CN104480118B - LRR-RLK (leucine-rich repeat receptor-like kinase) gene in arachis hypogaea.L and application thereof to bacterial wilt resistance of tobaccos - Google Patents

Abstract

The invention relates to an LRR-RLK (leucine-rich repeat receptor-like kinase) gene AhRLK6 associated with bacterial wilt resistance of arachis hypogaea.L and a construction method of an over-expression vector of the gene and in particular relates to an application of the gene AhRLK6 in arachis hypogaea.L to tobacco bacterial wilt resistant gene engineering, belonging to the technical field of plant gene engineering. The gene contains nucleotide sequences shown in SEQ ID No.1. The over-expression vector is constructed to transform Cuibi-1 tobaccos, the transgenic plants are inoculated with ralstonia solanacearum through molecular detection, and over-expression of the over-expression vector in the tobaccos can conduce to obviously improving the resistance of the transgenic tobaccos to bacterial wilt, thereby indicating that AhRLK6 possibly participates in the defence reaction of the plants to ralstonia solanacearum, which lays the foundation for bacterial wilt resistant genetic breeding of the plants and strongly promotes the development and application of the tobacco bacterial wilt resistant gene engineering.

Description

Peanut LRR-RLK gene and the application in tobacco resistance to bacterial wilt

Technical field

The present invention relates to a kind of bacterial wilt of peanut resistance correlation LRR Receptor-like protein ki-nase genoidAhRLK6And its super table Reach the structure of carrier, further relate to this peanutAhRLK6Application in tobacco Bacterial wilt resistance gene engineering for the gene, belongs to plant Thing gene engineering technology field.

Background technology

By Ralstonia solanacearum (Ralstonia solanacearum) bacterial wilt that causes is the widest in world wide One of general bacterial disease, can infect more than 450 kind plants of 54 sections.As a kind of soil-borne disease, bacterial wilt of peanut is endangered Evil is extremely serious, and the peanut underproduction can be caused even to have no harvest, and seriously threatens peanut yield and quality.By conventional chemical agent and Biological control can not this disease of effectively preventing generation, solve really by efficent rotation, intercropping and interplanting nor effectively The certainly popular and propagation of disease, maximally effective means still cultivate disease-resistant variety, but what conventional hybridization breeding method selected Disease-resistant variety has that resistance and high yield and high quality are negatively correlated, the clone of disease-resistant related gene and being resisted using genetic engineering It is effectively solving peanut by having that bacterial wilt infects that sick related gene conversion peanut obtains high yield and high quality resistance to bacterial wilt peanut varieties Effect approach.

Plant is constantly stimulated by external environment and cell interior in long-term evolutionary process, and then produces a series of Signal transduction this stimulation is responded, thus cause plant produce pathogen-associated molecular pattern (pathogen- Ssociated molecular patterns, PAMPs) immune response that causes（pattern triggered immunity PTI）And the immune response (effectortriggered immunity ETI) that effector causes, and as identification signal The protein kinase of membrane receptor then participates in signal transduction by reversible phosphorylation regulatory mechanism, and the participation of protein kinase is in cell Play an important role in signal transduction process.Because of the discovery in structure and molecular function and on animal of this kind of protein kinase Receptor protein kinase (receptor protein kinase, RPK) is similar, but most PRK does not also find that it is joined Body, therefore they are called Receptor-like protein ki-nase.From plant, identification obtains multiple and animal recipient protein kinase homology at present Gene, the function of receptors due to this kind of gene outcome has not been demonstrated, the native ligand of most receptors albumen also not by Find, therefore they are called Receptor-like protein ki-nase (receptor-like protein kinase, RLK).Full asphalt mixture Receptor-like protein ki-nase (1eucine-rich repeat receptor-like kinase, LRR-RLK) be to plant at present Most classes RLK are identified in thing.The typical structure of LRR-RLK includes extracellular LRR domain, the kinases area of intracellular and Individual transmembrane region.Wherein LRR domain has conservative L-x-x-L-x-L-x-x-N motif, produces in pathogen infection plant host The PAMPs of identification pathogen is participated in raw PTI immune response, then the signal transduction by the kinases area activation downstream of C-terminal, enter And make plant produce defence immune response.LRR-RLK coded product is except the signal of grow regulation and control, the hormone of involved in plant Transduction, biological abiotic stress etc., go back the degeneration-resistant Defense response reaction of involved in plant.The anti-white rot gene of paddy riceXa21Have The architectural feature of typical LRR-RLK, 21 LRR domains are capable of identify that the part of pathogen, in the presence of intracellular kinase Cause the anti-white rot defense reaction of paddy rice.ERECTAIt is an energy resistance to bacterial wilt LRR-RLK gene on arabidopsis, by extracellular The defense reaction to bacterial wilt for the kinases area phosphorylation downstream gene, in additionERECTATo gangrenosum acne fungi in arabidopsis (Plectosphaerella cucumerina) Resistant reaction.FLS2 is also belonging to the receptor protein of leucine repetitive sequence Kinases（LRR-RLK, FLS2 are that map based cloning obtains from the Arabidopsis Mutants insensitive to flg22, and its sequence is in plant Highly conserved, encode 1173 amino acid, disease resistance response can be produced with the flagellin flg22 interaction inducing plant of bacterium.With Going deep into of genomics research, more and more LRR-RLK will be cloned, its participate in the degeneration-resistant mechanism of action of plant disease-resistant with And plant also will be illustrated with the mechanism of pathogen interaction.

