CN110183521B - Application of magnaporthe grisea gene MoRMD1 in regulation and control of pathogenicity of magnaporthe grisea - Google Patents

Abstract

The invention discloses an application of a rice blast bacterium gene MoRMD1 in regulation of rice blast bacterium pathogenicity, and belongs to the field of plant genetic engineering. The invention constructs a gene knockout vector and introduces the gene knockout vector into a rice blast protoplast; knocking out the gene MoRMD1 from rice blast fungus by using a homologous recombination method to obtain a knock-out mutant delta MoRMD 1; the obtained magnaporthe grisea knockout mutant is defective in the formation of adherent cells, and the MorMD1 plays an important role in maintaining the integrity of cell walls. Pathogenicity tests show that the toxicity of the rice blast fungi is obviously reduced by the deletion of the MorMD1, and obvious disease spots cannot be formed on rice leaves. The invention demonstrates that Mormd1 is essential for blast fungus appressorium formation, maintenance of cell wall integrity and pathogenicity. The research of the rice blast fungi helps to deeply clarify the pathogenic molecular mechanism of the rice blast fungi and provides a target gene for developing effective bactericides.

Description

Application of magnaporthe grisea gene MoRMD1 in regulation and control of pathogenicity of magnaporthe grisea

Technical Field

The invention belongs to the field of plant genetic engineering, and particularly relates to an application of a rice blast bacterium gene MorMD1 in regulation and control of rice blast bacterium pathogenicity.

Background

The rice blast caused by Magnaporthe oryzae is an important disease in rice production. The economic loss of rice caused by rice blast is about $ 660 million each year around the world, and the lost rice can provide food for 6000 million people. The rice blast fungus infection process on rice mainly comprises the following steps: (1) conidium spreads with wind and rain and adheres to the surface of rice leaf; (2) germinating conidia to form a germ tube; (3) the germ tube is differentiated to form an attachment cell; (4) the attached cells are differentiated to form infection nails; (5) the infective spikes penetrate the host cell and form infective hyphae within the host cell, which expand from cell to cell. The key process of successfully infecting rice by rice blast fungi is that a highly specialized infection structure, namely an attached cell, is formed, and the turgor pressure generated after the attached cell is mature can enable an infection nail to penetrate through the cuticle of the rice, so that rice cells are successfully infected. When the rice blast fungus can not form complete attachment cells, the pathogenicity of the rice blast fungus is obviously weakened.

The domain of DUF (a domain of unknown function) refers to a class of protein domains that do not contain known specific functions, and is a generic term for unknown protein functional domains. In the Pfam database, there are about 3000 families of DUF proteins. In eukaryotes, about 1500 DUFs are contained. Many DUFs are highly conserved, presumably playing an important role in the biological function of fungi, but their specific function is unknown.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention aims to provide the application of the rice blast bacterium gene MorMD1 in regulating and controlling the pathogenicity of rice blast bacterium.

The rice blast fungus Sporula Protein RMD1 is a predicted Protein (Protein predicted) and is named as MoRMD 1; analyzed by the uniprotKB database (https:// www.uniprot.org/uniprot /), which contains the DUF155 domain. However, the specific biological function of Magnaporthe grisea MorMD1 is not clear at present. Experiments show that the toxicity of the rice blast fungi is obviously reduced by the deletion of the Mormd1, and obvious scabs cannot be formed on rice leaves.

The purpose of the invention is realized by the following technical scheme:

the invention provides an application of a rice blast bacterium gene MoRMD1 in regulation and control of rice blast bacterium pathogenicity.

Further, the application of the magnaporthe grisea gene MoRMD1 in regulating and controlling the growth and development of the magnaporthe grisea is provided.

Further, the application of the magnaporthe grisea gene MoRMD1 in regulation and control of magnaporthe grisea attached spore formation.

Further, the application of the magnaporthe grisea gene MoRMD1 in maintaining integrity of magnaporthe grisea cell walls.

The invention provides application of a rice blast bacterium gene MoRMD1 in preventing and treating rice blast caused by rice blast bacteria.

The invention provides application of a rice blast bacterium gene MoRMD1 as a target of a medicament for preventing and treating plant diseases, wherein the plant diseases are rice blast caused by rice blast bacteria.

The present invention further provides a method for treating plant blast caused by Pyricularia oryzae, comprising blocking or inhibiting the expression of the gene Mormd1 in Pyricularia oryzae (for example, by using antisense RNA or siRNA of the gene).

Use of an agent (e.g., antisense RNA or siRNA using the gene) that blocks or inhibits expression of the gene MorMD1 in Pyricularia oryzae for the preparation of a medicament for controlling plant Pyricularia oryzae caused by Pyricularia oryzae.

