CN108659109B

CN108659109B - Wheat powdery mildew resistance-related protein TaSTKR1, and coding gene and application thereof

Info

Publication number: CN108659109B
Application number: CN201810520151.8A
Authority: CN
Inventors: 常诚; 智朋飞; 樊庆新; 刘娇
Original assignee: Qingdao University
Current assignee: Qingdao University
Priority date: 2018-05-28
Filing date: 2018-05-28
Publication date: 2020-10-23
Anticipated expiration: 2038-05-28
Also published as: CN108659109A

Abstract

The invention provides a wheat powdery mildew resistance related protein TaSTKR1, and a coding gene and application thereof. The protein is the protein of the following (a) or (b): (a) protein composed of amino acid sequence shown in SEQ ID No. 2; (b) and (b) protein which is derived from (a) and related to disease resistance or has transcription activation activity, wherein the amino acid sequence shown in SEQ ID No.2 is subjected to substitution, deletion or addition of one or more amino acid residues. The invention discovers that the wheat protein TaSTKR1 can resist wheat powdery mildew caused by wheat powdery mildew physiological race E09 by transiently over-expressing the coding gene of the wheat protein TaSTKR1, and further researches show that the protein also has transcriptional activation activity and can be used as a transcriptional activation factor. The protein provided by the invention can lay a foundation for the research of culturing transgenic wheat with wheat powdery mildew resistance.

Description

Wheat powdery mildew resistance-related protein TaSTKR1, and coding gene and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a wheat powdery mildew resistance-related protein TaSTKR1, and a coding gene and application thereof.

Background

Wheat powdery mildew is caused by obligate parasitic fungus Poecilomyces bivalensBgt（Blumeriagraminisfsp.tritici) The caused fungal disease belongs to diseases distributed worldwide, and the yield of wheat in the world is seriously influenced. In recent years, the damage caused by wheat powdery mildew is increasingly serious due to the increase of the planting density of crops, the increase of the application amount of nitrogen fertilizer and the single planting of the crops. The disease can affect various organs of the overground part of a wheat plant, mainly leaves and leaf sheaths, chaffs and awns can be damaged when the disease is serious, the yield can be reduced by 10 to 40 percent generally, and the yield in a seriously ill field can be reduced by more than 50 percent. The powdery mildew has large population, wide application range, numerous physiological species and high variation speed, so thatMany effective resistance genes lose resistance. At present, breeding workers always select and popularize disease-resistant varieties as main prevention and treatment means for diseases, the effects are achieved for years, but the problem of resistance loss is unsolved all the time, and the diversity of resistance sources is an effective way for realizing the lasting disease resistance. Therefore, cloning a new disease-resistant gene by a biological method, and improving the resistance of wheat to powdery mildew by using a transgenic method is one of effective strategies for preventing and treating powdery mildew in the future. However, the existing wheat powdery mildew resistance gene resources are relatively deficient, and the development of wheat disease resistance gene resources is urgently needed.

Disclosure of Invention

The invention aims to provide a wheat powdery mildew resistance related protein TaSTKR1, and a coding gene and application thereof.

The invention provides a wheat powdery mildew resistance related protein, which is a protein of the following (a) or (b):

(a) protein composed of amino acid sequence shown in SEQ ID No. 2;

(b) and (b) protein which is derived from (a) and related to disease resistance or has transcription activation activity, wherein the amino acid sequence shown in SEQ ID No.2 is subjected to substitution, deletion or addition of one or more amino acid residues.

The protein of (a) or (b) may be artificially synthesized, or may be obtained by synthesizing the coding gene and then performing biological expression.

Substitution, substitution and/or addition of one or several amino acid residues in the amino acid sequence of the above-mentioned protein may be caused by naturally occurring variation or by artificial mutagenesis.

The present invention also provides a DNA molecule according to any one of the following 1) to 3):

1) DNA molecule shown in SEQ ID No. 1;

2) a DNA molecule which hybridizes with the DNA sequence defined in 1) under strict conditions and codes a protein which is related to disease resistance or has transcription activation activity;

3) a DNA molecule which has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the DNA sequence defined in 1) and which encodes a protein which is associated with disease resistance or has transcriptional activation activity.