The present invention is directed to background above technology, is given birth to peanut according to mRNA after peanut anti-sense bacterial wilt kind inoculation Ralstonia solanacearum The gene chip hybridization result that the sequencing of thing abiotic stress builds obtains one on disease-resistant variety and is subject to Ralstonia solanacearum inducible up regulation table Reach 2 times of LRR-RLK gene, its full length cDNA sequence is obtained by RACE technology, this gene contains 8 to be tied with Ralstonia solanacearum acceptor The LRR motif closing, albumen is guarded domain analysis and is had typical LRR-RLK Receptor-like protein ki-nase architectural feature.Subcellular Localization On cell membrane, after anti-sense peanut varieties inoculation Ralstonia solanacearum, disease-resistant variety can chronic up-regulation be expressed, and susceptible variety then becomes Change less, build Overexpression vector and pass through the resistance to bacterial wilt for the agrobacterium mediation converted tobacco performance.By to transgenosis Tobacco inoculate Ralstonia solanacearum after defense-related gene analysis thus it is speculated thatAhRLK6The defense reaction to Ralstonia solanacearum for the possible involved in plant. This just provides fundamental basis for the molecule mechanism of plant resistance to bacterial wilt.

Content of the invention

This discovery provides one kind and is expressed peanut LRR-RLK gene by Ralstonia solanacearum inducible up regulationAhRLK6And its resist in tobacco Application in bacterial-wilt gene engineering, by the development of tobacco Bacterial wilt resistance gene engineering of making greater efforts to promote and application.

Present invention firstly provides a kind of LRR Receptor-like protein ki-nase genoid, it is named asAhRLK6Gene, this gene contains Just like the nucleotide sequence shown in SEQ ID No.1.DescribedAhRLK6The amino acid sequence of gene code such as SEQ ID NO.2 Shown.PeanutAhRLK6Gene can significantly improve the resistance capacity of tobacco bacterial wilt, and this is the molecule machine of peanut resistance to bacterial wilt Reason is provided fundamental basis.

The peanut of the present inventionAhRLK6Gene mainly passes through resistance to bacterial wilt peanut varieties in inoculation Ralstonia solanacearum and non-seeded MRNA is hybrid with it the information obtaining substantial amounts of gene expression difference, to 2 times of LRR- of Ralstonia solanacearum Inducement difference up-regulated RLK gene carries out the clone of full-length cDNA, and Cloning of full length gene nucleotide series are as shown in SEQ ID No.1.

Present invention also offers comprising the overexpression vector of described peanut LRR Receptor-like protein ki-nase genoid；And, institute State the construction method of overexpression vector：Digestion connects the gus gene replaced in plant expression vector pBI121-GUSA, builds CaMV 35S promoter drivesAhRLK6The plant expression vector pBI121-AhRLK6-OE of gene.

Finally, the invention provides described peanut LRR Receptor-like protein ki-nase genoid or described overexpression vector Application in tobacco Bacterial wilt resistance gene engineering.

The peanut of the present inventionAhRLK6Functional identification of genes is to connect by digestion to replace plant expression vector pBI121- Gus gene in GUSA, builds CaMV 35S promoter and drivesAhRLK6Gene plant expression vector pBI121-AhRLK6-OE, By its Transformed E HA105 Agrobacterium, it is conducted on a dark green tobacco by leaf disk method, Ralstonia solanacearum is carried out to transgene tobacco Inoculation, and then it is carried out with Resistance Identification, result proves to improve the resistance to bacterial wilt to tobacco for this transgenosis.

The peanut of the present inventionAhRLK6Gene overexpression tobacco is compared wild-type tobacco and bacterial wilt resistance against diseases is significantly carried Height, shows that this gene has highly important using value in plant Bacterial wilt resistance gene engineering.