Wherein the amino acid sequence of the rice blast fungus gene MorMD1 is shown as SEQ ID NO: 2, or as shown in SEQ ID NO: 2 by one or more amino acid substitutions, insertions and deletions and still has the function of controlling the pathogenicity of the rice blast fungi;

the nucleotide sequence of the rice blast fungus gene MoRMD1 is one of the following A, B, C:

A. encoding the amino acid sequence of SEQ ID NO: 2;

B. as shown in SEQ ID NO: 1;

C. analogs obtained by the above A and B through base insertion, deletion, or substitution, which still have a function of controlling the pathogenicity of Pyricularia oryzae;

the application of the knock-out vector and the recombinant bacterium containing the rice blast bacterium gene MorMD1 in the aspects also belongs to the protection scope of the invention.

The invention constructs a gene knockout vector and introduces the gene knockout vector into a rice blast protoplast; knocking out the gene MoRMD1 from rice blast fungus by using a homologous recombination method to obtain a knock-out mutant delta MoRMD 1; this mutant is deficient in the formation of adherent cells. The pathogenicity determination result shows that the knockout mutant delta MorMD1 can not form obvious disease spots on rice leaves. The experiments prove that the rice blast fungus MorMD1 gene is a pathogenic related gene of the rice blast fungus.

Compared with the prior art, the invention has the following advantages and effects:

the rice blast fungus gene MorMD1 provided by the invention contains a DUF155 structural domain, but the biological function of the rice blast fungus gene is not clear. Experiments prove that after the coding gene MoRMD1 of the protein MoRMD1 is replaced by hygromycin phosphotransferase gene (hph) and fluorescent protein gene (SGFP), the obtained rice blast fungus knockout mutant has defects in the formation of attachment cells, and the MoRMD1 plays an important role in maintaining the integrity of cell walls. Pathogenicity tests show that the toxicity of the rice blast fungi is obviously reduced by the deletion of the MorMD1, and obvious disease spots cannot be formed on rice leaves. The invention demonstrates that Mormd1 is essential for blast fungus appressorium formation, maintenance of cell wall integrity and pathogenicity. The research of the rice blast fungi helps to deeply clarify the pathogenic molecular mechanism of the rice blast fungi and provides a target gene for developing effective bactericides.

Drawings

FIG. 1 is a schematic diagram of the construction of a rice blast fungus MorMD1 gene knockout vector.

FIG. 2 is a PCR amplification of the partial hygromycin resistant transformant gene of interest, MorMD 1; wherein, M: marker 5000; lane 1: wild type WT of rice blast fungus; lanes 2-6: transformants 2, 12, 20, 197 and 323.

FIG. 3 is a PCR amplification of part of the hygromycin-resistant transformant A-hph gene; wherein, M: marker 5000; lane 1: the plasmid pCT 74; lanes 2-6: transformants 2, 12, 20, 197 and 323.

FIG. 4 is Southern blot analysis of positive transformants (using the gene of interest as a probe); wherein, lane 1: wild type WT of rice blast fungus; lanes 2-6: transformants 2, 12, 20, 197 and 323.

FIG. 5 is Southern blot analysis of positive transformants (probed with hph); wherein, lanes 1-5: transformants 2, 12, 20, 197 and 323.

FIG. 6 shows colony morphology of Pyricularia oryzae knockout mutant Δ Mormd1 on YGA medium.

FIG. 7 is a comparison of sporulation yields of the Pyricularia oryzae knockout mutant Δ Mormd1 and the wild type; note: the spore-producing culture medium is tomato and oat culture medium.

FIG. 8 is a cell wall integrity assay of the Magnaporthe grisea knockout mutant Δ MorMD 1.

FIG. 9 is germination of conidia of the Pyricularia oryzae knockout mutant Δ MorMD 1; wherein the scale sizes in the figure are all 10 μm.

FIG. 10 is a pathogenicity analysis of the Pyricularia oryzae knockout mutant Δ Mormd 1.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

The test methods in the following examples, in which specific experimental conditions are not specified, are generally performed according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. The materials, reagents and the like used are, unless otherwise specified, reagents and materials obtained from commercial sources.

Example 1

1. Experimental Material

1.1 test strains and plants

The magnaporthe grisea subspecies is a Guangdong province vigor subspecies ZC₁₃The test rice was indica line CO39 (not containing known rice blast resistance gene).

1.2 host bacteria and plasmid vectors

The cloning vector is pMD18-T vector, and the gene knockout vector is filamentous fungus expression vector pCT 74.

2. Experimental methods

2.1 construction of Pyricularia oryzae knockout vector

A schematic diagram of the construction of the rice blast fungus MorMD1 gene knockout vector is shown in FIG. 1. Sequences of about 1500bp in length were selected upstream and downstream of the MorMD1 gene, and primers were designed (Table 1).

