CN111560384A - Application of gene FoRnt in regulation and control of pathogenicity of banana fusarium wilt - Google Patents

Abstract

The invention discloses application of a gene FoRnt in regulation and control of pathogenicity of banana vascular wilt pathogens, and belongs to the field of plant genetic engineering. The invention constructs a gene knockout vector and introduces the gene knockout vector into a protoplast of the fusarium oxysporum f.sp.cubense; knocking out the gene from fusarium oxysporum f.sp.cubense by using a homologous recombination method to obtain a knock-out mutant delta FoRnt; a gene complementation vector is constructed and is introduced into the delta FoRnt protoplast to obtain a complementation mutant delta FoRnt-com. Experiments prove that compared with wild type, the delta FoRnt has no significant difference in spore morphology, hypha morphology, high penetration resistance, oxidative stress resistance and the like; however, the deletion of the FoRnt causes a significant reduction in the pathogenicity of the FoRnt; the invention proves that FoRnt is necessary for pathogenicity of banana fusarium wilt. The research of the people is helpful to deeply elucidate the pathogenic molecular mechanism of the banana fusarium oxysporum and provides a target gene for developing an effective bactericide.

Description

Application of gene FoRnt in regulation and control of pathogenicity of banana fusarium wilt

Technical Field

The invention belongs to the field of plant genetic engineering, and particularly relates to application of a gene FoRnt in regulation and control of pathogenicity of banana vascular wilt.

Background

Banana wilt (Fusarium wilt) is one of the most important diseases in banana production, and poses a serious threat to the banana industry in China, and the pathogenic bacteria of the banana wilt is Fusarium oxysporum cubense (Foc). Banana vascular wilt is a systemic vascular bundle soil-borne disease, and can destroy banana vascular bundles to cause plant death. Foc can be divided into 3 physiological races, and there are No. 1 physiological race (Foc1) and No. 4 physiological race (Foc4) harmful to plantain region in China. Wherein Foc4 has the greatest harm to Chinese banana, and almost can infect all varieties of banana. The pathogenic mechanism of Foc is still unclear. Foc pathogenic genes are fully excavated and functional researches are carried out, which has important significance for preventing and controlling banana wilt.

In the research of carrying out proteomics on secretion of fusarium oxysporum f.sp.cubense, an unknown protein (named as Fornt) is identified; the analysis shows that the protein belongs to RNase T2 family, contains N-terminal signal peptide and belongs to classical secretory protein. RNase T2 was first found in Aspergillus oryzae as a single-stranded specific transfer endonuclease with broad biological effects such as clearing nucleic acids, degradation of self-RNA, etc.; but its biological function in banana vascular wilt is unclear.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention aims to provide the application of the gene FoRnt in regulating and controlling the pathogenicity of banana fusarium oxysporum.

The invention discloses a new unknown protein gene FoRnt of banana fusarium wilt bacteria and a function of an encoding protein RNT thereof. The gene FoRnt is SEQ ID NO: 1, and the protein RNT coded by the nucleotide sequence is SEQ ID NO: 2. The invention constructs a gene knockout vector and introduces the gene knockout vector into a protoplast of the fusarium oxysporum f.sp.cubense; knocking out the gene from fusarium oxysporum f.sp.cubense by using a homologous recombination method to obtain a knock-out mutant delta FoRnt; introducing a gene complementation vector into a delta FoRnt protoplast by constructing the gene complementation vector; the gene is complemented back into a knockout mutant by a random insertion method to obtain a complementing mutant delta FoRnt-com. The mutant has no defects in growth and development, and is insensitive to hyperosmotic stress, oxidative stress and the like. The pathogenicity determination result shows that compared with the wild type of the banana fusarium wilt, the pathogenicity of the knockout mutant delta FoRnt to Brazil banana is obviously reduced. The above experiments prove that the banana fusarium oxysporum FoRnt gene is a pathogenic related gene of the banana fusarium oxysporum.

The purpose of the invention is realized by the following technical scheme:

the invention provides application of a gene FoRnt in regulation and control of pathogenicity of banana vascular wilt.

The invention provides application of a gene FoRnt in preventing and treating banana vascular wilt caused by banana vascular wilt.

The invention provides application of a gene FoRnt as a target for a plant disease control drug, wherein the plant disease is banana vascular wilt caused by banana vascular wilt.

The invention further provides a method for treating banana vascular wilt caused by banana vascular wilt, which comprises blocking or inhibiting the expression of the gene FoRnt in the banana vascular wilt (for example, using antisense RNA or siRNA of the gene).

An application of a medicament (such as antisense RNA or siRNA and the like using the gene) for blocking or inhibiting the expression of the gene FoRnt in the fusarium oxysporum f.sp.cubense in preparing a medicament for controlling the fusarium oxysporum f.sp.cubense caused by the fusarium oxysporum f.sp.cubense.