The stringent conditions are as follows: in a solution of 6 XSSC, 0.5% SDS at 65 ℃ and then washed once with each of 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

The invention also provides the gene recombinant vector, the expression cassette, the transgenic cell line or the recombinant strain. Wherein, the recombinant vector can be a vector obtained by inserting SEQ ID No.1 into pUbi-Adaptor-NOS vector; the insertion of SEQ ID No.1 into the 35S-BD vector can also be usedEcoRⅠAndXhoⅠand obtaining the vector between enzyme cutting sites.

The invention also provides application of the protein in culturing transgenic plants with wheat powdery mildew disease resistance.

Further introducing the coding gene into plant wheat to obtain the wheat powdery mildew disease-resistant transgenic wheat.

The invention also provides application of the protein as a transcription activator. The protein is used as a transcription activator to activate gene expression.

The invention discloses a wheat protein TaSTKR1, and the coding gene thereof is transiently overexpressed, so that the wheat protein TaSTKR1 can resist wheat powdery mildew caused by wheat powdery mildew physiological race E09, and further research shows that the protein also has transcriptional activation activity and can be used as a transcriptional activation factor. The protein provided by the invention can lay a foundation for the research of culturing transgenic wheat with wheat powdery mildew resistance.

Drawings

FIG. 1 is a graph showing the results of PCR amplification of TaSTKR1 in example 1.

FIG. 2 shows the effect of transient overexpression of TaSTKR1 on wheat powdery mildew formation index in example 2.

FIG. 3 is a graph showing the results of transcriptional activation of reporter gene expression of TaSTKR1 in example 2.

FIG. 4 is a graph showing the results of example 3, TaSTKR1 localization in wheat nuclei.

Detailed Description

The present invention will be described in further detail with reference to the following embodiments and the accompanying drawings.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

The materials used in the examples described below are all available from Qingdao university.

Some of the materials in the following examples are as follows:

the wheat variety Shannong 20 is described in research paper on molecular detection of disease-resistant gene of new wheat variety "Shannong 20". Crop academic newspaper, 2014, 40: 611-621. Publicly available from Qingdao university;

the wheat variety Jing 411 is recorded in a research paper, and the Jing 411 is used as a backbone parent to culture a new high-yield wheat variety. Crop academic newspaper, 2009, 4: 1-5. Publicly available from Qingdao university;

wheat cultivar Kenong 199 is described in research paper high-yield widely-applicable wheat cultivar Kenong 199. Wheat crop press, 2007, 27 (2): 368-370. Publicly available from Qingdao university;

wheat variety Yumai 66 is described in research paper about the identification and molecular marker of powdery mildew resistance gene of common wheat variety Yumai 66. Crop literature, 2008, 34 (4): 545-550. Publicly available from Qingdao university;

wheat powdery mildew physiological race E09 is described in research paper, and the wheat head powdery mildew resistant gene resource GB4 is cultivated by utilizing artificially synthesized wheat. Plant genetic resources journal, 2007, 8: 378. publicly available from Qingdao university;

columbia ecotype Arabidopsis thaliana (Col-0) is described in research paper Molecular characterization of the submirgence response of theArabidopsis thalianaecotype columbia. New Photologist. 2011, 190: 457-;

the vector pUbi-GUS is described in research paper A transfer assay system for the functional genes in the world Molecular Plant-Microbe interactions, 1999, 12:647-654, publicly available from the university of Qingdao;

the vector pUbi-Adaptor-NOS is described in The research paper Recognition specificity and RAR1/SGT1 dependency in barrel MLA disease resistance genes to The pore great fusion. The Plant Cell, 2003, 15: 732-;

the vector 35S-BD is described in the research paper Soybean GmPHD-type transformation regulated stress strain complete plants, PLoS One, 2009, 4(9): e7209. publicly available from Qingdao university;