TABLE 1 amplification primers for the A and B homologous arm fragments of the Magnaporthe grisea Mormd1 gene

Primer name	Primer sequence 5 '-3'	Cleavage site
			MoRMD1-AF	GGGGTACCGAATGGACCTCGGCCTGTAT	Kpn I
MoRMD1-AR	CCGCTCGAGTGTTCATCGGTCGTGCGAA	Xho I
			MoRMD1-BF	CGGAATTCGCATGGAATATCATCAGGGCG	EcoR I
MoRMD1-BR	GCTCTAGAGCGCTGGATGAAGCAGAATC	Xba I

Extracting the genomic DNA of the rice blast bacterium by adopting a fungus DNA extraction kit method (OMEGAFungal DNAkit); performing PCR amplification by using the genomic DNA as a template and using primers MoRMD1-AF and MoRMD1-AR to obtain a homologous arm A fragment (MoRMD1-A) of the MoRMD1 gene; PCR amplification was performed with primers MoRMD1-BF and MoRMD1-BR to obtain the B fragment of the homology arm of the MoRMD1 gene (MoRMD 1-B).

The specific PCR reaction system is as follows:

template DNA	1.0μL
		MoRMD1-A/BF(20μmol/L)	1.0μL
MoRMD1-A/BR(20μmol/L)	1.0μL
		10×Taq Buffer(Mg2+plus)	5.0μL
dNTPs(2.5mmol/L)	4.0μL
		Taq(5U/μL)	0.5μL
ddH2O	37.5μL
		Total	50.0μL

The PCR reaction conditions are as follows: reacting at 94 ℃ for 5 min; reacting at 94 ℃ for 1min, at 67 ℃ for 1min and at 72 ℃ for 1min for 35 cycles; and reacting at 72 ℃ for 10min to obtain a PCR amplification product. And (3) cleanly recovering the PCR amplification product by using an OMEGA Cycle Pure Kit.

2.2T vector ligation and transformation of homology arms of Magnaporthe grisea MorMD1 Gene

MoRMD1-A and MoRMD1-B were ligated with T vectors, respectively, with reference to the Kit instructions of pMD18-T Vector Cloning Kit (Takara corporation), to obtain recombinant plasmids pMD18T-MoRMD1-A and pMD18T-MoRMD 1-B. The method specifically comprises the following steps: mu.L of pMD18-T vector was taken, and 4. mu.L of the above PCR-recovered product (MorMD1 gene homology arm A or homology arm B fragment) and 5. mu.L of solution I were added, respectively, and ligated at 16 ℃ overnight. Adding 10 μ L of the ligation product into 100 μ L of Escherichia coli DH 5 α competent cells, and standing on ice for 30 min; heating in 42 deg.C water bath for 90s, and cooling on ice for 5 min; adding 800 μ L LB liquid medium, and culturing at 37 deg.C and 150rpm for 45min under shaking; centrifuging at 4000rpm for 5min, discarding the supernatant, leaving 100 μ L of bacterial liquid, mixing with the precipitate, and coating on LB solid culture medium (containing 50 μ g/mL Amp); culturing at 37 ℃ for 8-12 h.

And (3) selecting positive transformants with Amp resistance, extracting recombinant plasmid DNA, and performing sequencing identification. The pMD18T-MorMD1-A and pCT74 vectors were double digested with Kpn I and Xho I, respectively, and the A fragment and pCT74 vectors were recovered. Connecting the fragment A with a pCT74 vector by using T4DNA ligase, and transforming Escherichia coli DH 5 alpha; the recombinant plasmid pCT74-MoRMD1-A was obtained. pMD18T-MorMD1-B and recombinant plasmid pCT74-MorMD1-A were digested simultaneously with EcoR I and Xba I in the same procedure, and the B fragment and recombinant plasmid were recovered. Connecting the B fragment with pCT74-Mormd1-A by using T4DNA ligase, and transforming Escherichia coli DH 5 alpha; and enzyme digestion identification is carried out to obtain the gene knockout vector pCT74-MoRMD 1-KO.

2.3 preparation of Magnaporthe grisea protoplasts

Inoculating Magnaporthe grisea into YPS medium (yeast extract 6g, hydrolyzed casein 6g, sucrose 10g, distilled water to constant volume of 1L), and shake-culturing at 28 deg.C and 130rpm for 2 d; filtering the culture with 200 mesh cell sieve, grinding, transferring appropriate amount of mycelium solution to 200mL YPS culture medium, and culturing at 28 deg.C and 130rpm for 1d under shaking; the hypha solution was filtered through a 200 mesh cell sieve, and the hyphae were washed 2 times with sterile water and 1 time with 0.8mol/L NaCl, and the wet hyphae were weighed. Adding a proper amount of lywallzyme solution of 10mg/mL according to the ratio of the enzyme solution to the hyphae (the volume mass ratio is 10: 1), carrying out enzymolysis for 3h at 30 ℃, filtering by using sterilized KIMTECH dust-free paper, and collecting the digestion solution. Centrifuging at 4 deg.C and 3500rpm for 10 min; resuspending the pellet in 1.5-2 mL of precooled STC (containing 1.2M sorbitol, 10mM Tris-HCl, pH7.5, 50mM CaCl)₂) Centrifuging at 5000rpm for 10min at 4 deg.C; the pellet was resuspended in 1mL of STC to a final protoplast concentration of 1X 10⁷one/mL.