Brief description

Fig. 1 obtains for RACEAhRLK63 ' unknown nucleotide sequences of gene and the electrophoretogram of 5 ' unknown nucleotide sequences and full-length cDNA；

Fig. 2 is S-TKc area Multiple alignment：Medicago truncatula for clover GenBank accession number is: AY769943.1, Lotus japonicus for crowtoe GenBank accession number is:AJ495843.1, Glycine max is big Beans, GenBank accession number is:ACM89591.1, Vitis vinifera for grape GenBank accession number is: XM_ 002279527.1；

Fig. 3 isAhRLK6Subcellular Localization result；

Fig. 4 isAhRLK6In the anti-, differential expression felt in bacterial wilt peanut varieties；*, * * shows average difference two-by-two respectively Significantly（P<0.05）Extremely notable with difference（P<0.01）.

Fig. 5 isAhRLK6Overexpression vector and overexpress the resistance that bacterial wilt is infected in transgene tobacco；Wherein a. pBI-AhRLK6The diagram of-OE overexpression vector; b.AhRLK6Overexpression transgene tobacco inoculates the phenotype of Ralstonia solanacearum.

Specific embodiment

【Embodiment 1】RACE obtainsAhRLK6Gene 3 ' unknown nucleotide sequence and 5 ' unknown nucleotide sequences

Abiotic according to peanut and biotic 454 sequencing transcription is combined into the expression profiles of gene chip of peanut（Roche Company synthesizes）, obtained using the differential expression that chip hybridization before and after the inoculation of resistance to bacterial wilt kind screens gene before and after Ralstonia solanacearum induces Obtain candidate gene fragment, design one pair of genes primer PRRS _ 6_F（5’-ACGAGATTCGCTTCATGACGAGCCTC-3’）With PRRS_6-R（5’-TCTAAGCATTCCTACCACCTCCTCTG-3’）；Further according to connecing added by template single-stranded cDNA building-up process Header sequence RACE-F（AAGCAGTGGTATCAACGCAGAGTGGCCAT）And RACE-R （ATTCTAGAGGCCGAGGCGGCCGACATGd(T)30N-1N-3'）, using PRRS_6-R primer and RACE-F primer and PRRS _ 6_F primer and the pairing of RACE-R primer carry out 5 ' and 3 '-RACE reactions respectively, and 5 '-RACE reaction conditions are 94 DEG C 5min→(94℃ 30s→57℃ 30s→72℃ 2min)30 cycles→72℃10min；3 '-RACE reaction conditions are 94 ℃ 5min→(94℃ 30s→72℃ 2min)5cycles →(94℃ 30s→64℃ 30s→72℃ 2min)30 cycles→72℃10min；The autotelic recovery to PCR primer of the size of the purpose band gene according to Bioinformatics Prediction Connect and carry out T-A clone, positive colony send Hua Da gene Co., Ltd to be sequenced.By 5 ' and 3 ' unknown nucleotide sequences obtaining after splicing Obtain its full length cDNA sequence, total length cNDA primer AhRLK6- FL-F is designed according to full length cDNA sequence（5’- AAATTAAGGAAGAACAAATGCATACCT-3’）And AhRLK6-FL-R（5’- GCAACAACATATATTATCTTTTATACAAAAC-3’）Primer obtains full length cDNA sequence from single-stranded cDNA amplification, and PCR is produced Thing autotelic recovery connection carries out T-A clone, and positive colony send Hua Da gene Co., Ltd to be sequenced and preserve plasmid.AhRLK6 The electrophoretogram of 3 ' unknown nucleotide sequences of gene and 5 ' unknown nucleotide sequences and full length cDNA clone is as shown in Figure 1；Its full length cDNA sequence As shown in SEQ ID No.1, cDNA sequence total length 3352bp of this gene, temporarily name AhRLK6 (LRR Receptor like Kinase), through analyzing 992 amino acid of this gene code, 5 ' non-translational region length is about 122 bp, and 3 ' end non-translational regions are a length of 251bp, includes Poly (A) tail of 31bp.From GenBank, find four known protein sequences, respectively from clover, Crowtoe, soybean, grape.Using Clustal W Multiple Sequence Alignment software, to protein kinase catalysis region（S_TKc）Carry out many Sequence homology compares analysis.As（Fig. 2）Shown although belonging to from different sections, protein kinase catalysis region（PKc）Suitable Conservative.