vector 35S-BD-VP16 is described in the research paper Soybean GmPHD-type transcriptional regulation strategy vectors PLoSONE, 2009, 4(9): e7209. publicly available from the university of Qingdao;

vector 5 XGAL 4-LUC describes a research paper in Soybean GmPHD-type transcriptional regulation stress tolerance in transgenic Arabidopsis plants, PLoSONE, 2009, 4(9): e7209. publicly available from the university of Qingdao;

the vector Pptrl is described in the research paper Soybean GmPHD-type transformation regulated stress strain complete plants, PLoS One, 2009, 4(9): e7209. publicly available from the Qingdao university;

the vector pUbi-Gateway-mYFP is described in The research paper The CC-NB-LRR-type Rdg2 aristosance gene transfer immunity to The seed-born barley leaf expression in The absence of The latent cell de-ath PLoS One, 2010, 5: e12599, publicly available from The university of Qingdao.

Examples 1,TaSTKR1Obtaining of genes

1. Obtaining RNA

Inoculating 7-day seedling of Shannong 20 wheat with wheat white powder physiological strain E09, collecting materials in 48 hr, and extracting RNA.

2. Reverse transcription to obtain cDNA

Reverse transcription system:

RNA 2.5. mu.L, Oligo-dT primer 1. mu.L, DEPC water 6.5. mu.L, mix the above solution in a centrifuge tube, incubate at 65 ℃ for 5 minutes, and keep on ice for 5 minutes.

5. mu.L of 5 Xreverse transcription buffer solution, 1.25. mu.L of dNTP mix, 0.625. mu.L of inhibitor, 1. mu.L of M-MLV reverse transcriptase, 7.125. mu.L of DEPC water, and carrying out warm bath at 42 ℃ for 1 hour and 5 minutes at 95 ℃ to obtain cDNA.

3. CloningTaSTKR1

Adding 25 μ L of double distilled water into the cDNA, taking 1 μ L of the cDNA to perform subsequent PCR reaction as a template, performing PCR amplification by using the following primers,

a forward primer: TATCGGCACCGATGCAGATAC (SEQ ID No. 3)

Reverse primer: GAAGACCATCACTCCATGTTC (SEQ ID No. 4)

The PCR system was as follows: KOD buffer 5. mu.L, MgSO₄mu.L, dNTP 5. mu.L, template 100ng, forward primer 2. mu.L, reverse primer 2. mu.L, KOD plus 1. mu.L, water 32. mu.L.

The PCR procedure was as follows: 94 ℃ for 5min, then 94 ℃ for 30s, 60 ℃ for 30s, 68 ℃ for 90s, for 29 cycles, and finally 68 ℃ for 10min and 16 ℃ for 10 min.

The result is shown in figure 1, a 1632bp PCR product is obtained, the PCR product is sent for sequencing, the result is that the PCR product has the nucleotide shown in SEQ ID No.1 in the sequence table, and the gene shown in the sequence is named asTaSTKR1The coding region is the 1 st to 1350 th nucleotides from the 5' end of SEQ ID No.1 in the sequence table; the protein coded by the gene is named TaSTKR1, and the amino acid sequence of the protein is SEQ ID No.2 in the sequence table.

Examples 2,TaSTKR1Application of gene in powdery mildew resistance

First, the gene gun transient overexpression technology identifies the regulation and control effect of TaSTKR1 on wheat powdery mildew resistance

1. Vector construction

1) PCR amplification was carried out using the PCR product obtained in example 1 (or the artificially synthesized sequence 1) as a template and the following primers.

A forward primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCACCCAAGCGCTCCGC (SEQ ID No. 5)

Reverse primer: GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGTCAGCACTCTCAAGGGC (SEQ ID No. 6)

2) BP reaction is carried out on the PCR product obtained in the step 1) and a pDNOR201 vector (purchased from invitrogen) to obtain an ENTRY vector.

The BP reaction system described above: PCR product 75ng, pDNOR 20175 ng, BP enzyme 0.5. mu.L, 25 ℃ overnight.

