CN110669773B

CN110669773B - Application of gene FoPDCD5 in regulation and control of pathogenicity of banana fusarium oxysporum

Info

Publication number: CN110669773B
Application number: CN201910986131.4A
Authority: CN
Inventors: 李云锋; 聂燕芳; 蒙姑; 李华平; 王振中
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2019-10-17
Filing date: 2019-10-17
Publication date: 2021-03-26
Anticipated expiration: 2039-10-17
Also published as: CN110669773A

Abstract

The invention discloses an application of a gene FoPDCD5 in regulation and control of pathogenicity of banana vascular wilt, and belongs to the field of plant genetic engineering. The gene is knocked out from banana fusarium oxysporum by using a homologous recombination method to obtain a knock-out mutant delta Fopdcd 5; introducing a gene complementation vector into a delta Fopdcd5 protoplast by constructing the vector; the gene was complemented back into the knockout mutant by random insertion to obtain the complementing mutant Δ Fopdcd 5-com. Pathogenicity assays indicate that the pathogenicity of the knockout mutant Δ Fopdcd5 is significantly reduced; the pathogenicity of the anaplerotic mutant Δ Fopdcd5-com was restored to wild-type levels. The invention proves that the FoPDCD5 is necessary for generating conidia of the fusarium oxysporum f.sp.cubense, and coping with oxidative stress and pathogenicity. Contributes to deeply clarifying the pathogenic molecular mechanism of the banana fusarium wilt and provides a target gene for developing an effective bactericide.

Description

Application of gene FoPDCD5 in regulation and control of pathogenicity of banana fusarium oxysporum

Technical Field

The invention belongs to the field of plant genetic engineering, and particularly relates to application of a gene FoPDCD5 in regulation and control of pathogenicity of banana vascular wilt.

Background

The banana wilt is one of the most important diseases in banana production in China, and seriously threatens the sustainable development of the banana industry. The pathogeny of banana vascular wilt is Fusarium oxysporum cubense (Fusarium oxysporum f.sp. cubense, Foc), and the Fusarium oxysporum cubense can be divided into 3 physiological races according to the difference of host susceptibility, wherein the 4 physiological race (Foc4) has the most serious harm and can almost harm all current cultivated varieties. At present, the prevention and control of banana vascular wilt mainly comprises breeding resistant varieties, but because most cultivated bananas are triploid, the bananas are highly sterile and have no seeds, the conventional crossbreeding of the bananas is very difficult. Fully excavates pathogenic related genes of banana fusarium wilt and develops functional research thereof, is helpful for comprehensively understanding pathogenic molecular mechanism of the banana fusarium wilt, and provides theoretical basis for prevention and control of the banana fusarium wilt.

PDCD5(Program Cell Death Protein 5) is an apoptosis accelerating Protein containing 1 DNA-binding domain and has high conservation in evolution. The current research on the PDCD5 protein is mainly focused on human cancer cells, and the main role is to regulate programmed cell death and immune regulation. No report is made about the specific function of PDCD5 in plant pathogenic fungi. In the study of proteomics of fusarium oxysporum f.sp.cubense, a predicted Protein Program Cell Death Protein 5, predicted, the function of which in fusarium oxysporum f.sp.cubense is unknown, is identified.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention aims to provide the application of the gene FoPDCD5 in regulating and controlling the pathogenicity of banana vascular wilt.

The invention discloses a gene FoPDCD5 of banana fusarium wilt and a new function of a coding protein PDCD5 thereof. The gene FoPDCD5 is SEQ ID NO: 1, and the encoded protein PDCD5 is SEQ ID NO: 2; the PDCD5 protein contains 1 DNA-binding domain. The invention constructs a gene knockout vector and introduces the gene knockout vector into a protoplast of the fusarium oxysporum f.sp.cubense; knocking out the gene from fusarium oxysporum f.sp.cubense by using a homologous recombination method to obtain a knock-out mutant delta Fopdcd 5; introducing a gene complementation vector into a delta Fopdcd5 protoplast by constructing the vector; the gene was complemented back into the knockout mutant by random insertion to obtain the complementing mutant Δ Fopdcd 5-com. The knock-out mutant of the gene has defects in conidium generation and stress response to oxidation. Pathogenicity assays indicate that the pathogenicity of the knockout mutant Δ Fopdcd5 is significantly reduced; the pathogenicity of the anaplerotic mutant Δ Fopdcd5-com was restored to wild-type levels. The experiments prove that the banana fusarium oxysporum FoPDCD5 is a pathogenic related gene of the banana fusarium oxysporum.

The purpose of the invention is realized by the following technical scheme:

the invention provides application of a gene FoPDCD5 in regulation and control of pathogenicity of banana vascular wilt.

Further, the gene FoPDCD5 is applied to regulating and controlling the spore yield of the fusarium oxysporum f.sp.cubense.

Further, the gene FoPDCD5 is applied to the regulation of the stress resistance of banana fusarium oxysporum;

preferably, the stress is oxidative stress.