Wherein, the amino acid sequence of the banana fusarium oxysporum gene FoRnt is shown as SEQ ID NO: 2, or as shown in SEQ ID NO: 2 through one or more amino acid substitutions, insertions and deletions, and the obtained analogue still has the function of controlling the pathogenicity of the fusarium oxysporum;

the nucleotide sequence of the gene FoRnt is one of the following A, B, C, D:

A. encoding the amino acid sequence of SEQ ID NO: 2;

B. as shown in SEQ ID NO: 1;

C. as shown in SEQ ID NO: 1, CDS sequences shown at positions 180-1016;

D. the above A, B and C have the function of controlling the pathogenicity of banana vascular wilt disease through base insertion, deletion or substitution;

further, the banana fusarium oxysporum is a No. 4 physiological race of the banana fusarium oxysporum (Foc 4).

The application of the knock-out vector and the recombinant bacteria containing the gene FoRnt in the aspects also belongs to the protection scope of the invention.

Compared with the prior art, the invention has the following advantages and effects:

the invention discloses an unknown protein (Unchartered protein) gene FoRnt of banana fusarium wilt germ No. 4 and a new function of an encoding protein RNT thereof. The gene FoRnt is a nucleotide sequence shown from 1 st to 1126 th in a sequence 1, and the encoded protein RNT is a protein shown in a sequence 2; the protein RNT belongs to the RNase T2 family, and its biological function in Fusarium oxysporum f.sp.cubense is unclear. Experiments prove that after the coding gene FoRnt of the protein RNT is replaced by hygromycin phosphotransferase gene (hph) and fluorescent protein gene (gfp), the obtained banana fusarium wilt bacterium mutant has no significant difference compared with a wild type in the aspects of spore morphology, hypha morphology, high penetration resistance, oxidative stress resistance and the like; however, the deletion of the FoRnt causes a significant reduction in the pathogenicity of the FoRnt; the invention proves that FoRnt is necessary for pathogenicity of banana fusarium wilt. The research of the people is helpful to deeply elucidate the pathogenic molecular mechanism of the banana fusarium oxysporum and provides a target gene for developing an effective bactericide.

Drawings

FIG. 1 is a schematic diagram of construction of a banana fusarium oxysporum gene FoRnt knockout vector.

FIG. 2 is a schematic diagram of a gene FoRnt complementation vector of banana fusarium oxysporum.

FIG. 3 is a Southern blot analysis of transformants (probed with the hph fragment); wherein, delta FoRnt-2 is transformant 2, delta FoRnt-12 is transformant 12, delta FoRnt-14 is transformant 14, delta FoRnt-17 is transformant 17, and delta FoRnt-24 is transformant 24.

FIG. 4 is a determination of the high osmotic pressure resistance of a knockout mutant delta FoRnt and a anaplerosis mutant delta FoRnt-com; wherein, the delta FoRnt-24 refers to a transformant 24, and the delta FoRnt-24-com refers to a complementation transformant 2 obtained by transforming the delta FoRnt-24 by a gene complementation vector.

FIG. 5 is a graph of the sensitivity of the knockout mutant Δ FoRnt and the anaplerotic mutant Δ FoRnt-com to hydrogen peroxide.

FIG. 6 is a pathogenicity analysis of the knockout mutant Δ FoRnt and the anaplerotic mutant Δ FoRnt-com.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

The test methods in the following examples, in which specific experimental conditions are not specified, are generally performed according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. The materials, reagents and the like used are, unless otherwise specified, reagents and materials obtained from commercial sources.

Example 1

1. Experimental Material

1.1 test strains and plants

The race of banana wilt disease is Foc4, and the tested banana variety is Brazil banana cavendish (AAA).

1.2 host bacteria and plasmid vectors

The host bacterium is Escherichia coli DH5 alpha, the cloning vector is pMD18-T vector, the gene knockout vector is binary vector pCT74, the gene complementation vector is pCTZN (obtained by modifying the laboratory on the basis of pCT74 plasmid, namely SGFP and hph genes on pCT74 are replaced by bleomycin (Zeocin) genes), and the gene FoPDCD5 is also disclosed in the patent' 201910986131.4 and the application of gene FoPDCD5 in regulating and controlling the pathogenicity of banana fusarium wilt.

2. Experimental methods

2.1 amplification of homologous fragments at upstream and downstream of gene FoRnt of banana vascular wilt

The construction of the banana fusarium oxysporum Fornt gene knockout vector is shown in FIG. 1. Sequences of about 1500bp in length (designated as homology arm A and B fragments, i.e., FoRnt-A and FoRnt-B, respectively) were selected upstream and downstream of the FoRnt gene, and primers were designed (Table 1).

TABLE 1 amplification primers for A and B fragments of homology arms of FoRnt genes

Primer name	Primer sequence 5 '-3'	Cleavage site
			FoRnt-AF	GGGGTACCTTGGCGATGGTGCTGAGTGG	KpnI
FoRnt-AR	CCGCTCGAGTGTTGGTTCCGGGGCTGATA	XhoI
			FoRnt-BF	GGAATTCCATCGTTCTTTTCAACGTTATC	EcoRI
FoRnt-BR	GACTAGTTAGGAGCATCACATTCGTAA	SpeI

Extracting Foc4 genome DNA with fungus DNA extraction Kit (OMEGA Fungal DNA Kit); using the genome DNA as a template, and carrying out PCR amplification by using primers FoRNT-AF and FoRnt-AR to obtain a homologous arm A fragment (FoRnt-A) of the FoRnt gene; and carrying out PCR amplification by using primers FoRnt-BF and FoRnt-BR to obtain a homologous arm B fragment (FoRnt-B) of the FoRnt gene.