【Embodiment 2】AhRLK6The Subcellular Localization of gene expression product

For Subcellular Localization carrier, by AhRLK6-SL-F（5’- ATTAGGATCCACCATGAGAACCTCATTGTGTTGTAG-3’）And AhRLK6-SL-R（5’- ATTAGGCGCGCCAGAGATTAATTAGGTTATGATGGGT-3’）This expands from the plasmid with complete reading frame to primer Do not included termination codonAhRLK6Gene cDNA, 5 ' end 3 ' end is respectively provided with BamH1 and Asc1 restriction enzyme site, to this reality Test the pBI-GFP of room structure and amplification obtainsAhRLK6Gene uses BamH1 simultaneously（Purchased from NEB company）And Asc1（Purchased from NEB Company）Double digestion, builds p35S through connecting and converting::AhRLK6::GFP carrier.Agrobacterium is converted by frozen-thawed method GV3101, with p35S::GFP compares, and agroinfiltration method converts Ben's tobacco, is seen with fluorescence microscope after 25 DEG C of culture 48h Examine green fluorescence（The a length of 488nm of excitation light wave, wavelength of transmitted light is 532nm）.Result showsAhRLK6The coded product of gene It is positioned on cell membrane（Shown in Fig. 3）.

【Embodiment 3】AhRLK6Expression pattern analysis after anti-, sense bacterial wilt peanut Ralstonia solanacearum are processed

Inoculate the difference that Ralstonia solanacearum is expressed, this research in order to analyze AhRLK6 gene in anti-, sense bacterial wilt peanut varieties Take real time fluorescence quantifying PCR method antagonism, sense bacterial wilt peanut material Guangdong oil 92 (YY 92）Can granule (XH) leaf-cutting method with newly After inoculation Ralstonia solanacearum is processed, in the expression of different time this gene of point analysis.Peanut and Tobacco Leaf are extracted using CTAB method The total serum IgE of piece, according to PrimeScript Reverse Transcriptase reverse transcriptase（Purchased from TAKARA company）Explanation Book carries out the synthesizing single-stranded cDNA of reverse transcription, and single-stranded cDNA is diluted 10 times, and 2 L are template, and with Ahactin, Ntactin is internal reference Gene, carries out quantitative PCR reaction using Eppendorf Mastercycler ep realplex real-time fluorescence quantitative PCR instrument, According to the SYBR Premix Ex Taq kit protocol operation of TAKARA company, the reaction system of 20 L includes 10 L 2 × SYBR Premix Ex-Taq buffer, each 0.5 L of positive anti-primer, moisturizing to 20 L.QRT-PCR reaction condition：95 DEG C pre- Denaturation 5min；95 DEG C of 15s, 60 DEG C of 15 s, 72 DEG C of 30s, 40 circulations.Relative expression quantity adopts 2^-△△Ct(Livak) method meter Calculate.Wherein △ △ Ct=(CT_gene- CT_actin)_Process- (CT_gene- CT_actin)_Comparison.Result is shown in disease-resistant variety Guangdong oil 92 （YY92）On, expression essentially unchangedization in 48h after inoculation, 72h gene expression after inoculation raises 2 times, and newly can in susceptible variety In granule, after inoculation, this gene of 3h relative expression just raises 2.5 times, with the continuity of inoculation time, the relative expression of this gene Amount also continues to increase, and the 72h gene expression to after inoculation is raised more than 16 times（Shown in Fig. 4）

【Embodiment 4】AhRLK6Overexpression vector builds and checking

By AhRLK6-OE-F（5’-ATTAGGATCCACCATGAGAACCTCATTGTGTTGTAG-3’）And AhRLK6- OE-R（5’-ATTTAGGCGCGCCTAGAGATTAATTAGGTTATGATGGGT-3’）This is to primer from having complete reading frame In plasmid, amplification obtains including termination codonAhRLK6Gene cDNA ORFs, 5 ' end 3 ' end be respectively provided with BamH1 and Asc1 restriction enzyme site, the pBI121-GUSA being driven by 2 × CaMV 35S promoter that this laboratory is built and amplification obtainAhRLK6Purpose fragment uses BamH1 and Asc1 double digestion simultaneously, reclaims purpose fragment, 16 DEG C overnight connect with T4 ligase, turns Change to e.colistraindh5α, build p35S::AhRLK6-OE overexpression vector, true through PCR checking and digestion verification The correctness of its vector construction fixed（Fig. 5 a）.Agrobacterium EHA105 is converted by frozen-thawed method in case Transgenic Tobacco is used.

【Embodiment 5】The PCR identification of the genetic transformation of tobacco and transgene tobacco

Take Agrobacterium tumefaciens mediated leaf disk method transformation of tobacco, being respectively provided with plasmid p35S::The super table of AhRLK6-OE The Agrobacterium reaching carrier passes through dark green No. one of leaf disk method transformation of tobacco kind（CB-1）, use 100mg/L kanamycins（Kan）Screening Leaf bud and root growth, with 500 mg/L cephalosporins in incubation（Cef）To suppress the growth of Agrobacterium, condition of culture 25 DEG C ± 2 DEG C of temperature, illumination daily 14h daytime/10h night.Co-culture culture medium：MS culture medium+0.1mg/L NAA（A- naphthalene Acetic acid）+ 1mg/L 6-BA（6-benzyl aminopurine）, induce screening and culturing medium：MS culture medium+0.1mg/L NAA+1mg/L 6- BA+ 100 mg/L kan+500mg/L Cef, root media：MS culture medium+50mg/L Kam+500mg/L Cef. NAA, 6-BA, kan and Cef are purchased from Sigma company.