2.4 transformation of Magnaporthe grisea protoplasts

The knock-out vector pCT74-Mormd1-KO was double digested with Kpn I and Xba I to obtain the A-hph-sgfp-B fragment. Mixing 2 μ g of A-hph-sgfp-B fragment with 200 μ L of protoplast, and ice-cooling for 20 min; 1mL of PTC transformation buffer (60% PEG4000, 50mM CaCl) was added₂10mM Tris-HCl, pH7.5), standing at room temperature for 20 min; at 4 ℃ 3500Centrifuging at rpm for 10 min; resuspend the precipitate with 4mL of regeneration liquid medium (yeast extract 6.0g, hydrolyzed casein 6.0g, sucrose 200.0g, distilled water to constant volume of 1L), shake culture at 28 deg.C and 100rpm for 16-18 h. Adding 40mL of regeneration solid culture medium (the regeneration liquid culture medium contains 1.5% agar powder and 200 mu g/mL hygromycin), uniformly mixing, pouring into a plate, and culturing in the dark at 28 ℃ for 3-4 days; the hygromycin resistant transformant is picked, transferred to a YGA culture medium (containing 5.0g of yeast extract, 22.0g of anhydrous grape, 17.0g of agar powder and distilled water with constant volume of 1L) containing 200 mu g/mL of hygromycin, and cultured in the dark at 28 ℃ for 3-4 days.

2.5 PCR validation analysis of Pyricularia oryzae knockout mutant

The genomic DNA of the hygromycin positive transformant was extracted and analyzed by PCR validation according to the instructions of the Fungal DNA extraction kit (OMEGA Fungal DNAkit). Carrying out PCR amplification of the gene fragment MoRMD1 by using primers MoRMD1-F/MoRMD1-R respectively; PCR amplification analysis of gene fragment A-hph was performed with primer A-hph-F/A-hph-R.

MoRMD1-F：5′-CCAATTCCAAGCGAACCGTC-3′，

MoRMD1-R：5′-ACGTCCAGTCGCTCGTTTAG-3′，

A-hph-F：5′-GCTCCTCGTCGTATCGTCTC-3′，

A-hph-R：5′-ACCGCAAGGAATCGGTCAAT-3′；

The PCR reaction system is as follows:

template DNA	0.5μL
		MoRMD1-F/A-hph-F(20μmol/L)	0.5μL
MoRMD1-R/A-hph-R(20μmol/L)	0.5μL
		10×Taq Buffer(Mg2+plus)	2.5μL
dNTPs(2.5mmol/L)	2.0μL
		Taq(5U/μL)	0.25μL
ddH2O	18.75μL
		Total	25.0μL

The PCR reaction conditions are as follows: reacting at 94 ℃ for 5 min; reacting at 94 ℃ for 1min, at 61 ℃ for 1min and at 72 ℃ for 2min for 32 cycles; reacting at 72 ℃ for 10min to obtain an amplification product.

2.6 Southern blot analysis of Pyricularia oryzae knockout mutants

Southern blot hybridization was performed according to the DIG High Prime DNALabeling and Detection Starter Kit I (Roche LOT28309220) instructions. The target gene probe was amplified with primers MorMD1-F/MorMD1-R, and the hph gene probe was amplified with hph-F/hph-R.

MoRMD1-F：5′-CCAATTCCAAGCGAACCGTC-3′，

MoRMD1-R：5′-ACGTCCAGTCGCTCGTTTAG-3′，

hph-F：5′-TGCTGCTCCATACAAGCCAA-3′，

hph-R：5′-GACATTGGGGAGTTCAGCGA-3′；

The PCR amplification system of the DNA probe is as follows:

template DNA	1.0μL
		MoRMD1-F/hph-F(20μmol/L)	1.0μL
MoRMD1-R/hph-R(20μmol/L)	1.0μL
		10×Ex Taq Buffer(Mg2+plus)	5.0μL
dNTPs(2.5mmol/L)	4.0μL
		Ex Taq(5U/μL)	0.5μL
ddH2O	37.5μL
		Total	50.0μL

The PCR reaction conditions are as follows: reacting at 94 ℃ for 5 min; reacting at 94 ℃ for 1min, at 54 ℃ for 1min and at 72 ℃ for 2min for 32 cycles; reacting at 72 ℃ for 10min to obtain an amplification product.