The specific PCR reaction system is as follows:

template DNA	1.0μL
		FoRnt-AF/BF(10μmol/L)	1.0μL
FoRnt-AR/BR(10μmol/L)	1.0μL
		10×Taq Buffer(Mg2+ plus)	5.0μL
dNTPs(2.5mmol/L)	4.0μL
		Taq(5U/μL)	0.5μL
ddH2O	37.5μL
		Total	50.0μL

The PCR reaction conditions are as follows: reacting at 94 ℃ for 5 min; reacting at 94 ℃ for 30s, at 58 ℃ for 30s and at 72 ℃ for 1min for 30 cycles; the reaction was carried out at 72 ℃ for 10 min. And (3) cleanly recovering the PCR amplification product by using an OMEGA Cycle Pure Kit.

2.2 construction of FoRnt Gene knockout vector

With reference to the Kit instructions of pMD18-T Vector Cloning Kit (Takara corporation), FoRnt-A and FoRnt-B were ligated to T vectors, respectively, to obtain recombinant plasmids pMD18T-FoRnt-A and pMD 18T-FoRnt-B. The method specifically comprises the following steps: mu.L of pMD18-T vector was taken, 4. mu.L of the above PCR-recovered product (homology arm A fragment or homology arm B fragment) and 5. mu.L of solution I were added, respectively, and ligated at 16 ℃ overnight. Adding 10 μ L of the ligation product into 100 μ L of E.coli DH5 α competent cells, and standing on ice for 30 min; heating in 42 deg.C water bath for 90s, and cooling on ice for 5 min; adding 800 μ L LB liquid medium, and culturing at 37 deg.C and 150rpm for 45min under shaking; centrifuging at 4000rpm for 5min, discarding the supernatant, leaving 100 μ L of bacterial liquid, mixing with the precipitate, and coating on LB solid culture medium (containing 50 μ g/mL Amp); culturing at 37 ℃ for 8-12 h.

And (3) selecting positive transformants with Amp resistance, extracting recombinant plasmid DNA, and performing sequencing identification. The pMD18T-FoRnt-A and pCT74 vectors were double digested with KpnI and XhoI, respectively, and the A fragment and pCT74 vector were recovered. Connecting the A fragment with pCT74 by using T4 DNA ligase, and transforming Escherichia coli DH5 alpha; the recombinant plasmid pCT74-FoRnt-A was obtained. The same procedure was followed using EcoRI and SpeI to double-cleave pMD18T-FoRnt-B and recombinant plasmid pCT74-FoRnt-A, recovering the B fragment and the recombinant plasmid. Connecting the B fragment with pCT74-FoRnt-A by using T4 DNA ligase, and transforming Escherichia coli DH5 alpha; and carrying out enzyme digestion identification to obtain a gene knockout vector pCT 74-FoRnt-KO.

2.3 amplification of upstream and downstream fragments of 2.3 Foc4 Gene RNT (FoRnt) complementation vector

The construction of the FoRnt gene complementation vector is shown in FIG. 2. A promoter sequence 1500bp in length was selected upstream of the FoRnt gene, a terminator sequence 500bp in length was selected downstream, and primers (designated com FoRnt-F and com FoRnt-R, respectively) were designed (Table 2).

TABLE 2 amplification primers for the complementing fragment of the FoRnt Gene

Primer name	Primer sequence 5 '-3'	Cleavage site
			com FoRnt-F	GGGGTACCGGAGAAGAAACCGAGATTGTAATT	KpnI
com FoRnt-R	ACGCGTCGACCGAAACATGCCATAGTGGAGAT	SalI

Extracting Foc4 genome DNA with fungus DNA extraction Kit (OMEGA Fungal DNA Kit); PCR amplification was performed using the genomic DNA as a template and primers com FoRnt-F and com FoRnt-R to obtain a complementation fragment of the FoRnt gene (designated com FoRnt).

The specific PCR reaction system is as follows:

template DNA	1.0μL
		com FoRnt-F(10μmol/L)	1.0μL
com FoRnt-R(10μmol/L)	1.0μL
		10×Taq Buffer(Mg2+ plus)	5.0μL
dNTPs(2.5mmol/L)	4.0μL
		ExTaq(5U/μL)	0.5μL
ddH2O	37.5μL
		Total	50.0μL

The PCR reaction conditions are as follows: reacting at 94 ℃ for 5 min; reacting at 94 ℃ for 30s, at 58 ℃ for 30s and at 72 ℃ for 4min for 30 cycles; and reacting at 72 ℃ for 10min to obtain a PCR amplification product. And (3) cleanly recovering the PCR amplification product by using an OMEGA Cycle Pure Kit.

