdpdaA2-b, the phenotype and knockout mutations body △ of complementary transformant VdpdaA2-a and △ VdpdaA2-b phenotype does not have obvious difference, all basically identical with the phenotype of V592 bacterial strains.

3rd, sporulation quantity determines

As a result show since the 6th day, the conidium yield of complementary transformant is apparently higher than knockout mutations body △ VdpdaA2-a and △ VdpdaA2-b (B in Fig. 6), illustrate VdpdaA2 genes VdpdaA2 genes ginseng related to conidium yield With conidial formation.

Claims

1. a kind of method for the restructuring verticillium dahliae for preparing conidium yield reduction, suppressed in purpose verticillium dahliae The expression of VdpdaA2 gene, obtain the restructuring verticillium dahliae that conidium yield is less than the purpose verticillium dahliae；

The VdpdaA2 is that amino acid sequence is protein shown in SEQ ID No.1.

2. according to the method for claim 1, it is characterised in that：The base for suppressing VdpdaA2 in purpose verticillium dahliae The expression of cause is realized by way of by the gene knockout of the VdpdaA2.

3. the restructuring verticillium dahliae of the conidium yield reduction obtained using the methods described of claim 1 or 2.

4. suppress the material of VdpdaA2 gene expression described in claim 1 or reduce VdpdaA2 described in claim 1 Application of the material of activity in anti-verticillium dahliae plant is cultivated.

5. application according to claim 4, it is characterised in that：The plant is the host of verticillium dahliae.

6. application according to claim 5, it is characterised in that：The host of the verticillium dahliae is cotton.

7. suppress the material of VdpdaA2 gene expression described in claim 1 or reduce VdpdaA2 described in claim 1 Application of the material of activity in verticillium dahliae inhibitor is prepared.

8. VdpdaA2 described in claim 1, or the biomaterial of the correlations of VdpdaA2 described in claim 1 are big beautiful in regulation and control Application in Verticillium dahliae conidium yield；

Any of the biomaterial related VdpdaA2 is following A 1) to A20)：

A1) nucleic acid molecules；The nucleic acid molecules are the nucleic acid molecules of VdpdaA2 described in coding claim 1；