2.7 phenotypic Observation of Pyricularia oryzae knockout mutant

(1) Observing colony morphology and measuring growth speed. The wild type rice blast fungus and the knockout mutant delta Mormd1 are inoculated on a YGA culture medium (containing 5.0g of yeast extract, 22.0g of anhydrous grape, 17.0g of agar powder and distilled water with constant volume of 1L) and cultured under the dark condition at the temperature of 28 ℃. The colony diameters were measured at 2d, 4d, 6d, 8d, and 10d, respectively, and the colony morphologies of the wild type and the mutant of rice blast fungus were observed.

(2) And (5) observing the generation and germination of conidia. The rice blast fungi is inoculated to a tomato and oat culture medium (40 g of raw oat is boiled for 1h by double distilled water, 150mL of tomato juice, 0.06g of calcium carbonate and 2.5-3% of agar powder are added after filtration, the volume is fixed to 1L by double distilled water), the mixture is placed in an incubator at 28 ℃ for culture, and the illumination is carried out for 7-10 d for 24 h. And adding 3-5 mL of sterile water into each dish, washing the conidia by using the sterile water, and filtering by using 3-5 layers of KIMTECH dust-free paper to obtain the conidia suspension. Counting by using a blood counting chamber, and counting the spore yield. The conidium suspension is inoculated on a PVDF membrane, samples are taken at 2h, 4h, 6h, 8h and 10h respectively, and the germination of the conidia is observed by a microscope.

(3) Cell wall integrity assay

The wild rice blast fungus strain and the knockout mutant delta MorMD1 are respectively inoculated on YGA culture medium containing 0.005% SDS, 0.01% SDS, 0.02% SDS and 200 mu g/mL congo red, and after being inversely cultured for 10-14 days in an incubator at 28 ℃, the colony growth conditions of the knockout mutant delta MorMD1 and the wild strain are observed.

2.8 pathogenicity analysis of Pyricularia oryzae knockout mutant Delta MorMD1

Taking the 4 th or 5 th leaf of the rice seedling at the 4-5 leaf stage, and using conidium suspension (1-5 multiplied by 10) of the wild type of the magnaporthe grisea and the knock-out mutant delta MorMD1⁵seed/mL, containing 0.25% tween 20); placing the rice leaves for 24 hours under the dark condition at the temperature of 28 ℃, then alternately culturing the rice leaves in light for 12 hours/dark for 12 hours, and observing the disease condition of the rice leaves after 5-7 days.

3 results and analysis

3.1 construction of Pyricularia oryzae MoRMD1 Gene knockout vector

Respectively cloning to obtain fragments of a homology arm A and a homology arm B of the Mormd1 gene by adopting a PCR amplification method; the recombinant plasmids are respectively connected with a T vector, and are subjected to transformation of escherichia coli, Amp resistance screening, plasmid extraction and sequencing identification to obtain recombinant plasmids pMD18T-MoRMD1-A and pMD18T-MoRMD 1-B. Connecting pMD18T-MoRMD1-A with pCT74 plasmid to obtain recombinant plasmid pCT74-MoRMD 1-A; carrying out double enzyme digestion on the vector and pMD18T-MoRMD1-B, and obtaining a gene knockout vector pCT74-MoRMD1-KO (figure 1) through DNA ligation, escherichia coli transformation and enzyme digestion identification.

3.2 screening of Pyricularia oryzae knockout mutant

3.2.1 PCR validation of Gene fragment MoRMD1

The gene knockout carrier is transformed into the rice blast protoplast by utilizing a homologous recombination method, and 215 hygromycin positive transformants are obtained. Through extraction of the rice blast fungus genome DNA, 68 hygromycin positive transformants in the rice blast fungus genome DNA are subjected to PCR verification analysis by utilizing a MoRMD1 gene specific primer. The result shows that 63 positive transformants can amplify the target gene fragment, which indicates that the 63 transformants still contain the MorMD1 gene; there were 5 transformants that were not amplified to the MorMD1 gene, and these 5 transformants were preliminarily identified as positive transformants (FIG. 2).

3.2.2 PCR validation of Gene fragment A-hph

Performing PCR amplification by using the 5 transformant genomic DNAs which are not amplified to the Mormd1 gene as templates and using an A-hph specific primer; as a result, the above 5 transformants which did not amplify the MorMD1 gene all amplified the target fragment of about 1500bp, further indicating that the 5 transformants are all positive transformants (FIG. 3).

3.2.3 Southern blot validation of knockout mutants

Southern blot analysis was performed on 5 positive transformants which had not been amplified to the MorMD1 gene but to the A-hph gene. As a result, the hybridization was carried out using the target gene as a probe, and no hybridization band was observed in any of 5 transformants (FIG. 4). Hybridization was performed using hph as a probe, and a single copy band was found in all 5 transformants (FIG. 5). The above experiments demonstrated that these 5 transformants were positive transformants.