The invention provides application of a gene FoPDCD5 in preventing and treating banana wilt caused by banana fusarium wilt.

The invention provides application of a gene FoPDCD5 as a target for a plant disease control drug, wherein the plant disease is banana vascular wilt caused by banana vascular wilt.

The invention further provides a method for treating banana vascular wilt caused by banana vascular wilt, which comprises blocking or inhibiting the expression of the gene FoPDCD5 in the banana vascular wilt (for example, by using antisense RNA or siRNA of the gene).

An application of a medicament (for example, antisense RNA or siRNA and the like using the gene) for blocking or inhibiting the expression of the gene FoPDCD5 in the fusarium oxysporum f.sp.cubense in preparing a medicament for controlling the fusarium oxysporum f.sp.cubense caused by the fusarium oxysporum f.sp.cubense.

Wherein, the amino acid sequence of the banana fusarium oxysporum gene FoPDCD5 is shown as SEQ ID NO: 2, or as shown in SEQ ID NO: 2 through one or more amino acid substitutions, insertions and deletions, and the obtained analogue still has the function of controlling the pathogenicity of the fusarium oxysporum;

the nucleotide sequence of the gene FoPDCD5 is one of the following A, B, C:

A. encoding the amino acid sequence of SEQ ID NO: 2;

B. as shown in SEQ ID NO: 1;

C. the analogues obtained by the above A and B through base insertion, deletion or substitution still have the function of controlling the pathogenicity of the fusarium oxysporum f.sp.cubense;

further, the banana fusarium oxysporum is a No. 4 physiological race of the banana fusarium oxysporum (Foc 4).

The application of the knock-out vector and the recombinant bacteria containing the gene FoPDCD5 in the aspects also belongs to the protection scope of the invention.

Compared with the prior art, the invention has the following advantages and effects:

the gene FoPDCD5 of the banana fusarium oxysporum provided by the invention contains 1 DNA-binding domain, but the biological function of the gene in the banana fusarium oxysporum is not clear. Replacing a coding gene FoPDCD5 of protein PDCD5 with a hygromycin phosphotransferase gene (hph) and a fluorescent protein gene (SGFP) to obtain a Foc4 knockout mutant delta Fopdcd 5; experiments prove that compared with Foc4 wild type, the yield of the delta Fopdcd5 spores is obviously reduced, and the spores are more sensitive to oxidative stress; pathogenicity tests show that the deletion of FoPDCD5 obviously reduces the pathogenicity of banana vascular wilt; after the gene is complemented back, the pathogenicity of the gene is recovered. The invention proves that the FoPDCD5 is necessary for generating conidia of the fusarium oxysporum f.sp.cubense, and coping with oxidative stress and pathogenicity. The research of the people is helpful to deeply elucidate the pathogenic molecular mechanism of the banana fusarium oxysporum and provides a target gene for developing an effective bactericide.

Drawings

FIG. 1 is a schematic diagram of construction of a banana fusarium oxysporum gene FoPDCD5 knockout vector.

FIG. 2 is a schematic diagram of the construction of a banana fusarium oxysporum gene FoPDCD5 complementation vector.

FIG. 3 is a PCR amplification of part of the hygromycin-resistant transformant A-hph gene; m: marker 5000; lane 1: the plasmid pCT 74; lanes 2-6:

transformants

1, 2, 3, 4 and 5.

FIG. 4 is a PCR amplification of the partial hygromycin-resistant transformant gene of interest FoPDCD 5; m: marker 5000; lane wt: foc4 wild type; lanes 1-3:

transformants

1, 2 and 5.

FIG. 5 is a Southern blot analysis of Foc4 knock-out transformants probed with FoPDCD5 fragment;

FIG. 6 is a Southern blot analysis of Foc4 knockout transformants probed with the hph fragment;

FIG. 7 is an analysis of the knockout mutant Δ Fopdcd5 for different stress conditions.

FIG. 8 is a PCR analysis of the FoPDCD5 gene of a portion of bleomycin resistant transformants; m: marker 5000; lane 1: foc4 wild type; lanes 2-5:

transformants

1, 2, 5 and 7.

FIG. 9 is a pathogenicity analysis of the knockout mutant Δ Fopdcd5 and the anaplerotic mutant Δ Fopdcd 5-com.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

The test methods in the following examples, in which specific experimental conditions are not specified, are generally performed according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. The materials, reagents and the like used are, unless otherwise specified, reagents and materials obtained from commercial sources.

Example 1

1. Experimental Material

1.1 test strains and plants

The test strain is banana fusarium wilt bacterium No. 4 physiological race (Foc4), and the test plant is Brazilian banana (Cavendish, AAA) with 4-5 leaves.

1.2 host bacteria and plasmid vectors

The cloning vector is pMD18-T vector, the gene knockout vector is filamentous fungus expression vector pCT74, and the gene complementation vector is pCTZN (obtained by modification of the laboratory on the basis of pCT74 plasmid, namely SGFP and hph genes on pCT74 are replaced by bleomycin (Zeocin) genes).