2.4 construction of the 2.4 Foc4 Gene RNT (FoRnt) complementation vector

And carrying out double enzyme digestion on com FoRnt and pCTZN vectors by using KpnI and SalI respectively, and recovering a com FoRnt fragment and the pCTZN vector. Connecting the com FoRnt fragment with pCTZN by using T4 DNA ligase, and transforming Escherichia coli DH5 alpha; obtaining the recombinant plasmid pCTZN-FoRnt-com. After enzyme digestion identification, the gene complementation vector pCTZN-FoRnt-com is obtained.

2.5 preparation of 2.5 Foc4 protoplasts

Inoculating Foc4 into Chaudhuri culture medium (sodium nitrate 3g, dipotassium phosphate trihydrate 1g, potassium chloride 0.5g, magnesium sulfate heptahydrate 0.5g, ferrous sulfate heptahydrate 0.018g, sucrose 30g, distilled water to constant volume of 1L, pH 6.0), shaking and culturing at 28 deg.C and 150rpm for 3d, filtering the culture solution with 200 mesh cell sieve, centrifuging at 4 deg.C for 10min at 10000 × g, discarding supernatant, precipitating with NCM culture medium (glucose 10g, aspartic acid 4g, 20 × nitrate 50mL, 1000 × vitamin 1mL, 1000 × microelement 1mL, 200 × ferric salt 5mL, resuspending to 1L, pH 6.5) and diluting to obtain Foc4 conidiaInoculating the prepared conidium suspension into NCM culture medium to make the final concentration of conidium be 1 × 10⁶Culturing at 28 deg.C under shaking at 120rpm for 11-12 h, filtering with 200 mesh cell sieve, washing with 0.8mol/L NaCl solution (osmotic pressure stabilizer) for 3-5 times to obtain fresh mycelium, adding 15g/L of collapse enzyme solution according to the ratio of enzyme solution to mycelium (volume mass ratio is 10:1), performing enzymolysis at 30 deg.C under 120rpm for 3h to obtain protoplast enzymolysis solution, centrifuging at 4 deg.C at 400 × g for 10min, discarding supernatant, adding 1mL of precooled STC solution (containing 10mmol/L Tris-HCl (pH 7.5), 1.2mol/L sorbitol, 50mmol/L CaCl₂) Resuspending the precipitate, centrifuging, discarding the supernatant, adding 10-20 mL of precooled STC, and resuspending the precipitate to obtain Foc4 protoplast suspension, wherein the final concentration of the protoplast is about 1 × 10⁷one/mL.

And (3) preparing the protoplast of the knockout mutant of the fusarium oxysporum f.sp.cubense, and obtaining the protoplast by referring to the preparation steps of the protoplast of the fusarium oxysporum f.sp.cubense.

2.6 transformation of 2.6 Foc4 protoplasts

The knock-out vector pCT74-FoRnt-KO was double digested with KpnI and SpeI to obtain an A-hph-gfp-B fragment. Uniformly mixing 3-5 mu g of recombinant fragment A-hph-gfp-B fragment with 200 mu L of Foc4 protoplast, or uniformly mixing 3-5 mu g of pCTZN-FoRnt-com plasmid with 200 mu L of protoplast of the banana fusarium wilt germ knockout mutant; ice-bath for 15 min. Freshly prepared PSTC conversion buffer (40% PEG4000, 1.2mol/L sorbitol, 50mmol/L CaCl) was added dropwise₂10mmol/L Tris-HCl, pH7.5)1mL, mixed well and left on ice for 15 min. Adding 10mL of precooled STC, and uniformly mixing; centrifuging at 4000rpm at 4 deg.C for 15 min; 6mL of supernatant was removed, and the pellet was resuspended in 3mL of PSB regeneration medium (potato 200.0g, sucrose 273.6g, distilled water to a constant volume of 1L), and shake-cultured at 28 ℃ and 100rpm for 12-16 h. Centrifuging at 4000rpm at 4 ℃ for 15min, removing 5mL of supernatant, adding 12mL of PSA regeneration medium (1.5% agar powder and 150 microgram/mL hygromycin are added into PSB regeneration medium), uniformly mixing, pouring, and culturing in the dark at 28 ℃ for 2-3 d; hygromycin-resistant transformants were picked, transferred to PDA medium (containing potato 200.0g, anhydrous glucose 20.0g, agar 15.0g, distilled water to a constant volume of 1L) containing hygromycin 150. mu.g/mL, and incubated at 28 ℃ in blackDark culture is carried out for 3-4 d, and single colonies are picked for identification.

2.7 PCR validation analysis of 2.7 Foc4 knockout mutant Δ Fornt

Genomic DNA of the hygromycin-positive transformant was extracted and analyzed by PCR validation according to the Fungal DNA extraction Kit (OMEGA Fungal DNA Kit). Respectively carrying out PCR amplification on FoRnt gene segments by using primers FoRnt-F/FoRnt-R; PCR amplification analysis of the hph gene fragment was performed with primers hph-F/hph-R.