3.3 analysis of colony morphology and growth Rate of Pyricularia oryzae knockout mutant

2 knockout mutants (Δ MorMD1-197 and Δ MorMD1-323) were randomly selected, inoculated into YGA medium, and observed for growth at different times. The results showed that the colony morphology of the knockout mutant Δ MoRMD1 was not significantly different compared to the wild type of magnaporthe grisea (fig. 6).

3.4 spore production and conidium germination observation of Pyricularia oryzae knockout mutant

The knockout mutants delta MoRMD1-197 and delta MoRMD1-323 are inoculated in a tomato oat culture medium, and after the tomato oat culture medium is cultured for 14 days, spore yield analysis is carried out. The results show that there is no significant difference in spore yield between the wild type of Pyricularia oryzae and the mutant Δ Mormd1 (FIG. 7).

3.5 cell wall integrity assay of Pyricularia oryzae knockout mutants

The colony morphology of the knockout mutants Δ MorMD1-197 and Δ MorMD1-323 was observed by inoculating the mutants into YGA medium containing different concentrations of SDS and Congo red. The results show that the Δ MorMD1 mutant is more sensitive to 0.02% SDS and 200 μ g/mL Congo red than the wild type, indicating that the integrity of the magnaporthe oryzae cell wall is affected after the MorMD1 is knocked out (FIG. 8).

Inoculating conidia on a PVDF membrane, and culturing in an incubator at 28 ℃; samples were taken at different times for observation. The result shows that the wild conidium of the rice blast fungus can normally produce germ tubes and attached spores; however, the knockout mutant Δ MorMD1 conidia failed to form intact adherent cells after germination (8h) (FIG. 9).

3.6 pathogenicity analysis of Pyricularia oryzae knockout mutant

And respectively inoculating conidia of the wild type magnaporthe grisea and the knock-out mutant delta MorMD1 conidia to the in vitro leaves of the rice, and observing after 7 d. The result shows that after the wild type of the rice blast fungi is inoculated, obvious scabs appear on the rice leaves; however, after inoculation of the knockout mutant Δ MorMD1, no obvious lesion was formed on the rice leaf (FIG. 10). The result shows that after the MorMD1 gene is knocked out, the pathogenicity of the rice blast fungi is obviously reduced.

Therefore, the gene provided by the invention can be used for preventing and treating plant diseases, in particular to the rice blast caused by rice blast fungi. In addition, the gene provided by the invention can be used as a target of a medicament for preventing and treating plant diseases. Those skilled in the art, following the teachings and teachings of this specification, can develop agents for controlling plant diseases, particularly rice blast.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> southern China university of agriculture

Application of magnaporthe grisea gene MoRMD1 in regulation and control of pathogenicity of magnaporthe grisea

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2072

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> nucleotide sequence of Magnaporthe grisea gene MorMD1