2. Experimental methods

2.1 amplification of homologous fragments upstream and downstream of FoPDCD5 of Banana wilt bacteria

The construction of the gene knockout vector of banana wilt bacterium FoPDCD5 is shown in figure 1. Sequences about 1500bp in length (named as homology arm A fragment and homology arm B fragment respectively) are selected at the upstream and downstream of the FoPDCD5 gene, and primers are designed (Table 1).

TABLE 1 amplification primers for the A and B fragments of the homology arm of the FoPDCD5 gene

Primer name	Primer sequence 5 '-3'	Cleavage site
			FoPDCD5-AF	GGGGTACCGAACAGGGATTCTGTTAAGCAGTTC	Kpn I
FoPDCD5-AR	CCGGGCCCGATCTTGATACGTGACGTTCTTTAA	ApaI
			FoPDCD5-BF	GGAATTCGAGGTGCTTGTGATACCATGGAATT	EcoR I
FoPDCD5BR	GACTAGTCGTCATGTCGTTTTTCGATCCCTAT	SpeI

Extracting Foc4 genome DNA with fungus DNA extraction Kit (OMEGA Fungal DNA Kit); performing PCR amplification by using the genomic DNA as a template and primers FoPDCD5-AF and FoPDCD5-AR to obtain a homologous arm A fragment (FoPDCD5-A) of the FoPDCD5 gene; primers FoPDCD5-BF and FoPDCD5-BR are used for PCR amplification to obtain a B fragment (FoPDCD5-B) of a homology arm of the FoPDCD5 gene.

The specific PCR reaction system is as follows:

template DNA	1.0μL
		FoPDCD5-AF/BF(10μmol/L)	1.0μL
FoPDCD5-AR/BR(10μmol/L)	1.0μL
		10×Taq Buffer(Mg²⁺plus)	5.0μL
dNTPs(2.5mmol/L)	4.0μL
		Taq(5U/μL)	0.5μL
ddH₂O	37.5μL
		Total	50.0μL

The PCR reaction conditions are as follows: reacting at 94 ℃ for 5 min; reacting at 94 ℃ for 1min, at 67 ℃ for 1min and at 72 ℃ for 1min for 35 cycles; the reaction was carried out at 72 ℃ for 10 min. And (3) cleanly recovering the PCR amplification product by using an OMEGA Cycle Pure Kit.

2.2 construction of FoPDCD5 Gene knockout vector

FoPDCD5-A and FoPDCD5-B were ligated to T vectors, respectively, with reference to the Kit instructions of pMD18-T Vector Cloning Kit (Takara corporation), to obtain recombinant plasmids pMD18T-FoPDCD5-A and pMD18T-FoPDCD 5-B. The method specifically comprises the following steps: mu.L of pMD18-T vector was taken, 4. mu.L of the above PCR-recovered product (homology arm A fragment or homology arm B fragment) and 5. mu.L of solution I were added, respectively, and ligated at 16 ℃ overnight. Adding 10 μ L of the ligation product into 100 μ L of Escherichia coli DH5 α competent cells, and standing on ice for 30 min; heating in 42 deg.C water bath for 90s, and cooling on ice for 5 min; adding 800 μ L LB liquid medium, and culturing at 37 deg.C and 150rpm for 45min under shaking; centrifuging at 4000rpm for 5min, discarding the supernatant, leaving 100 μ L of bacterial liquid, mixing with the precipitate, and coating on LB solid culture medium (containing 50 μ g/mL Amp); culturing at 37 ℃ for 8-12 h.

And (3) selecting positive transformants with Amp resistance, extracting recombinant plasmid DNA, and performing sequencing identification. The vector pMD18T-FoPDCD5-A and the vector pCT74 are subjected to double enzyme digestion by Kpn I and ApaI respectively, and an A fragment and the vector pCT74 are recovered. Connecting the A fragment with pCT74 by using T4 DNA ligase, and transforming Escherichia coli DH5 alpha; the recombinant plasmid pCT74-FoPDCD5-A is obtained. The same procedure was followed using EcoRI and SpeI to double digest pMD18T-FoPDCD5-B and recombinant plasmid pCT74-FoPDCD5-A, recovering the B fragment and recombinant plasmid. Connecting the B fragment with pCT74-FoPDCD5-A by using T4 DNA ligase, and transforming Escherichia coli DH5 alpha; and enzyme digestion identification is carried out to obtain a gene knockout vector pCT74-FoPDCD 5-KO.

2.3 amplification of the FoPDCD5 anaplerotic fragment

The construction of the banana fusarium oxysporum FoPDCD5 gene complementation vector is shown in figure 2. A promoter sequence with the length of 1500bp is selected at the upstream of the FoPDCD5 gene, a terminator sequence with the length of 500bp is selected at the downstream, and primers are designed (Table 2).