According to 35S promoter andAhRLK6Gene order design pair of primers primer 35S-F (5 '- TGATGTGATATCTCCACTGACGTAAG-3 ') andAhRLK6-R（5’-ACTCAGAGTAACTCTCAGGAATCTC-3’）, CTAB method extracts transgenosis and non-transgenic tobacco DNA, and with the DNA of two kinds of transfer-gen plants as template, unconverted tobacco DNA is Comparison, using design 35S-F andAhRLK6- R enters performing PCR amplification.PCR reaction system is：10 × buffer 2.0 l, dNTP 1.5 l, 35S-F 0.5 l,AhRLK6- R 0.5 l, Taq enzyme 0.1 l, ddH2O 14.4 l, template DNA 1.0 l, cumulative volume For 20 l.Response procedures are：94 ℃ 5 min→（94 ℃ 30 s→58℃ 30 s→72 ℃ 60 s）40 cycles→ 72 ℃ 10min→ hold at 4℃.

【Embodiment 6】AhRLK6The Resistance to bacterial wilt identification of overexpression transgene tobacco

The transgene tobacco T0 of acquisition is carried out bagging selfing for Resistant variants and harvests T1 for transgenic seed, using T2 generation Transgenic seed carries out transgene tobacco phenotype analytical and Function Identification.By T2 for transgenic line seed（pBI-AhRLK6- OE）And wild-type mature seed（WT-CB-1）Seed asepsis water soaks 24h, 75% alcohol 30s, 10% hydrogen peroxide respectively 10min, sterile water wash 5-6 time, in sowing MS culture, after 15 days, transplant in seedlings nursing plate, choose in the same size after one month Transplantation of seedlings cultivate 9 weeks in the small flower after, tobacco seedling is carried out with Ralstonia solanacearum vein injection inoculation and processes, in transgene tobacco After inoculation tobacco Ralstonia solanacearum 7d, obvious necrotic plaque in overexpression tobacco plant, and wilting and dead occurs in control group WT-CB-1 The symptom died, after 15d, substantially performance is stronger than wild type CB-1 for transgene tobacco resistance, identical test at least in triplicate more than, All there is same trend result.It was found thatAhRLK6Transgene tobacco is significantly stronger than wild type control (Fig. 5 b) to ralstonia solanacearum, ExplanationAhRLK6Take part in plant the resistance of ralstonia solanacearum is acted on.

<110>University Of Agriculture and Forestry In Fujian

<120>Peanut LRR-RLK gene and the application in tobacco resistance to bacterial wilt