3) The LR reaction between the ENTRY vector and pUbi-Adaptor-NOS vector is carried out to generate pUbi-TaSTKR1 vector.

LR reaction system: ENTRY vector 75ng, pUbi-Adaptor-NOS vector 75ng, LR enzyme 0.5. mu.L, 25 ℃ overnight.

The vector pUbi-TaSTKR1 is identified by sequencing, and is obtained by inserting SEQ ID No.1 in a sequence table into pUbi-Adaptor-NOS vector.

2. Gene gun transient overexpression test

1) Preparation of gold powder

(1) Weighing 9mg (w) of gold powder, placing the gold powder in a centrifuge tube, and placing the centrifuge tube for more than 4 hours at 65 ℃;

(2) adding 70% ethanol, vortex oscillating for 8 min, and standing for 15 min;

(3) centrifuging at 2000r/min for 2s, and removing supernatant;

(4) adding 1mL of sterilized distilled water, carrying out vortex oscillation for 2 minutes, standing for 1 minute, centrifuging at 2000rpm/min for 2s, and removing supernatant;

(5) repeating the step (4) for three times;

(6) adding 50% glycerol into the precipitated gold powder, and carrying out vortex oscillation.

2) Preparation of DNA bullets

(1) Shaking gold powder in 50% glycerol for 5min to obtain suspension;

(2) taking 50 mu L of suspension liquid into a centrifugal tube;

(3) 5 μ L of plasmid DNA (2 μ g) was added, and 50 μ L of CaCl was added with shaking₂Adding 20 mu L spermidine (0.1M) into the aqueous solution (2.5M) in the small tube during oscillation, oscillating for 3 minutes, standing for 1min, centrifuging at 2000rpm/min for 2s, and removing the supernatant;

(4) adding 140 mu L70% ethanol, performing vortex oscillation to uniformly disperse the precipitate, centrifuging (2000 rpm/min2 s), and discarding the supernatant;

(5) adding 140 muL 100% ethanol, performing vortex oscillation to uniformly disperse the precipitate, centrifuging (2000 rpm/min2 s), and discarding the supernatant;

(6) adding 12 mu L100% ethanol, and performing vortex oscillation to uniformly disperse the precipitate.

3) Gene gun bombardment transformation method

Gene gun-mediated methods: respectively carrying out moisturizing and bud blowing on seeds of 20 wheat shannon, 411 wheat koong 199 and 66 wheat yunnan, growing for about one week, cutting off a first leaf with the leaf surface upward, placing on a culture dish containing a culture medium (1% agar and 100mg/L benzimidazole), recovering for 4 hours to obtain target materials of 20 wheat shannon, 411 wheat koong 199 and 66 wheat yunnan, and carrying out bombardment by using a gene gun;

the objective plasmid pUbi-TaSTKR1 and the plasmid pUbi-GUS were expressed as 1: 1 volume, wrapping on gold powder particles with the diameter of 1 μm, bombarding the target materials of wheat Shannon 20, Jing 411, Kenong 199 and Yumai 66 by PDS-1000/He (American Bio-Rad) according to the method, wherein the bombardment parameters of a gene gun are as follows: the distance between the barrier net and the bombarding material was 5.5cm and the pressure of the splittable film was 1100 Pa).

After the gene gun bombardment is finished, respectively putting the bombarded target material leaves of the wheat Shannon 20, Jing 411, Kenong 199 and Yumai 66 into an incubator to restore and culture for 4 hours (the culture condition is 22 ℃, 16h illumination/18 ℃ and 8h darkness) to obtain the wheat Shannon 20, Jing 411, Kenong 199 and Yumai 66 leaves transferred with pUbi-TaSTKR1 and pUbi-GUS; standing for 15 hours, and then inoculating spores of wheat powdery mildew physiological race E09;

the inoculation methods are as follows: shaking spores of corresponding microspecies on corresponding wheat leaves to ensure 2 spores/mm²。

Standing and culturing the inoculated leaves of 20 Shannong, 411 Jing, 199 Konong and 66 Yumai for 48 hours (under the culture condition of 22 ℃, 16h of illumination and 8h of darkness at 18 ℃), performing GUS staining, standing overnight at 37 ℃, decoloring after the staining is finished, and observing the cells by using a microscope after two days.