FoRnt-F：5′-ATGCTCAGTTACGGGTTGCG-3′，

FoRnt-R：5′-CAAGTAAAGTACGT GATTACATACGG-3′，

hph-F：5′-TGCTGCTCCATACAAGCCAA-3′，

hph-R：5′-GACATTGGGGAGTTCAGCGA-3′；

The PCR reaction system is as follows:

template DNA	0.5μL
		FoRnt-F/hph-F(10μmol/L)	0.5μL
FoRnt-R/hph-R(10μmol/L)	0.5μL
		10×Taq Buffer(Mg2+ plus)	2.5μL
dNTPs(2.5mmol/L)	2.0μL
		Taq(5U/μL)	0.25μL
ddH2O	18.75μL
		Total	25.0μL

The PCR reaction conditions are as follows: reacting at 94 ℃ for 5 min; reacting at 94 ℃ for 30s, at 58 ℃ for 30s and at 72 ℃ for 1min for 30 cycles; reacting at 72 ℃ for 10min to obtain an amplification product.

2.8 PCR validation analysis of anaplerotic mutant Δ FoRnt-com

Genomic DNA of the bleomycin positive transformant was extracted according to the Fungal DNA extraction Kit (OMEGA Fungal DNA Kit) protocol and subjected to PCR-based assay. And carrying out PCR amplification on the gene fragment FoRnt by using the primer FoRnt-F/FoRnt-R.

FoRnt-F：5′-ATGCTCAGTTACGGGTTGCG-3′，

FoRnt-R：5′-CAAGTAAAGTACGT GATTACATACGG-3′；

The PCR reaction system is as follows:

template DNA	0.5μL
		FoRnt-F(10μmol/L)	0.5μL
FoRnt-R(10μmol/L)	0.5μL
		10×Taq Buffer(Mg2+ plus)	2.5μL
dNTPs(2.5mmol/L)	2.0μL
		Taq(5U/μL)	0.25μL
ddH2O	18.75μL
		Total	25.0μL

The PCR reaction conditions are as follows: reacting at 94 ℃ for 5 min; reacting at 94 ℃ for 30s, at 58 ℃ for 30s and at 72 ℃ for 1min for 30 cycles; reacting at 72 ℃ for 10min to obtain an amplification product.

2.9 Southern blot analysis of the 2.9 Foc4 knockout mutant

Southern blot hybridization was performed according to the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche). And amplifying a target gene probe by using a primer FoRnt-F/FoRnt-R, and amplifying an hph gene probe by using an hph-F/hph-R.

FoRnt-F：5′-ATGCTCAGTTACGGGTTGC-3′，

FoRnt-R：5′-CAAGTAAAGTACGTGATTACATACGG-3′，

hph-F：5′-TGCTGCTCCATACAAGCCAA-3′，

hph-R：5′-GACATTGGGGAGTTCAGCGA-3′；

The PCR amplification system of the DNA probe is as follows:

template DNA	1.0μL
		FoRnt-F/hph-F(20μmol/L)	1.0μL
FoRnt-R/hph-R(20μmol/L)	1.0μL
		10×Ex Taq Buffer(Mg2+ plus)	5.0μL
dNTPs(2.5mmol/L)	4.0μL
		Ex Taq(5U/μL)	0.5μL
ddH2O	37.5μL
		Total	50.0μL

The PCR reaction conditions are as follows: reacting at 94 ℃ for 5 min; reacting at 94 ℃ for 30s, at 58 ℃ for 30s and at 72 ℃ for 1min for 30 cycles; reacting at 72 ℃ for 10min to obtain an amplification product.

2.10 phenotypic observations of knockout and anaplerotic mutants Δ FoRnt-com

(1) Observing colony morphology and measuring growth speed. Foc4 wild type, delta FoRnt and delta FoRnt-com were inoculated onto PDA medium, respectively, and cultured at 28 ℃ for 5 days in the dark. The colony diameters were measured at 1d, 3d, and 5d, respectively, and the colony morphologies were observed. Each process set 3 replicates.

(2) And (5) observing the generation and germination of conidia. Inoculating the banana fusarium oxysporum to a Chachi culture medium, placing the Chachi culture medium at 28 ℃, performing shake culture at 120rpm, and counting the sporulation amount after 7 days. The conidium suspension is inoculated on an NCM culture medium, shake culture is carried out at the temperature of 28 ℃ and the rpm of 120, samples are taken at the time of 11h, and the germination condition of the conidia is observed.

2.11 analysis of stress-resistant environmental capability of knockout mutant delta FoRnt and anaplerosis mutant delta FoRnt-com

(1) Determination of cell wall resistance to high osmotic pressure

Foc4 wild type, Δ FoRnt and Δ FoRnt-com were inoculated on PDA medium containing 1mol/L NaCl, 1mol/L sorbitol, 0.02% SDS and 200 μ g/mL Congo red, respectively, and after cultivation in an inverted incubator at 28 ℃ for 5 days, colony growth was observed and measured. Each process set 3 replicates.

(2) Determination of oxidative stress

Foc4 wild type,. DELTA.FoRnt and. DELTA.FoRnt-com were inoculated in a medium containing 25mmol/L H, respectively₂O₂、50mmol/LH₂O₂、75mmol/L H₂O₂After culturing the cells in the PDA culture medium at 28 ℃ for 5 days in an inverted manner, the growth of colonies of the. DELTA.FoRnt, the. DELTA.FoRnt-com and the wild type strain was observed. Each process set 3 replicates.