TABLE 2 amplification primers for the complementing fragment of the FoPDCD5 gene

Primer name	Primer sequence 5 '-3'	Cleavage site
			FoPDCD5-comF	GGAATTC GCGCCATCACGGCCA	EcoR I
FoPDCD5-comR	GACTAGTTAGGCGTTCATTCATTATTTCCGT	SpeI

Extracting banana fusarium wilt germ genome DNA by using a fungus DNA extraction Kit (OMEGA Fungal DNA Kit); the genomic DNA was used as a template, and primers FoPDCD5-comF and FoPDCD5-comR were used to perform PCR amplification, so as to obtain a complementary fragment (FoPDCD5-com) of the FoPDCD5 gene.

The specific PCR reaction system is as follows:

template DNA	1.0μL
		FoPDCD5-comF(10μmol/L)	1.0μL
FoPDCD5-comR(10μmol/L)	1.0μL
		10×Taq Buffer(Mg²⁺plus)	5.0μL
dNTPs(2.5mmol/L)	4.0μL
		ExTaq(5U/μL)	0.5μL
ddH₂O	37.5μL
		Total	50.0μL

The PCR reaction conditions are as follows: reacting at 94 ℃ for 5 min; reacting at 94 ℃ for 1min, at 60 ℃ for 1min and at 72 ℃ for 4min for 30 cycles; the reaction was carried out at 72 ℃ for 10 min. And (3) cleanly recovering the PCR amplification product by using an OMEGA Cycle Pure Kit.

2.4 construction of the FoPDCD5 Gene complementation vector

And carrying out double enzyme digestion on the FoPDCD5-com vector and the pCTZN vector by using EcoR I and SpeI respectively, and recovering a FoPDCD5-com fragment and the pCTZN vector. Connecting the FoPDCD5-com fragment with pCTZN by using T4 DNA ligase, and transforming Escherichia coli DH5 alpha; obtaining the recombinant plasmid pCTZN-FoPDCD 5-com. After enzyme digestion identification, the gene complementation vector pCTZN-FoPDCD5-com is obtained.

2.5 preparation of 2.5 Foc4 protoplasts

Foc4 was inoculated into Chachi's medium (FeSO)₄.7H₂O 0.018g，KCl 0.5g，K₂HPO₄.3H₂O 1g，MgSO₄.7H₂O 0.5g，NaNO₃3g, 30g of cane sugar and distilled water to a constant volume of 1L), and carrying out shaking culture at 28 ℃ and 150rpm for 3 d; the culture broth was filtered through a 200 mesh cell sieve, centrifuged at 10000 Xg for 10min at 4 ℃ and the supernatant was discarded. The precipitate was resuspended in NCM medium (10 g glucose, 4g aspartic acid, 50mL 20 Xnitrate, 1mL 1000 Xvitamin, 1mL 1000 Xmicroelement, 5mL 200 Xiron salt, constant volume of 1L, pH 6.5) and diluted to obtain Foc4 conidia suspension. Inoculating the prepared conidium suspension into NCM culture medium to make the final concentration of conidium be 1 × 10⁶Per mL; 120rpm at 28 ℃Shake culturing for 11-12 h, filtering with 200 mesh cell sieve, and washing with 0.8mol/L NaCl solution (osmotic pressure stabilizer) for 3-5 times to obtain fresh mycelium. Adding a proper amount of 15g/L of collapse enzyme solution according to the ratio of the enzyme solution to the hyphae (the volume mass ratio is 10:1), and carrying out enzymolysis for 3h at 30 ℃ and 120rpm to obtain a protoplast enzymolysis solution. Centrifuge at 400 Xg for 10min at 4 ℃ and discard the supernatant. 1mL of precooled STC solution (containing 10mmol/L Tris-HCl (pH 7.5), 1.2mol/L sorbitol, 50mmol/L CaCl) was added₂) Resuspending the pellet; centrifuging and discarding the supernatant. Adding 10-20 mL of precooled STC to re-suspend the precipitate to obtain Foc4 protoplast suspension, wherein the final concentration of the protoplast is about 1 × 10⁷one/mL.

Knocking out the mutant protoplast of the banana fusarium oxysporum, and preparing according to the preparation steps of the banana fusarium oxysporum protoplast.