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 3352

<212> DNA

<213>Peanut（Arachis hypogaea ）

<400> 1

acagactact gatgatcagt cgatgggggc gaaattaagg aagaacaaat gcatacctgg 60

ccataggttg gttagagtat tgtatcagag atagaagaaa caaagggaac tgtgaaacaa 120

aaatgagaac ctcattgtgt tgtagcatta ttctgttaag tttcgtcttc atttggctga 180

ataatgtaac agtaacagtg ttaggctctt ccttcagcga cctcgacacg ttgttgaagc 240

tcaaggaagc catgaaagga tcaaaagcca aacccgacgc gcttcaagat tggaaattct 300

caacctctat ctccgctcac tgttcattct ccggcgtcac ctgcgaccgc cagaacctcc 360

gcgtcgtggc ccttaacgtc tcctttgttc cccttttcgg cagcattccg ccggagatag 420

gcctcttgga caagctcgag agccttaccc tctcatcgga caatctcacc aaggagcttc 480

ccatggagct cgccaatctc acctccctca ggctcctcaa catctcgcac aaccttttct 540

ctggtcgctt ccccggcgat atcaccgtgg ccatgacaga actcgaaacg ctggacatct 600

acgacaacag cttcagcgga accttaccag aggagttcgt gagactggag aagctccggt 660

ccctcaacct ctctggaaac tatttctccg gcgagattcc tgagagttac tctgagttcg 720

aaagcttgga ggttctgaac ctggccacaa acagcttaac cggcaagatt ccgagaagct 780

tggtgaaatt gaagaagctg aaaagactat ccctcgggta tgataattcc tactcagatg 840

tagtacctac agaattcggt tcgttcgagt cgttgcaact gcttgatttg tccagctgta 900

acttgagcgg tgagattcct cccacgctcg gcgcgttaac tcacttgcac actctcttcc 960

ttcaaatgaa caaccttacc ggaaccattc cttcacaact ctccactatg ataagcctca 1020

agtcgttgga tctctcctac aacgagttaa cgggcgagtt tccgttgaca ttctctaagc 1080

tcaccaatct cacgctaatc aatttcttcc ataacaaact ccgaggcaac atccctccct 1140

tcgttgggga cctcccgaac ctggagacct ttcaggtttg gggtaacaac ttctccaacg 1200

tgcttccacc caaccttggc caaaacgcca gattcttata cttcgacgtc actaataacc 1260

acttcactgg agagctccct agggacctgt gcaaatccgg caggttgaga acgttcttgg 1320

ccaccggtaa cttcttttac ggcaccattc ctgaaggaat aggaggttgc gtttcgttgg 1380

agaagataag aattagtgat aacttcctcc aaggccaggt tcctcctggg atctttaaat 1440

tgccagctgt ccagatcatc gagatggcga ataaccgttt taacggaaat attccttctg 1500

atatttccgg ggattccctc agcatcctaa ccctctccac taacaacttc gccggcagga 1560

tcgcgccgga gctcaagaat ctccagaaac tgcagacgct tgcgcttgac gcgaaccagt 1620

tcgttggaga gattccaggg gaggtgtttg acttgccggc gttgatcaag gtcaacttga 1680

gcggcaacaa cctcaccggt gagattccgg agtcggtgat tcactgtggt tctctgacgg 1740

cggttgattt tagccggaac atgctcaccg gagaaattcc caaggggata aaaagcctca 1800

cagttctaag catcttgaac ctctcgcgca accacatcac cggaactgtc cccgacgaga 1860

ttcgcttcat gacgagcctc aacacgctgg atctctccaa caacaacttc attggaagag 1920

tccccacggg tggccagttc gtggccttca atgacaagtc gtttgcaggg aaccctaacc 1980

tctgctctcc gcaccagccg tattgtcctt cctccgtcaa cactgcctct ggaaaaagcc 2040

acaatcctct gagttcaaaa tcaactaagg tagttataat cgtgatcggg atctccacgg 2100

cagtgctcct ggctatggtg acggtataca ttatgaggaa gaggaagcac cagaaagaaa 2160

tgtcgtggaa gctgacggcg ttccagtcaa cgctgaaaat gaaggcagag gaggtggtgg 2220

aatgcttgaa ggaagagaac atcattggaa aaggaggagc aggaatcgtg taccgcggga 2280

caacaccgaa gggaacggag gtggcaatca agagacttgt ggggcaagga agtggaagaa 2340

acgattacgg tttcaaggcg gagatagaaa cgttagggaa gataaggcac aggaacataa 2400

tgaggctctt ggggtacgtg tcaaataagg acacgaacct gttgctgtat gagtacatgc 2460

cgaatggaag cttgggagag tggctgcatg gtgcgaaggg agggcacctc acgtgggaaa 2520

tgagataccg cattgcggtg gaggctgcca aggggctctg ctacttgcac catgattgct 2580

cgcccttgat cattcacagg gatgttaagt ccaataacat cttgcttgat gaggactttg 2640

aggctcacgt tgctgatttt gggctcgcca agttcttgca ggaccctgga gcgtctcagt 2700