2.12 pathogenicity analysis of 2.12 Foc4 knock-out mutant delta FoRnt and anaplerosis mutant delta FoRnt-com

Using root-damaging inoculation, Foc4 conidia suspensions of wild type,. DELTA.FoRnt-24 and. DELTA.FoRnt-24-com were used (2 × 10)⁵number/mL) inoculated with 4-leaf stage Brazil bananas; alternately culturing at 25 + -1 deg.C under light/dark for 12h/12h, and observing and counting the incidence of banana seedling leaves and corms after 25 d. Foc4 wild strain and sterile water were used as positive and negative controls, respectively.

3 results and analysis

3.1 construction of Banana Fusarium oxysporum FoRnt gene knockout vector and anaplerosis vector

3.1.1 respectively cloning to obtain a FoRnt gene homology arm A fragment and a homology arm B fragment by adopting a PCR amplification method; respectively connecting the recombinant plasmid with a T vector, and obtaining recombinant plasmids pMD18T-FoRnt-A and pMD18T-FoRnt-B through transformation of escherichia coli, Amp resistance screening, plasmid extraction and sequencing identification. Connecting pMD18T-FoRnt-A with pCT74 plasmid to obtain recombinant plasmid pCT 74-FoRnt-A; the recombinant plasmid is subjected to double enzyme digestion with pMD18T-FoRnt-B, and subjected to DNA ligation, escherichia coli transformation and enzyme digestion identification to obtain a gene knockout vector pCT74-FoRnt-KO (figure 1).

3.1.2 construction of Banana wilt bacterium FoRnt Gene complementation vector

Cloning to obtain a FoRnt gene complementing fragment by adopting a PCR amplification method; the recombinant plasmid pCTZN-FoRnt-com (shown in figure 2) is obtained by connecting the recombinant plasmid pCTZN with a pCTZN vector, and carrying out escherichia coli transformation, Amp resistance screening, plasmid extraction and sequencing identification.

3.2 screening of knockout mutants Δ FoRnt

3.2.1 PCR validation of Gene fragment FoRnt

A homologous recombination method is utilized to convert the gene knockout vector pCT74-FoRnt-KO into protoplasts of fusarium oxysporum f.sp.cubense to obtain 36 hygromycin positive transformants. After DNA extraction, 36 hygromycin positive transformants were subjected to PCR verification analysis using FoRnt gene specific primers. The result shows that 31 positive transformants can be amplified to the target gene fragment, which indicates that the 31 transformants still contain the FoRnt gene; there were 5 transformants that were not amplified to the FoRnt gene, and these 5 transformants were initially identified as positive transformants.

3.2.2 PCR validation of Gene fragment hph

Taking the 5 transformant genomic DNAs which are not amplified to the FoRnt gene as templates, and carrying out PCR amplification by using a hph specific primer; the result shows that 5 transformants of the FoRnt gene are not amplified, and the target fragment of about 1000bp is amplified, and further shows that the 5 transformants are positive transformants.

3.2.3 Southern blot validation of knockout mutant Δ FoRnt

Southern blot analysis was performed on 5 positive transformants that were not amplified to the FoRnt gene but to the hph gene. The results showed that hybridization was carried out using the target gene as a probe, and 5 transformants had no hybridization band. Hybridization was performed using hph as a probe, and a single copy band was found in all 5 transformants (FIG. 3). The above experiments demonstrated that these 5 transformants were positive transformants.

3.3 screening of anaplerotic mutant Δ FoRnt-com

By using a random insertion method, the gene complementation vector pCTZN-FoRnt-com is transformed into Foc4 knock-out mutant delta FoRnt protoplast, and 2 bleomycin positive transformants are obtained. PCR verification analysis is carried out on 2 bleomycin positive transformants by extracting genome DNA of banana fusarium oxysporum and utilizing FoRnt gene specific primers. The result shows that 2 positive transformants can be amplified to a target gene fragment, which indicates that the 2 transformants contain the FoRnt gene; the 2 transformants were preliminarily identified as positive transformants and scored as complemented transformant 1 and complemented transformant 2.

3.4 colony morphology and growth Rate assays for Δ FoRnt and Δ FoRnt-com

Delta FoRnt (delta FoRnt-24) and delta FoRnt-com (delta FoRnt-24-com) were inoculated into PDA medium and observed for growth at different times. The results show that there is no significant difference in colony morphology and growth rate between Δ formnt and Δ formnt-com compared to the Foc4 wild type.

3.5 Observation and analysis of spore yield and spore germination of delta FoRnt and delta FoRnt-com

Delta FoRnt (delta FoRnt-24) and delta FoRnt-com (delta FoRnt-24-com) were inoculated into Chachi's medium, respectively, and spore production analysis was performed after 7d of culture. The results show that the sporulation yield of delta FoRnt and delta FoRnt-com is not significantly different compared with Foc4 wild type.

The observation result of conidium germination shows that the germination rate of Foc4 wild type conidium has no obvious difference with delta FoRnt or delta FoRnt-com, which indicates that after the FoRnt is knocked out, the germination of conidium of banana vascular wilt disease is not affected.