Counting the ratio of susceptible cells in GUS-expressing cells to calculate haustorium index, and judging according to the haustorium indexGeneTaSTKR1The function of (c). The lower the haustorium index, the higher the resistance.

The judgment standard of the disease-resistant cells is as follows: GUS is expressed in cells, the cells do not contain haustoria, and the cells with conidium attached to the surfaces of the cells are disease-resistant cells.

Judgment standard of the infected cells: GUS is expressed in the cells, and the cells containing haustorium in the cells are susceptible cells.

The calculation formula of the sucker index is as follows: haustorium index = number of susceptible cells/(number of resistant cells + number of susceptible cells) × 100%.

Wheat Shannon 20 leaf cells (OE-EV) transferred with pUbi-Adaptor-NOS and pUbi-GUS, wheat Jing 411 leaf cells (OE-EV) transferred with pUbi-Adaptor-NOS and pUbi-GUS, wheat Kenong 199 (KN 199) leaf cells (OE-EV) transferred with pUbi-Adaptor-NOS and pUbi-GUS, and wheat Yumai 66 leaf cells (OE-EV) transferred with pUbi-Adaptor-NOS and pUbi-GUS were used as air controls. The experiment was repeated 3 times and the results averaged.

The results are shown in FIG. 2:

the haustorium index of the wheat shannon 20 leaf cells transferred with pUbi-Adaptor-NOS and pUbi-GUS is 47.32%, and the haustorium index of the wheat shannon 20 leaf cells transferred with pUbi-TaSTKR1 and pUbi-GUS is 34.21%;

the haustorium index of the wheat Jing 411 leaf cell transferred with pUbi-Adaptor-NOS and pUbi-GUS is 52.13%, and the haustorium index of the wheat Jing 411 leaf cell transferred with pUbi-TaSTKR1 and pUbi-GUS is 27.14%;

the haustorium index of the wheat family agro 199 leaf cells transferred with pUbi-Adaptor-NOS and pUbi-GUS is 46.37%, and the haustorium index of the wheat family agro 199 leaf cells transferred with pUbi-TaSTKR1 and pUbi-GUS is 31.26%;

the haustorium index of the wheat Yumai 66 leaf cells transferred into pUbi-Adaptor-NOS and pUbi-GUS is 49.34%, and the haustorium index of the wheat Yumai 66 leaf cells transferred into pUbi-TaSTKR1 and pUbi-GUS is 21.32%.

The results show that it is overexpressed in wheat leavesTaSTKR1Then, the sucker indexes all decline obviously, which showsTaSTKR1Positively regulates the powdery mildew resistance of wheat.

Second, analysis of transcriptional activation Activity of TaSTKR1 as a transcriptional activator

1. 35S-BD-TaSTKR1 vector construction

A forward primer: AAATTTGAATTCATGGCACCCAAGCGCTCCGC (SEQ ID No. 7)

Reverse primer: GGGCCTCTCGAGTCAGTCAGCACTCTCAAGGGC (SEQ ID No. 8)

Subjecting the obtained PCR product toEcoRⅠAndXhoⅠafter double digestion, the double digestion is connected with a 35S-BD vector subjected to the same digestion to obtain a vector 35S-BD-TaSTKR 1.

The 35S-BD-TaSTKR1 vector is identified by sequencing, and the vector is obtained by inserting the sequence 1 in the sequence table into the 35S-BD vectorEcoRⅠAndXhoⅠand obtaining the vector between enzyme cutting sites.

2. Protoplast preparation

Three weeks Columbia type Arabidopsis thaliana young and tender leaves are cut into 1 mm strips by a blade, enzymolysis is carried out for 4 hours at 25 ℃ in the dark, counting is carried out under a microscope by a cell counting plate after a series of operations such as filtration, centrifugation and the like, and generally 2 multiplied by 10 are contained in each 100 mu L⁵And (4) protoplasts.