2.6 transformation of mutant protoplasts of the 2.6 Foc4 knockout

The knock-out vector pCT74-FoPDCD5-KO was double digested with Kpn I and SpeI to obtain the A-hph-sgfp-B fragment. Mixing 5 μ g of A-hph-sgfp-B fragment with 200 μ L of protoplast; or, mixing pCTZN-FoPDCD5-com plasmid with 200 μ L of banana fusarium wilt germ knockout mutant protoplast uniformly; performing ice bath for 15 min; 1mL of PSTC conversion buffer (40% PEG4000, 1.2mol/L sorbitol, 50mmol/L CaCl) was added dropwise₂10mmol/L Tris-HCl, pH7.5), mixing, and standing on ice for 15 min; adding 10mL of precooled STC, and uniformly mixing; centrifuging at 4000rpm at 4 deg.C for 15 min; 6mL of supernatant was removed, and the pellet was resuspended in 3mL of PSB regeneration medium (potato 200.0g, sucrose 273.6g, distilled water to a constant volume of 1L), and shake-cultured at 28 ℃ and 100rpm for 12-16 h. Centrifuging at 4000rpm at 4 ℃ for 15min, removing 5mL of supernatant, adding 12mL of PSA regeneration medium (1.5% agar powder, 150. mu.g/mL hygromycin or 200. mu.g/mL bleomycin are added into PSB regeneration medium), uniformly mixing, pouring, and culturing in dark at 28 ℃ for 2-3 d; picking hygromycin (or bleomycin) resistant transformants, transferring the transformants to a PDA (potato dextrose agar) culture medium (containing 200.0g of potatoes, 20.0g of anhydrous glucose, 15.0g of agar and distilled water with the constant volume of 1L) containing 150 mug/mL of hygromycin (or 200 mug/mL of bleomycin), carrying out dark culture at 28 ℃ for 3-4 days, and picking single colonies for identification.

2.7 PCR-validated analysis of 2.7 Foc4 knockout mutants

Genomic DNA of the hygromycin-positive transformant was extracted and analyzed by PCR validation according to the Fungal DNA extraction Kit (OMEGA Fungal DNA Kit). Respectively carrying out PCR amplification on the A-hph gene segments by using primers A-hph-F/A-hph-R; PCR amplification analysis of the FoPDCD5 gene fragment was performed with primers FoPDCD5-F/FoPDCD 5-R.

A-hph-F：5′-GCCTGAAGAAGTTCTGCTACCGCCG-3′，

A-hph-R：5′-TGGCAAACTGTGATGGACGACACCG-3′，

FoPDCD5-F：5′-ATGGATGACGCAGATTAGAACAGG-3′，

FoPDCD5-R：5′-TTACAGATCCAAATCGTCATCATCG-3′；

The PCR reaction system is as follows:

template DNA	0.5μL
		FoPDCD5-F/A-hph-F(10μmol/L)	0.5μL
FoPDCD5-R/A-hph-R(10μmol/L)	0.5μL
		10×Taq Buffer(Mg²⁺plus)	2.5μL
dNTPs(2.5mmol/L)	2.0μL
		Taq(5U/μL)	0.25μL
ddH₂O	18.75μL
		Total	25.0μL

The PCR reaction conditions are as follows: reacting at 94 ℃ for 5 min; reacting at 94 ℃ for 1min, at 56 ℃ for 1min and at 72 ℃ for 1min for 30 cycles; reacting at 72 ℃ for 10min to obtain an amplification product.

2.8 Southern blot analysis of the 2.8 Foc4 knockout mutant

Southern blot hybridization was performed according to the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche). The target gene probe is amplified by using a primer FoPDCD5-F/FoPDCD5-R, and the hph gene probe is amplified by using hph-F/hph-R.

FoPDCD5-F：5′-ATGGATGACGCAGATTAGAACAGG-3′，

FoPDCD5-R：5′-TTACAGATCCAAATCGTCATCATCG-3′，

hph-F：5′-TGCTGCTCCATACAAGCCAA-3′，

hph-R：5′-GACATTGGGGAGTTCAGCGA-3′；

The PCR amplification system of the DNA probe is as follows:

template DNA	1.0μL
		FoPDCD5-F/hph-F(20μmol/L)	1.0μL
FoPDCD5-R/hph-R(20μmol/L)	1.0μL
		10×Ex Taq Buffer(Mg²⁺plus)	5.0μL
dNTPs(2.5mmol/L)	4.0μL
		Ex Taq(5U/μL)	0.5μL
ddH₂O	37.5μL
		Total	50.0μL

2.9 phenotypic Observation of the 2.9 Foc4 knockout mutant

(1) Observing colony morphology and measuring growth speed. Foc4 wild type and knockout mutant, Δ Fopdcd5, were inoculated onto PDA medium and cultured in the dark at 28 ℃. The colony diameters were measured at 1d, 3d, 5d, and 7d, respectively, and the colony morphologies were observed.

(2) And (5) observing the generation and germination of conidia. Inoculating the banana fusarium oxysporum to a Chachi culture medium, placing the Chachi culture medium at 28 ℃, performing shake culture at 120rpm, and counting the sporulation amount after 7 days. The conidium suspension is inoculated on an NCM culture medium, shake culture is carried out at the temperature of 28 ℃ and the rpm of 120, samples are taken at the time of 11h, and the germination condition of the conidia is observed.

2.10 knockout mutant Δ Fopdcd5 stress resistance assay

(1) Analysis of high osmotic stress

Foc4 wild type and Δ Fopdcd5 were inoculated on PDA medium containing 1mol/L NaCl and 1mol/L sorbitol, respectively, and after culturing in an inverted incubator at 28 ℃ for 7d, the colony growth of Δ Fopdcd5 and the wild type strain was observed.

(2) Oxidative stress assay

Inoculating wild type and knockout mutant delta Fopdcd5 of banana wilt bacteria in a medium containing 50mmol/L H₂O₂After culturing on the PDA medium in an inverted incubator at 28 ℃ for 7 days, the growth of colonies of Δ FoPdcd5 and the wild type strain was observed.