3.6 determination of the anti-hypertonic Capacity of Δ FoRnt and Δ FoRnt-com

The colony diameters of the cells were determined by inoculating Δ FoRnt (. DELTA.FoRnt-24) and Δ FoRnt-com (. DELTA.FoRnt-24-com) in the respective media containing 1mol/L NaCl, 1mol/L sorbitol, 0.02% SDS and 200. mu.g/mL Congo Red (CR) PDA. The results show that compared with the wild type, the sensitivity of delta FoRnt or delta FoRnt-com to NaCl, SDS, congo red and sorbitol has no significant difference, which indicates that the high osmotic pressure resistance of banana fusarium oxysporum is not affected after the FoRnt is knocked out (figure 4).

3.7 determination of oxidative stress sensitivity of Δ FoRnt and Δ FoRnt-com

Delta FoRnt (Delta FoRnt-24) and Delta FoRnt-com (Delta FoRnt-24-com) were seeded at a concentration of 25mmol/L, 50mmol/L and 75mmol/L H, respectively₂O₂The PDA culture medium (2) was cultured at 28 ℃ for 5 days, and the colony diameter was measured. The results show that after knocking out the FoRnt gene, the sensitivity to hydrogen peroxide is not changed significantly (FIG. 5).

3.8 pathogenicity analysis of Δ FoRnt and Δ FoRnt-com

The pathogenicity test result of the Brazilian banana seedlings shows that obvious yellowing and withering appear on banana leaves after Foc4 wild type inoculation, and the corms are browned in a large area; after the knockout mutant delta FoRnt (delta FoRnt-24) is inoculated, the yellowing condition of banana leaves is light, and the color change area of the corms is small. The disease condition of the anaplerotic mutant delta FoRnt-com (delta FoRnt-24-com) is similar to the disease condition index of a wild type. Disease index statistics showed that the disease index of the knockout mutant was significantly lower than that of the wild type (fig. 6).

Therefore, the gene provided by the invention can be used for preventing and treating plant diseases, particularly banana vascular wilt caused by banana vascular wilt. In addition, the gene provided by the invention can be used as a target of a medicament for preventing and treating plant diseases. Following the teachings and teachings of this specification, one skilled in the art can develop a medicament for controlling plant diseases, particularly banana vascular wilt.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> southern China university of agriculture

Application of <120> gene FoRnt in regulation and control of pathogenicity of banana fusarium oxysporum

<160>12

<170>SIPOSequenceListing 1.0

<210>1

<211>1126

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> base sequence of banana fusarium oxysporum FoRnt gene

<220>

<222>(180)..(1016)

<223> CDS sequence of banana fusarium oxysporum FoRnt gene

<400>1

tgatgctcag ttacgggttg cgagtggatg atcgtacaaa ctggatggta tagaaatcgc 60

tcatgtcatg gtcagagcgg tgccgttgag aattataaag ccaggagcca tatcgttgca 120

aaatcaagtg ttgcaaagta acccaagtga agactgcagt accttgagat agcagcaaca 180

tgtcttcgtt tcagattttg tctcttatca cagcagctac ttctgttgtg gcacttgctg 240

ggacaccaaa tgtctacgct ggtagtcgcc gaggctcatg ctatgatgat gctgcagctg 300

atgacacctg ctgctattca tcacctgcga gactaattca gactcaagtc tgggatacac 360

gaccagtcac tggaccttta gactcatgga ctgttggtgg actctggcca atccacaacg 420

acggctccct ccctacccac tgcgacacca accgcacata cacaaacatc acacaaatcc 480

tctaccatgc aggtgccgaa tataccattg acgatatgaa ccaactctgg gagtcaccca 540

atggtgataa cgacgagctc tggcaagatc aatgggctaa gcatggcaca tgcttcagca 600

ccttgagccc ggagtgcttc agccactatg aagtctccga agaagcagcc ccgtacttca 660

aaaaagccat gtctctccac aagaggctgc cgacgtatga ctggcttcgt gacgacggca 720

ttgttccttc atattccatg ttttatcggc tctcagacat ccaagatact ctagaggatc 780

atcatggctc ccgcgtgtca cttcgctgtg ccggacaaag aatacgtgag attgggtatc 840

acttcaatgt tacagggact ttgcaagatg gcttctttac tgactctggc gcattcggcg 900

atttgggcga ttgtccagag ctggtattgt atgaaccgaa gggggaaacc aagaaggcaa 960

tttttaactt tgagacgttt catccgcata ccgctgcgga tgtggaggac ctttagctca 1020

gtccatcagt atacttcacc ttagcttaga taacctttta ataaattccg tatgtaatca 1080

cgtactttac ttgagaacta gcaaccaatc aagtgccgtt tccaag 1126

<210>2

<211>278

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> amino acid sequence encoded by gene FoRnt