3. Plasmid transformation and fluorescence value determination

100 μ L of protoplasts were dispensed into 2mL EP tubes and the following plasmids were added: effects 35S-BD-TaSTKR 1; CK-: 35S-BD; CK +: 35S-BD-VP 16; reporter, 5 XGAL 4-LUC; internalcotrol: Pptrl. The expression of the reporter gene LUC was examined after 16 hours of dark culture at 25 ℃.

And detecting the fluorescence values of the firefly luciferase and the Renilla luciferase to obtain the ratio of the two (the fluorescence value of the firefly luciferase/the fluorescence value of the Renilla luciferase), namely the relative activity of the reporter gene. (for detailed detection, see the Promega kit Dual-Luciferase Reporter Assay System No. E1910)

As a result, as shown in FIG. 3, the relative activity of LUC in protoplasts transformed with 35S-BD-TaSTKR1 and 5 XGAL 4-LUC was 2.47;

the relative activity of LUC in protoplasts transformed with 35S-BD and 5 XGAL 4-LUC was 1;

the relative activity of LUC in protoplasts transformed with 35S-BD-VP16 and 5 XGAL 4-LUC was 11.24;

the above results indicate that TaSTKR1 can activate the expression of the reporter gene, and the fluorescence value is 2.47 times that of the control plasmid 35S-BD, whereby it was confirmed that TaSTKR1 has the transcriptional activation activity and is a transcriptional activator.

Example 3 subcellular localization of TaSTKR1

One, subcellular localization of TaSTKR1

1. Vector construction

A forward primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCACCCAAGCGCTCCG (SEQ ID No. 9)

Reverse primer: GGGGACCACTTTGTACAAGAAAGCTGGGTCGTCAGCACTCTCAAGGGCAT (SEQ ID No. 10)

2) BP reaction is carried out on the PCR product prepared in the step 1) and a pDNOR201 vector (purchased from invitrogen company) to obtain an ENTRY-TaSTKR1 vector.

3) The ENTRY-TaSTKR1 vector and pUbi-Gateway-mYFP vector LR are reacted to generate pUbi-TaSTKR1-mYFP vector.

LR reaction system:

75ng of intermediate vector, 75ng of pUbi-Gateway-mYFP vector, 0.5 μ L of LR enzyme, and overnight at 25 ℃.

The pUbi-TaSTKR1-mYFP vector is identified by sequencing, and the vector is obtained by inserting the sequence 1 in the sequence table into the pUbi-Gateway-mYFP vector.

2. Gene gun-mediated single cell transient transformation technology for identifying subcellular localization condition of TaSTKR1

After the 20 wheat shannong seeds are subjected to moisturizing and bud blowing planting, after the seeds grow for about one week, shearing off a first leaf with the leaf surface facing upwards, placing the first leaf on a culture dish containing a culture medium (1% agar and 100mg/L benzimidazole), recovering for 4 hours, and performing gene gun bombardment; wrapping a target plasmid pUbi-TaSTKR1-mYFP on gold powder particles with the diameter of 1 μm, bombarding the target material by PDS-1000/He (American Bio-Rad), and setting the bombardment parameters of a gene gun as follows: the distance between the blocking net and the bombarding material is 5.5cm, and the pressure of the splittable film is 1100 Pa.

After the leaves are bombarded by a gene gun, the leaves are placed in a plant culture chamber to normally grow for 36 hours, DAPI staining is carried out to mark cell nuclei, and the subcellular localization condition of TaSTKR1 is observed through different fluorescence channels of a confocal microscope.

As a result, as shown in FIG. 4, the fluorescence of TaSTKR1-mYFP completely overlapped the fluorescence of DAPI, so that TaSTKR1 was localized in the nucleus.