(3) Cell wall integrity analysis

The wild type and knockout mutant delta Fopdcd5 of banana wilt bacteria were inoculated on PDA medium containing 0.02% SDS, respectively, and after inverted culture in an incubator at 28 ℃ for 7 days, colony growth of delta Fopdcd5 and the wild type strain was observed.

2.11 PCR identification and phenotypic analysis of FoPDCD5 complementation mutants

(1) PCR identification of FoPDCD5 complementation mutant

Genomic DNA of the bleomycin positive transformant was extracted according to the Fungal DNA extraction Kit (OMEGA Fungal DNA Kit) protocol and subjected to PCR-based assay. PCR amplification of gene fragment FoPDCD5 was performed with primers FoPDCD5-F/FoPDCD 5-R.

The PCR reaction system is as follows:

template DNA	0.5μL
		FoPDCD5-F(10μmol/L)	0.5μL
FoPDCD5-R(10μmol/L)	0.5μL
		10×Taq Buffer(Mg²⁺plus)	2.5μL
dNTPs(2.5mmol/L)	2.0μL
		Taq(5U/μL)	0.25μL
ddH₂O	18.75μL
		Total	25.0μL

(2) Phenotypic analysis of FoPDCD5 complementation mutants

1) And (5) observing colony morphology. Foc4 wild type, knockout mutant and complementation mutant were inoculated on PDA medium and cultured at 28 ℃ in the dark. The colony diameter was measured at 7d and its colony morphology was observed.

2) And (4) analyzing the sporulation yield. Inoculating the wild type, knockout mutant and anaplerotic mutant of banana fusarium wilt bacteria to a Chaudhur culture medium, placing the Chaudhur culture medium at 28 ℃ and 120rpm for shake culture, and counting the sporulation yield after 7 days.

2.12 pathogenicity analysis of knockout mutant Δ Fopdcd5 and anaplerosis mutant Δ Fopdcd5-com

The Brazil banana at the 4-leaf stage was picked up and conidia (2X 10) of Foc4 wild type, knockout mutant delta Fopdcd5 and anaplerosis mutant delta Fopdcd5-com were used⁵seed/mL) suspension is soaked for 30min and then transplanted into nutrient soil; culturing in 25 + -1 deg.C plant culture room, alternately culturing in light/dark for 12h/12h, and observing the occurrence of leaf and corm of banana seedling after 25 daysThe situation is.

3 results and analysis

3.1 construction of the banana vascular wilt bacterium FoPDCD5 Gene knockout vector

Respectively cloning to obtain a FoPDCD5 gene homologous arm A fragment and a homologous arm B fragment by adopting a PCR amplification method; respectively connecting the recombinant plasmid with a T vector, and obtaining recombinant plasmids pMD18T-FoPDCD5-A and pMD18T-FoPDCD5-B through transformation of escherichia coli, Amp resistance screening, plasmid extraction and sequencing identification. Connecting pMD18T-FoPDCD5-A with pCT74 plasmid to obtain recombinant plasmid pCT74-FoPDCD 5-A; carrying out double enzyme digestion on the gene fragment and pMD18T-FoPDCD5-B, and obtaining a gene knockout vector pCT74-FoPDCD5-KO (figure 1) through DNA connection, escherichia coli transformation and enzyme digestion identification.

3.2 construction of the Banana wilt bacterium FoPDCD5 Gene complementation vector

Cloning to obtain a gene complementation fragment of FoPDCD5 by adopting a PCR amplification method; the recombinant plasmid pCTZN-FoPDCD5-com (figure 2) is obtained by connecting the recombinant plasmid pCTZN with a pCTZN vector, and carrying out escherichia coli transformation, Amp resistance screening, plasmid extraction and sequencing identification.

3.3 selection of knockout mutant Δ Fopdcd5

3.3.1 PCR verification of Gene fragment A-hph

A homologous recombination method is utilized to convert the gene knockout carrier into protoplasts of the fusarium oxysporum f.sp.cubense, and 36 hygromycin positive transformants are obtained. After DNA extraction, 36 hygromycin positive transformants were subjected to PCR validation analysis using A-hph gene specific primers. As a result, the A-hph gene was amplified in all of the 36 transformants (FIG. 3).

3.3.2 PCR validation of Gene fragment FoPDCD5

Further, the 36 positive transformants amplified by the above PCR to the A-hph gene were subjected to PCR validation analysis of FoPDCD5 using FoPDCD5 gene-specific primers. The results indicated that 2 of the 36 transformants did not amplify to the FoPDCD5 gene, further indicating that these 2 transformants were positive transformants (fig. 4).

3.3.3 Southern blot validation of knockout mutants

Southern blot analysis was performed on 2 positive transformants amplified to the A-hph gene and not amplified to the FoPDCD5 gene. As a result, hybridization was carried out using the target gene as a probe, and no hybridization band was observed in any of 2 transformants (FIG. 5). Hybridization was performed with hph as probe and single copy bands appeared in all 2 transformants (FIG. 6). The above experiments further demonstrated that these 2 transformants were positive transformants.