ccatgtcctc cattgctggc tcctacggct acattgctcc agagtacgct tacacgctga 2760

aagtggacga gaagagcgat gtatacagct ttggagtagt gctgttggag ctgatcgtag 2820

gaaggaagcc agtgggtgag ttcggagatg gtgttgacat cgttggatgg gtcaacaaga 2880

ccatgtcgga gctgtctcag ccgtctgatg cggcttccgt gttggcagtg gtggacccca 2940

ggctcaatgg gtatccattg ggcagcgtca tccacatgtt caacatagct atgatgtgtg 3000

ttagagaaat tggccatgct aggcctacca tgagggaagt tgtttatatg ctcactaatc 3060

cacctcaatc taccacccat cataacctaa ttaatctcta gttcattacc ctttttaatt 3120

tcccctttgt aaataaatta acacagatga aactgtgcaa aatataataa ccttcatcta 3180

tatatatatg ggtagacgtg tattaatacc aaatgtaaaa taggtttgaa ttttggtttg 3240

atgttatttg tcaaagggag gggtttgtcc tgattgtgtt attatcagaa gttttgtata 3300

aaagataata tatgttgttg caaaaaaaaa aaaaaaaaaa aaaaaaaaaa aa 3352

<210> 2

<211> 992

<212> PRT

<213>Peanut（Arachis hypogaea）

<400> 2

Met Arg Thr Ser Leu Cys Cys Ser Ile Ile Leu Leu Ser Phe Val Phe

1 5 10 15

Ile Trp Leu Asn Asn Val Thr Val Thr Val Leu Gly Ser Ser Phe Ser

20 25 30

Asp Leu Asp Thr Leu Leu Lys Leu Lys Glu Ala Met Lys Gly Ser Lys

35 40 45

Ala Lys Pro Asp Ala Leu Gln Asp Trp Lys Phe Ser Thr Ser Ile Ser

50 55 60

Ala His Cys Ser Phe Ser Gly Val Thr Cys Asp Arg Gln Asn Leu Arg

65 70 75 80

Val Val Ala Leu Asn Val Ser Phe Val Pro Leu Phe Gly Ser Ile Pro

85 90 95

Pro Glu Ile Gly Leu Leu Asp Lys Leu Glu Ser Leu Thr Leu Ser Ser

100 105 110

Asp Asn Leu Thr Lys Glu Leu Pro Met Glu Leu Ala Asn Leu Thr Ser

115 120 125

Leu Arg Leu Leu Asn Ile Ser His Asn Leu Phe Ser Gly Arg Phe Pro

130 135 140

Gly Asp Ile Thr Val Ala Met Thr Glu Leu Glu Thr Leu Asp Ile Tyr

145 150 155 160

Asp Asn Ser Phe Ser Gly Thr Leu Pro Glu Glu Phe Val Arg Leu Glu

165 170 175

Lys Leu Arg Ser Leu Asn Leu Ser Gly Asn Tyr Phe Ser Gly Glu Ile

180 185 190

Pro Glu Ser Tyr Ser Glu Phe Glu Ser Leu Glu Val Leu Asn Leu Ala

195 200 205

Thr Asn Ser Leu Thr Gly Lys Ile Pro Arg Ser Leu Val Lys Leu Lys

210 215 220

Lys Leu Lys Arg Leu Ser Leu Gly Tyr Asp Asn Ser Tyr Ser Asp Val

225 230 235 240

Val Pro Thr Glu Phe Gly Ser Phe Glu Ser Leu Gln Leu Leu Asp Leu

245 250 255

Ser Ser Cys Asn Leu Ser Gly Glu Ile Pro Pro Thr Leu Gly Ala Leu

260 265 270

Thr His Leu His Thr Leu Phe Leu Gln Met Asn Asn Leu Thr Gly Thr

275 280 285

Ile Pro Ser Gln Leu Ser Thr Met Ile Ser Leu Lys Ser Leu Asp Leu

290 295 300

Ser Tyr Asn Glu Leu Thr Gly Glu Phe Pro Leu Thr Phe Ser Lys Leu

305 310 315 320

Thr Asn Leu Thr Leu Ile Asn Phe Phe His Asn Lys Leu Arg Gly Asn

325 330 335

Ile Pro Pro Phe Val Gly Asp Leu Pro Asn Leu Glu Thr Phe Gln Val

340 345 350

Trp Gly Asn Asn Phe Ser Asn Val Leu Pro Pro Asn Leu Gly Gln Asn

355 360 365

Ala Arg Phe Leu Tyr Phe Asp Val Thr Asn Asn His Phe Thr Gly Glu

370 375 380

Leu Pro Arg Asp Leu Cys Lys Ser Gly Arg Leu Arg Thr Phe Leu Ala

385 390 395 400

Thr Gly Asn Phe Phe Tyr Gly Thr Ile Pro Glu Gly Ile Gly Gly Cys

405 410 415

Val Ser Leu Glu Lys Ile Arg Ile Ser Asp Asn Phe Leu Gln Gly Gln

420 425 430

Val Pro Pro Gly Ile Phe Lys Leu Pro Ala Val Gln Ile Ile Glu Met

435 440 445

Ala Asn Asn Arg Phe Asn Gly Asn Ile Pro Ser Asp Ile Ser Gly Asp

450 455 460

Ser Leu Ser Ile Leu Thr Leu Ser Thr Asn Asn Phe Ala Gly Arg Ile

465 470 475 480

Ala Pro Glu Leu Lys Asn Leu Gln Lys Leu Gln Thr Leu Ala Leu Asp

485 490 495

Ala Asn Gln Phe Val Gly Glu Ile Pro Gly Glu Val Phe Asp Leu Pro