Sequence listing

<110> Qingdao university

<120> wheat powdery mildew resistance related protein TaSTKR1, and coding gene and application thereof

<160>12

<170>SIPOSequenceListing 1.0

<210>1

<211>1350

<212>DNA

<213> wheat (Triticum aestivum)

<400>1

atggcaccca agcgctccgc cgccacggcg tgggggtccc cgtccgacgc ctccgacgcg 60

gagggcgacg cgggccaccg ccgccgcggc cgcgacgacc ccccctccga caccgacccc 120

tccaagaccc cgccgcccaa ccctaaccct aagtcgtccg ccgccgcgcc ctcctccacc 180

ccctccgtcg cggctgactc cgccgccgcc ggatccgact ccgggggcac ctacgactcc 240

gacgccgagg cgcaccgccg ccccgcgccc aagcccgccg cctcctcgcc caagcccggc 300

ggcaagccca gggcgcgctc ccccggcatc aactccgact cctacaactc cgccgcgccc 360

gtggcctcgg acgccgacctcgacccggcc gccggcgccg actctgaaga cgacaacgtc 420

tcgccgctcc gctccgcgcg ccgcccccgc gccgaggcat ccatcatcaa gcccatcagc 480

tcccgcccca tggactcgcc gccccgcggc ggcgcctctg cctccgagcc gcgcgtcaag 540

cgcccccgca gcgccgccat atcagcgccc tctccggacc cgctgaagcg cccctcgcgg 600

ctctggagcc atgacgacga gcttctcatc ctgcgcggcc tcgccacata ccgcgccaag 660

agcggcgtgc tccctggttc caccaatgac atcggtaagc tccacagcca catccgtgcc 720

cagctcagtg ttagggtatc caccacgcag ctcagtgata aggtccggcg cctcaagcag 780

aagtaccagt tgcttgccac ccgtgccaag aatggacggg agcaggagtt gcacaccccg 840

catgaccgca gcatctatga gcatgccaag aaggtctggg ggttggttgg tagtggtggt 900

ggtgatggag gaggcagtgg gtatgagaat tatggtggtg gtgatagtga tgaattgcaa 960

tacagcggag atagcgatga tgatatggag agtcagcggg atgaccgcta ccacatcaag 1020

aaccggaagg tgaggccaat tacagcggcc aatggcaatg ggattgggct tggggctgtc 1080

aatgccaatg gcagagggaa aagtgggctt gagaagggga aggatgcata tccctacctg 1140

tgggagactg ttgaggagct gtccaaggag catccgagtg gtgcggcatt caagaaggca 1200

tttgaggtgc tcgaaggatc aaaagcacgg gcgatagagg aaaagctgag gaggtttagg 1260

ttgacggaga tcagacagca gctgcgtagg atggacctga tgaaggagac ggtgaggatg 1320

gtgctcgatg cccttgagag tgctgactga 1350

<210>2

<211>449

<212>PRT

<213> wheat (Triticum aestivum)