3.4 colony morphology and growth Rate determination of knockout mutant Δ Fopdcd5

The knockout mutant Δ Fopdcd5 was inoculated into PDA medium and growth was observed at different times. The results showed that there was no significant difference in colony morphology and growth rate of Δ Fopdcd5 compared to wild type of fusarium oxysporum f.sp.

Sporulation analysis of 3.5 knockout mutant Δ Fopdcd5

The knockout mutant Δ Fopdcd5 was inoculated into a Chacker medium and cultured for 7 days for spore production analysis. The results show that the sporulation yield of the mutant Δ Fopdcd5 is significantly lower than that of its wild type.

3.6 Germination Observation of the knock-out mutant Δ Fopdcd5 conidia

Inoculating conidia into an NCM culture medium, and performing shake culture at 28 ℃ and 120 rpm; after 11h, observation was carried out. The result shows that the germination of Foc4 wild type conidium has no obvious difference with that of the knock-out mutant delta Fopdcd5, which indicates that the germination of the conidium of the fusarium oxysporum f.sp.cubense is not influenced after the FoPDCD5 is knocked out.

Analysis of the 3.7 knockout mutant Δ Fopdcd5 for different stress conditions

The knockout mutants (. DELTA.Fopdcd 5-2 and. DELTA.Fopdcd 5-5) were inoculated with 1mol/L NaCl, 1mol/L sorbitol, and 50mmol/L H, respectively₂O₂Or 0.02% SDS in PDA medium, the colony morphology and diameter were determined (FIG. 7). The results show that (1) in PDA medium containing NaCl and sorbitol, the delta Fopdcd5 has no obvious difference from the wild type, which indicates that FoPDCD5 has no influence on the high osmotic pressure resistance of Foc 4. (2) In PDA medium with 0.02% SDS, the growth of mutant Δ Fopdcd5 was not significantly different from wild type compared to wild type, indicating that knockout of Fopdcd5 had no effect on Foc4 cell wall integrity. (3) Under oxidative stress conditions, withCompared with the wild type, the colony growth of the delta Fopdcd5 mutant is slow, which indicates that the FoPDCD5 plays an important role in the reaction of Foc4 against oxidative stress.

3.8 identification and phenotypic analysis of the anaplerotic mutant Δ Fopdcd5-com

By using a random insertion method, the gene complementation vector pCTZN-FoPDCD5-com is transformed into a protoplast of the fusarium oxysporum delta Fopdcd5 to obtain 9 bleomycin positive transformants. PCR verification analysis was performed on these positive transformants by extraction of genomic DNA and using FoPDCD5 gene specific primers. The result shows that 4 positive transformants can be amplified to the target gene fragment, which indicates that the 4 transformants contain the FoPDCD5 gene; these 4 transformants were confirmed as positive transformants (FIG. 8). Colony morphology observation and sporulation analysis are carried out on the anaplerotic mutant delta Fopdcd5-com, and the result shows that the colony morphology and the sporulation of the anaplerotic mutant are restored to the wild type level.

3.9 pathogenicity analysis of knockout mutant Δ Fopdcd5 and anaplerosis mutant Δ Fopdcd5-com

Brazil bananas were inoculated with Foc4 wild type,. DELTA.Fopdcd 5, and anaplerotic mutant,. DELTA.Fopdcd 5-com conidia, respectively, using the root-damaging inoculation method, and observed after 25 days. The result shows that the Brazilian banana seedlings of the clear water control group have no leaf yellowing phenomenon, and the corms have no color change; foc4 after wild type inoculation, obvious yellowing appears on the leaves at the upper and lower parts of the whole banana plant, and browning appears in more than 50% of the corm area; after inoculation with Δ Fopdcd5, only the lower leaves of banana plants appeared yellow, with no more than 20% of the bulb discoloration. After inoculation of the anaplerotic mutant Δ Fopdcd5-com, the upper and lower leaves of banana plants also yellow to a large extent, and over 50% of the bulb region browned (fig. 9). Further statistics are carried out on disease indexes, and the results show that the disease indexes of the delta Fopdcd5-com are similar to those of the Foc4 wild type, which indicates that the pathogenicity of the delta Fopdcd5-com is restored to the wild type level; meanwhile, the disease index of the delta Fopdcd5 is obviously lower than that of a wild type mutant and a anaplerotic mutant, which shows that after the FoPDCD5 gene is knocked out, the pathogenicity of banana fusarium oxysporum is obviously reduced.