500 505 510

Ala Leu Ile Lys Val Asn Leu Ser Gly Asn Asn Leu Thr Gly Glu Ile

515 520 525

Pro Glu Ser Val Ile His Cys Gly Ser Leu Thr Ala Val Asp Phe Ser

530 535 540

Arg Asn Met Leu Thr Gly Glu Ile Pro Lys Gly Ile Lys Ser Leu Thr

545 550 555 560

Val Leu Ser Ile Leu Asn Leu Ser Arg Asn His Ile Thr Gly Thr Val

565 570 575

Pro Asp Glu Ile Arg Phe Met Thr Ser Leu Asn Thr Leu Asp Leu Ser

580 585 590

Asn Asn Asn Phe Ile Gly Arg Val Pro Thr Gly Gly Gln Phe Val Ala

595 600 605

Phe Asn Asp Lys Ser Phe Ala Gly Asn Pro Asn Leu Cys Ser Pro His

610 615 620

Gln Pro Tyr Cys Pro Ser Ser Val Asn Thr Ala Ser Gly Lys Ser His

625 630 635 640

Asn Pro Leu Ser Ser Lys Ser Thr Lys Val Val Ile Ile Val Ile Gly

645 650 655

Ile Ser Thr Ala Val Leu Leu Ala Met Val Thr Val Tyr Ile Met Arg

660 665 670

Lys Arg Lys His Gln Lys Glu Met Ser Trp Lys Leu Thr Ala Phe Gln

675 680 685

Ser Thr Leu Lys Met Lys Ala Glu Glu Val Val Glu Cys Leu Lys Glu

690 695 700

Glu Asn Ile Ile Gly Lys Gly Gly Ala Gly Ile Val Tyr Arg Gly Thr

705 710 715 720

Thr Pro Lys Gly Thr Glu Val Ala Ile Lys Arg Leu Val Gly Gln Gly

725 730 735

Ser Gly Arg Asn Asp Tyr Gly Phe Lys Ala Glu Ile Glu Thr Leu Gly

740 745 750

Lys Ile Arg His Arg Asn Ile Met Arg Leu Leu Gly Tyr Val Ser Asn

755 760 765

Lys Asp Thr Asn Leu Leu Leu Tyr Glu Tyr Met Pro Asn Gly Ser Leu

770 775 780

Gly Glu Trp Leu His Gly Ala Lys Gly Gly His Leu Thr Trp Glu Met

785 790 795 800

Arg Tyr Arg Ile Ala Val Glu Ala Ala Lys Gly Leu Cys Tyr Leu His

805 810 815

His Asp Cys Ser Pro Leu Ile Ile His Arg Asp Val Lys Ser Asn Asn

820 825 830

Ile Leu Leu Asp Glu Asp Phe Glu Ala His Val Ala Asp Phe Gly Leu

835 840 845

Ala Lys Phe Leu Gln Asp Pro Gly Ala Ser Gln Ser Met Ser Ser Ile

850 855 860

Ala Gly Ser Tyr Gly Tyr Ile Ala Pro Glu Tyr Ala Tyr Thr Leu Lys

865 870 875 880

Val Asp Glu Lys Ser Asp Val Tyr Ser Phe Gly Val Val Leu Leu Glu

885 890 895

Leu Ile Val Gly Arg Lys Pro Val Gly Glu Phe Gly Asp Gly Val Asp

900 905 910

Ile Val Gly Trp Val Asn Lys Thr Met Ser Glu Leu Ser Gln Pro Ser

915 920 925

Asp Ala Ala Ser Val Leu Ala Val Val Asp Pro Arg Leu Asn Gly Tyr

930 935 940

Pro Leu Gly Ser Val Ile His Met Phe Asn Ile Ala Met Met Cys Val

945 950 955 960

Arg Glu Ile Gly His Ala Arg Pro Thr Met Arg Glu Val Val Tyr Met

965 970 975

Leu Thr Asn Pro Pro Gln Ser Thr Thr His His Asn Leu Ile Asn Leu

980 985 990

Claims (5)

1. one cultivate peanut LRR Receptor-like protein ki-nase genoid, be named asAhRLK6Gene, this gene order such as SEQ ID Shown in No.1.

2. peanut LRR Receptor-like protein ki-nase genoid according to claim 1 it is characterised in that：DescribedAhRLK6 The amino acid sequence of gene code is as shown in SEQ ID No.2.

3. comprise the overexpression vector of peanut LRR Receptor-like protein ki-nase genoid as claimed in claim 1.

4. a kind of construction method of overexpression vector as claimed in claim 3 it is characterised in that：Digestion connects replaces plant expression Gus gene in carrier pBI121-GUSA, builds CaMV 35S promoter and drivesAhRLK6The plant expression vector of gene pBI121-AhRLK6-OE.

5. a kind of peanut LRR Receptor-like protein ki-nase genoid as claimed in claim 1 or the overexpression described in claim 3 Application in tobacco Bacterial wilt resistance gene engineering for the carrier.