<400>2

Met Ala Pro Lys Arg Ser Ala Ala Thr Ala Trp Gly Ser Pro Ser Asp

1 5 10 15

Ala Ser Asp Ala Glu Gly Asp Ala Gly His Arg Arg Arg Gly Arg Asp

20 25 30

Asp Pro Pro Ser Asp Thr Asp Pro Ser Lys Thr Pro Pro Pro Asn Pro

35 40 45

Asn Pro Lys Ser Ser Ala Ala Ala Pro Ser Ser Thr Pro Ser Val Ala

50 55 60

Ala Asp Ser Ala Ala Ala Gly Ser Asp Ser Gly Gly Thr Tyr Asp Ser

65 70 75 80

Asp Ala Glu Ala His Arg Arg Pro Ala Pro Lys Pro Ala Ala Ser Ser

85 90 95

Pro Lys Pro Gly Gly Lys Pro Arg Ala Arg Ser Pro Gly Ile Asn Ser

100 105 110

Asp Ser Tyr Asn Ser Ala Ala Pro Val Ala Ser Asp Ala Asp Leu Asp

115 120 125

Pro Ala Ala Gly Ala Asp Ser Glu Asp Asp Asn Val Ser Pro Leu Arg

130 135 140

Ser Ala Arg Arg Pro Arg Ala Glu Ala Ser Ile Ile Lys Pro Ile Ser

145 150 155 160

Ser Arg Pro Met Asp Ser Pro Pro Arg Gly Gly Ala Ser Ala Ser Glu

165 170 175

Pro Arg Val Lys Arg Pro Arg Ser Ala Ala Ile Ser Ala Pro Ser Pro

180 185 190

Asp Pro Leu Lys Arg Pro Ser Arg Leu Trp Ser His Asp Asp Glu Leu

195 200 205

Leu Ile Leu Arg Gly Leu Ala Thr Tyr Arg Ala Lys Ser Gly Val Leu

210 215 220

Pro Gly Ser Thr Asn Asp Ile Gly Lys Leu His Ser His Ile Arg Ala

225 230 235 240

Gln Leu Ser Val Arg Val Ser Thr Thr Gln Leu Ser Asp Lys Val Arg

245 250 255

Arg Leu Lys Gln Lys Tyr Gln Leu Leu Ala Thr Arg Ala Lys Asn Gly

260 265 270

Arg Glu Gln Glu Leu His Thr Pro His Asp Arg Ser Ile Tyr Glu His

275 280 285

Ala Lys Lys Val Trp Gly Leu Val Gly Ser Gly Gly Gly Asp Gly Gly

290 295 300

Gly Ser Gly Tyr Glu Asn Tyr Gly Gly Gly Asp Ser Asp Glu Leu Gln

305 310 315 320

Tyr Ser Gly Asp Ser Asp Asp Asp Met Glu Ser Gln Arg Asp Asp Arg

325 330 335

Tyr His Ile Lys Asn Arg Lys Val Arg Pro Ile Thr Ala Ala Asn Gly

340 345 350

Asn Gly Ile Gly Leu Gly Ala Val Asn Ala Asn Gly Arg Gly Lys Ser

355 360 365

Gly Leu Glu Lys Gly Lys Asp Ala Tyr Pro Tyr Leu Trp Glu Thr Val

370 375 380

Glu Glu Leu Ser Lys Glu His Pro Ser Gly Ala Ala Phe Lys Lys Ala

385 390 395 400

Phe Glu Val Leu Glu Gly Ser Lys Ala Arg Ala Ile Glu Glu Lys Leu

405 410 415

Arg Arg Phe Arg Leu Thr Glu Ile Arg Gln Gln Leu Arg Arg Met Asp

420 425 430

Leu Met Lys Glu Thr Val Arg Met Val Leu Asp Ala Leu Glu Ser Ala

435 440 445

Asp

<210>3

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

tatcggcacc gatgcagata c 21

<210>4

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gaagaccatc actccatgtt c 21

<210>5

<211>51

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ggggacaagt ttgtacaaaa aagcaggctt catggcaccc aagcgctccg c 51

<210>6

<211>51

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ggggaccact ttgtacaaga aagctgggtc tcagtcagca ctctcaaggg c 51

<210>7

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

aaatttgaat tcatggcacc caagcgctcc gc 32

<210>8

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

gggcctctcg agtcagtcag cactctcaag ggc 33

<210>9

<211>50

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

ggggacaagt ttgtacaaaa aagcaggctt catggcaccc aagcgctccg 50

<210>10

<211>50

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

ggggaccact ttgtacaaga aagctgggtc gtcagcactc tcaagggcat 50

<210>11

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

atccaactcc acgccatgct c 21

<210>12

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

gcttcttggt tttgcgctta g 21

Claims

1. An application of a wheat powdery mildew resistance gene in resisting wheat powdery mildew caused by wheat powdery mildew physiological race E09 is characterized in that the gene is a gene consisting of a nucleotide sequence shown as SEQ ID No. 1; inserting the gene into a pUbi-adapter-NOS vector to obtain a recombinant expression vector, and introducing the recombinant expression vector into a plant wheat leaf.