Therefore, the gene provided by the invention can be used for preventing and treating plant diseases, particularly banana vascular wilt caused by banana vascular wilt. In addition, the gene provided by the invention can be used as a target of a medicament for preventing and treating plant diseases. Following the teachings and teachings of this specification, one skilled in the art can develop a medicament for controlling plant diseases, particularly banana vascular wilt.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> southern China university of agriculture

Application of <120> gene FoPDCD5 in regulation and control of pathogenicity of banana fusarium oxysporum

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 495

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> nucleotide sequence of gene FoPDCD5

<220>

<222> (25)..(77)

<223> non-coding region 1

<220>

<222> (167)..(218)

<223> non-coding region 2

<400> 1

atggatgacg cagagttaga acaggtagct cacttttgtg gattttatcg ggagtccatc 60

actgattttc ttcgcagtta cgaaaagctc gtctggagca actgaaggcc gaagctggtg 120

gcagtggagg cggttcttct ggtcaggaac aacaacagca gcgccagtca gttgtctcga 180

tccataccgt acgacattat cttactgacc ttgaataggc aacagcaaaa tgatgctcgc 240

caacacatcc tcaaccagat cctccatccc gaagccgccg accgtctagg ccgtatccga 300

cttgtgaaag aggagcgtgc cgccgatatc gagaaccgac ttatcacgct tgcacaaacc 360

ggtcaacttc gacagaaggt cactgaagcg caactcaagg agcttctgaa cgctatgtcg 420

gagagcaagg aggaggagaa gattgttgtg agcagacgca aggcgtggga cgatgatgac 480

gatttggatc tgtaa 495

<210> 2

<211> 129

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> amino acid sequence of gene FoCWM

<400> 2

Met Asp Asp Ala Glu Leu Glu Gln Leu Arg Lys Ala Arg Leu Glu Gln

1 5 10 15

Leu Lys Ala Glu Ala Gly Gly Ser Gly Gly Gly Ser Ser Gly Gln Glu

20 25 30

Gln Gln Gln Gln Arg Gln Gln Gln Gln Asn Asp Ala Arg Gln His Ile

35 40 45

Leu Asn Gln Ile Leu His Pro Glu Ala Ala Asp Arg Leu Gly Arg Ile

50 55 60

Arg Leu Val Lys Glu Glu Arg Ala Ala Asp Ile Glu Asn Arg Leu Ile

65 70 75 80

Thr Leu Ala Gln Thr Gly Gln Leu Arg Gln Lys Val Thr Glu Ala Gln

85 90 95

Leu Lys Glu Leu Leu Asn Ala Met Ser Glu Ser Lys Glu Glu Glu Lys

100 105 110

Ile Val Val Ser Arg Arg Lys Ala Trp Asp Asp Asp Asp Asp Leu Asp

115 120 125

Leu

<210> 3

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> FoPDCD5-AF

<400> 3

ggggtaccga acagggattc tgttaagcag ttc 33

<210> 4

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> FoPDCD5-AR

<400> 4

ccgggcccga tcttgatacg tgacgttctt taa 33

<210> 5

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> FoPDCD5-BF

<400> 5

ggaattcgag gtgcttgtga taccatggaa tt 32

<210> 6

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> FoPDCD5-BR

<400> 6

gactagtcgt catgtcgttt ttcgatccct at 32

<210> 7

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> FoPDCD5-comF

<400> 7

ggaattcgcg ccatcacggc ca 22

<210> 8

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> FoPDCD5-comR

<400> 8

gactagttag gcgttcattc attatttccg t 31

<210> 9

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> A-hph-F

<400> 9

gcctgaagaa gttctgctac cgccg 25

<210> 10

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> A-hph-R

<400> 10

tggcaaactg tgatggacga caccg 25

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> FoPDCD5-F

<400> 11

atggatgacg cagattagaa cagg 24

<210> 12

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> FoPDCD5-R

<400> 12

ttacagatcc aaatcgtcat catcg 25

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> hph-F

<400> 13

tgctgctcca tacaagccaa 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> hph-R

<400> 14

gacattgggg agttcagcga 20

Claims

1. The application of the gene FoPDCD5 in regulating and controlling the spore yield of the fusarium oxysporum f.sp.cubense is characterized in that: the coded amino acid sequence of the banana fusarium oxysporum gene FoPDCD5 is shown as SEQ ID NO: 2, respectively.

2. The application of the gene FoPDCD5 in regulating and controlling the stress resistance of banana vascular wilt in claim 1 is characterized in that: the stress is oxidative stress.

3. The application of the gene FoPDCD5 in preventing and treating banana wilt caused by banana wilt bacteria in claim 1 is characterized in that: the prevention and treatment are realized by knocking out a gene FoPDCD 5.

4. The application of the gene FoPDCD5 as a target for plant disease control drugs in claim 1 is characterized in that: the plant disease is banana vascular wilt caused by banana vascular wilt.

5. Use according to claim 1, 2, 3 or 4, characterized in that:

the nucleotide sequence of the gene FoPDCD5 is one of the following A, B:

A. encoding the amino acid sequence of SEQ ID NO: 2;

B. as shown in SEQ ID NO: 1.

6. A method of treating banana vascular wilt caused by banana vascular wilt, comprising: comprising blocking or inhibiting the expression of the gene FoPDCD5 in claim 1.