<400> 1

atggccgaag ccgtgacgga aacctctccg ctgctatcga cggtgtcgga gccgaccact 60

accccggaat tccctcgtcc caattccaag cgaaccgtca ccttcaatcc gaaccctgtc 120

acgcgaacca tcgagcccga acgacaacct ctccgccgcc gcatttccac aaacatcgat 180

gtcgctcgcg catctgggca gaggtcgcct ggcggctcgg gtccgcccac ccccacgagc 240

tcaataagca ccggtagtct cgccggtgct ccgccaatgc tggtcgcact caactctaaa 300

cttcgccgcc gcaactccca tggaggtaca cagggttcca tgccgggctc aaacaaccta 360

ctaccagccc cgggtggtgt gggtctcgtc gccggggccg gtcacctgcc caagattggg 420

ccccagcgta gcaccaagaa ggcgcagaag ctcaagctgc ttcccacgcc tgaacttgcc 480

gacgatggtg acgatgacca agatgaggag agcggacgtg aggtctacag ccagtacacg 540

cgtatcaagg accccaatgc ccgacgagat gccgccaggc taggcaaggc cgatcgcgac 600

cgtctgccgc gcgtcacggc gtactgcacc gccaacaaat accagatgga tggcctgatg 660

cactggctga aggggagcag gagcagagca aagggagcga accccaagct cgtggacgag 720

tgcatataca cgccgtacca gtataaagac acgccaccac cgcccccagg acgtggtgcg 780

aggattcgca gagttgccag tgctcagaat gctgccgacg ctgccgagga tgccgcgagg 840

gctgcggtca acgctgatgg catcctgggg tctgaggtaa ccagtgactc accggagccg 900

atgtctaccc aacagaggag acactcgact ggtgatgtcg aggccacccc accccgattc 960

agccaggagg acctgataga tctggagcca gaggctatct ctgatgtgca agatggacga 1020

agcgaggcac gcatagagag cctcggagaa ggagaccacg cagaaatatc aagcagcccg 1080

caagaacgtg accacgagca tggtcacgac catgatcaat cccccagctc ggcagaccat 1140

cgggatgaaa tgatcagcac gcaccacgag cccatcaacg agcgacctgc cgattttgat 1200

atcgaggtac acaccccgga ggttttcctc tttgactacg gcgtggtggt gatatggggc 1260

atgacgatgg cacaggagcg gaggtttctc aaggaaattg ccaagtttga aaccgagaaa 1320

ctggcgaccg aggaggtcga gactgaacac ttcaactttt actacacccg cgagtatcag 1380

cccaggatat acaacgactt tatcaccctc cgtgacaagc acaactacat gaccaagctg 1440

gccatttcac atgcgctggc acagagtgtc aaggttagta ctctcactct ttggctgttt 1500

tgccatgcgt tctatttcgg tgggcacttc taacacgaac tagacgtctc ttttcgagga 1560

gctcatcgcc tctaccgtcg acacgtgcaa ggacattccg acgcagattg ctttgaccgg 1620

caagatcaat cttagcagga cacagatcaa catgcagatc ggcgagcttt tcattctgag 1680

gatcagtatt cacctcaacg gctccgtcct tgacacgcca gagcttttct gggtcgagcc 1740

tcaactcgag ccgctgtacg ccgctgtgcg gtcctaccta gagatggacc agcgagttgg 1800

cctgctaaac gagcgactgg acgtcattgc ggacttgctt gctgtgctca aagaccaact 1860

gagtcatggt catggtgaga aactcgagtg gattggtaag tttgcttcca ttctttcgcg 1920

cgcccagtcc cttgcgcctt tgaacttgtt ctatggtatc atgaatactg accagcatcc 1980

tttgggttta cacagttatt gtattgattg cagccgaaat ccttgttgct gctgttaaca 2040

tagttgtaga tttatatgcg ggcgtcgact ag 2072

<210> 2

<211> 633

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> amino acid sequence of Magnaporthe grisea gene MorMD1