<400>2

Met Ser Ser Phe Gln Ile Leu Ser Leu Ile Thr Ala Ala Thr Ser Val

1 5 10 15

Val Ala Leu Ala Gly Thr Pro Asn Val Tyr Ala Gly Ser Arg Arg Gly

20 25 30

Ser Cys Tyr Asp Asp Ala Ala Ala Asp Asp Thr Cys Cys Tyr Ser Ser

35 40 45

Pro Ala Arg Leu Ile Gln Thr Gln Val Trp Asp Thr Arg Pro Val Thr

50 55 60

Gly Pro Leu Asp Ser Trp Thr Val Gly Gly Leu Trp Pro Ile His Asn

65 70 75 80

Asp Gly Ser Leu Pro Thr His Cys Asp Thr Asn Arg Thr Tyr Thr Asn

85 90 95

Ile Thr Gln Ile Leu Tyr His Ala Gly Ala Glu Tyr Thr Ile Asp Asp

100 105 110

Met Asn Gln Leu Trp Glu Ser Pro Asn Gly Asp Asn Asp Glu Leu Trp

115 120 125

Gln Asp Gln Trp Ala Lys His Gly Thr Cys Phe Ser Thr Leu Ser Pro

130 135 140

Glu Cys Phe Ser His Tyr Glu Val Ser Glu Glu Ala Ala Pro Tyr Phe

145 150 155 160

Lys Lys Ala Met Ser Leu His Lys Arg Leu Pro Thr Tyr Asp TrpLeu

165 170 175

Arg Asp Asp Gly Ile Val Pro Ser Tyr Ser Met Phe Tyr Arg Leu Ser

180 185 190

Asp Ile Gln Asp Thr Leu Glu Asp His His Gly Ser Arg Val Ser Leu

195 200 205

Arg Cys Ala Gly Gln Arg Ile Arg Glu Ile Gly Tyr His Phe Asn Val

210 215 220

Thr Gly Thr Leu Gln Asp Gly Phe Phe Thr Asp Ser Gly Ala Phe Gly

225 230 235 240

Asp Leu Gly Asp Cys Pro Glu Leu Val Leu Tyr Glu Pro Lys Gly Glu

245 250 255

Thr Lys Lys Ala Ile Phe Asn Phe Glu Thr Phe His Pro His Thr Ala

260 265 270

Ala Asp Val Glu Asp Leu

275

<210>3

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>FoRnt-AF

<400>3

ggggtacctt ggcgatggtg ctgagtgg 28

<210>4

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>FoRnt-AR

<400>4

ccgctcgagt gttggttccg gggctgata 29

<210>5

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>FoRnt-BF

<400>5

ggaattccat cgttcttttc aacgttatc 29

<210>6

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>FoRnt-BR

<400>6

gactagttag gagcatcaca ttcgtaa 27

<210>7

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>com FoRnt-F

<400>7

ggggtaccgg agaagaaacc gagattgtaa tt 32

<210>8

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>com FoRnt-R

<400>8

acgcgtcgac cgaaacatgc catagtggag at 32

<210>9

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>FoRnt-F

<400>9

atgctcagtt acgggttgcg 20

<210>10

<211>26

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>FoRnt-R

<400>10

caagtaaagt acgtgattac atacgg 26

<210>11

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>hph-F

<400>11

tgctgctcca tacaagccaa 20

<210>12

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>hph-R

<400>12

gacattgggg agttcagcga 20

Claims (7)

1. The application of the gene FoRnt in regulating and controlling the pathogenicity of banana vascular wilt pathogens is characterized in that:

the amino acid sequence of the gene FoRnt is shown as SEQ ID NO: 2, or as shown in SEQ ID NO: 2 by one or more amino acid substitutions, insertions and deletions, and the analogue still has the function of controlling the pathogenicity of the fusarium oxysporum f.sp.

2. The application of the gene FoRnt of claim 1 in preventing and treating banana vascular wilt caused by banana vascular wilt.

3. The use of the gene FoRnt of claim 1 as a target for a plant disease control drug, characterized in that: the plant disease is banana vascular wilt caused by banana vascular wilt.

4. Use according to claim 1, 2 or 3, characterized in that:

the nucleotide sequence of the gene FoRnt is one of the following A, B, C, D:

A. encoding the amino acid sequence of SEQ ID NO: 2;

B. as shown in SEQ ID NO: 1;

C. as shown in SEQ ID NO: 1, CDS sequences shown at positions 180-1016;

D. the above A, B and C have been obtained by base insertion, deletion, or substitution and still have the function of controlling the pathogenicity of banana vascular wilt.

5. A method of treating banana vascular wilt caused by banana vascular wilt, comprising: comprising blocking or inhibiting the expression of the gene FoRnt of claim 1.

6. The application of the medicament for blocking or inhibiting the expression of the gene FoRnt in claim 1 in preparing medicines is characterized in that:

the medicament is antisense RNA or siRNA of the gene FoRnt of claim 1, and the medicament is used for controlling banana vascular wilt caused by banana vascular wilt.

7. Use according to claim 6, characterized in that:

the nucleotide sequence of the gene FoRnt is one of the following A, B, C, D:

A. encoding the amino acid sequence of SEQ ID NO: 2;

B. as shown in SEQ ID NO: 1;

C. as shown in SEQ ID NO: 1, CDS sequences shown at positions 180-1016;

D. the above A, B and C have been obtained by base insertion, deletion, or substitution and still have the function of controlling the pathogenicity of banana vascular wilt.

Images