<400> 2

Met Ala Glu Ala Val Thr Glu Thr Ser Pro Leu Leu Ser Thr Val Ser

1 5 10 15

Glu Pro Thr Thr Thr Pro Glu Phe Pro Arg Pro Asn Ser Lys Arg Thr

20 25 30

Val Thr Phe Asn Pro Asn Pro Val Thr Arg Thr Ile Glu Pro Glu Arg

35 40 45

Gln Pro Leu Arg Arg Arg Ile Ser Thr Asn Ile Asp Val Ala Arg Ala

50 55 60

Ser Gly Gln Arg Ser Pro Gly Gly Ser Gly Pro Pro Thr Pro Thr Ser

65 70 75 80

Ser Ile Ser Thr Gly Ser Leu Ala Gly Ala Pro Pro Met Leu Val Ala

85 90 95

Leu Asn Ser Lys Leu Arg Arg Arg Asn Ser His Gly Gly Thr Gln Gly

100 105 110

Ser Met Pro Gly Ser Asn Asn Leu Leu Pro Ala Pro Gly Gly Val Gly

115 120 125

Leu Val Ala Gly Ala Gly His Leu Pro Lys Ile Gly Pro Gln Arg Ser

130 135 140

Thr Lys Lys Ala Gln Lys Leu Lys Leu Leu Pro Thr Pro Glu Leu Ala

145 150 155 160

Asp Asp Gly Asp Asp Asp Gln Asp Glu Glu Ser Gly Arg Glu Val Tyr

165 170 175

Ser Gln Tyr Thr Arg Ile Lys Asp Pro Asn Ala Arg Arg Asp Ala Ala

180 185 190

Arg Leu Gly Lys Ala Asp Arg Asp Arg Leu Pro Arg Val Thr Ala Tyr

195 200 205

Cys Thr Ala Asn Lys Tyr Gln Met Asp Gly Leu Met His Trp Leu Lys

210 215 220

Gly Ser Arg Ser Arg Ala Lys Gly Ala Asn Pro Lys Leu Val Asp Glu

225 230 235 240

Cys Ile Tyr Thr Pro Tyr Gln Tyr Lys Asp Thr Pro Pro Pro Pro Pro

245 250 255

Gly Arg Gly Ala Arg Ile Arg Arg Val Ala Ser Ala Gln Asn Ala Ala

260 265 270

Asp Ala Ala Glu Asp Ala Ala Arg Ala Ala Val Asn Ala Asp Gly Ile

275 280 285

Leu Gly Ser Glu Val Thr Ser Asp Ser Pro Glu Pro Met Ser Thr Gln

290 295 300

Gln Arg Arg His Ser Thr Gly Asp Val Glu Ala Thr Pro Pro Arg Phe

305 310 315 320

Ser Gln Glu Asp Leu Ile Asp Leu Glu Pro Glu Ala Ile Ser Asp Val

325 330 335

Gln Asp Gly Arg Ser Glu Ala Arg Ile Glu Ser Leu Gly Glu Gly Asp

340 345 350

His Ala Glu Ile Ser Ser Ser Pro Gln Glu Arg Asp His Glu His Gly

355 360 365

His Asp His Asp Gln Ser Pro Ser Ser Ala Asp His Arg Asp Glu Met

370 375 380

Ile Ser Thr His His Glu Pro Ile Asn Glu Arg Pro Ala Asp Phe Asp

385 390 395 400

Ile Glu Val His Thr Pro Glu Val Phe Leu Phe Asp Tyr Gly Val Val

405 410 415

Val Ile Trp Gly Met Thr Met Ala Gln Glu Arg Arg Phe Leu Lys Glu

420 425 430

Ile Ala Lys Phe Glu Thr Glu Lys Leu Ala Thr Glu Glu Val Glu Thr

435 440 445

Glu His Phe Asn Phe Tyr Tyr Thr Arg Glu Tyr Gln Pro Arg Ile Tyr

450 455 460

Asn Asp Phe Ile Thr Leu Arg Asp Lys His Asn Tyr Met Thr Lys Leu

465 470 475 480

Ala Ile Ser His Ala Leu Ala Gln Ser Val Lys Thr Ser Leu Phe Glu

485 490 495

Glu Leu Ile Ala Ser Thr Val Asp Thr Cys Lys Asp Ile Pro Thr Gln

500 505 510

Ile Ala Leu Thr Gly Lys Ile Asn Leu Ser Arg Thr Gln Ile Asn Met

515 520 525

Gln Ile Gly Glu Leu Phe Ile Leu Arg Ile Ser Ile His Leu Asn Gly

530 535 540

Ser Val Leu Asp Thr Pro Glu Leu Phe Trp Val Glu Pro Gln Leu Glu

545 550 555 560

Pro Leu Tyr Ala Ala Val Arg Ser Tyr Leu Glu Met Asp Gln Arg Val

565 570 575

Gly Leu Leu Asn Glu Arg Leu Asp Val Ile Ala Asp Leu Leu Ala Val

580 585 590

Leu Lys Asp Gln Leu Ser His Gly His Gly Glu Lys Leu Glu Trp Ile

595 600 605

Val Ile Val Leu Ile Ala Ala Glu Ile Leu Val Ala Ala Val Asn Ile

610 615 620

Val Val Asp Leu Tyr Ala Gly Val Asp

625 630

<210> 3

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> MoRMD1-AF

<400> 3

ggggtaccga atggacctcg gcctgtat 28

<210> 4

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> MoRMD1-AR

<400> 4

ccgctcgagt gttcatcggt cgtgcgaa 28

<210> 5

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> MoRMD1-BF

<400> 5

cggaattcgc atggaatatc atcagggcg 29

<210> 6

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> MoRMD1-BR

<400> 6

gctctagagc gctggatgaa gcagaatc 28

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> MoRMD1-F

<400> 7

ccaattccaa gcgaaccgtc 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> MoRMD1-R

<400> 8

acgtccagtc gctcgtttag 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> A-hph-F

<400> 9

gctcctcgtc gtatcgtctc 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> A-hph-R

<400> 10

accgcaagga atcggtcaat 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> hph-F

<400> 11

tgctgctcca tacaagccaa 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> hph-R

<400> 12

gacattgggg agttcagcga 20

Claims (8)

1. Magnaporthe grisea geneMoRMD1The application of the composition in reducing the pathogenicity of rice blast fungi is characterized in that:

the rice blast fungus geneMoRMD1The coded amino acid sequence is shown as SEQ ID NO: 2, respectively.

2. The Pyricularia oryzae gene as defined in claim 1MoRMD1Application in reducing formation of Magnaporthe grisea attached spore.

3. The Pyricularia oryzae gene as defined in claim 1MoRMD1Application in maintaining integrity of cell walls of Magnaporthe grisea.

4. The Pyricularia oryzae gene as defined in claim 1MoRMD1The application of the composition in preventing and controlling rice blast caused by rice blast fungi is characterized in that: the prevention and treatment is realized by blocking or inhibiting genesMoRMD1Is realized by the expression of (1).

5. The Pyricularia oryzae gene as defined in claim 1MoRMD1Use as a target for a medicament for the control of plant diseases, characterized in that: the plant disease is rice blast caused by rice blast fungi.

6. Use according to claim 1, 2, 3, 4 or 5, characterized in that:

the rice blast fungus geneMoRMD1The nucleotide sequence is shown as SEQ ID NO: 1.

7. Blocking or inhibiting the Pyricularia oryzae gene as claimed in claim 1MoRMD1The use of an expressed agent of (a) in the preparation of a medicament, characterized in that:

the agent is the rice blast fungus gene of claim 1MoRMD1The antisense RNA or siRNA of (1), which is useful for controlling plant blast caused by Pyricularia oryzae.

8. Use according to claim 7, characterized in that:

the rice blast fungus geneMoRMD1The nucleotide sequence is shown as SEQ ID NO: 1.

Images