CN113512558B

CN113512558B - Method for improving resistance of tomatoes to bacterial wilt

Info

Publication number: CN113512558B
Application number: CN202110430566.8A
Authority: CN
Inventors: 师恺; 丁淑婷; 吕建荣; 王娇; 胡璋健; 喻景权
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2021-04-21
Filing date: 2021-04-21
Publication date: 2022-08-05
Anticipated expiration: 2041-04-21
Also published as: CN113512558A

Abstract

The invention discloses a method for improving the resistance of tomatoes to bacterial wilt, and belongs to the technical field of biology. The invention edits the tomato CDPK18L gene with the nucleotide sequence shown as SEQ ID NO.1 by using CRISPR/Cas9 gene editing technology, silences the expression of tomato CDPK18L gene coding protein, and further obtains a tomato mutant with enhanced bacterial wilt resistance. The mutant can obviously enhance the resistance to the tomato bacterial wilt and can be used for breeding tomato varieties with bacterial wilt resistance.

Description

Method for improving resistance of tomatoes to bacterial wilt

Technical Field

The invention relates to the technical field of biology, in particular to a method for improving the resistance of tomatoes to bacterial wilt.

Background

Tomatoes, belonging to the genus solanum of the family solanaceae, are an important vegetable and commercial crop and are widely cultivated worldwide. The tomato fruit has rich nutrition and delicious taste, and is widely popular. However, in recent years, with the change of agricultural planting modes, a single and high-density planting mode makes tomato disease outbreaks become more serious, and the yield and quality are seriously influenced.

Bacterial wilt is one of the high-incidence diseases, and is caused by Laurella sp. The ralstonia solanacearum is a soil inhabitation bacterium, can live in soil for a long time, is mainly spread in fields through rainwater and irrigation water, and can also be spread in modes of people, livestock, farm implements, bacterium-carrying soil, insects, nematodes and the like, so that repeated infection is caused, and the epidemic spread of the bacterial wilt is caused. The ralstonia solanacearum mainly invades from the wound at the root or the stem of the plant, and is propagated in vascular bundle tissues in the plant body and carries out metabolic activity to cause the blockage of a catheter, so that the nutrient transportation in the plant body is prevented, and finally the plant is wilted to die. Once tomato is infected with bacterial wilt, the tomato can cause the production to be reduced and even the tomato is absolutely harvested, and the harm is extremely great.

Calcium-dependent protein kinase (CDPK) is a calcium-ion-dependent protein kinase belonging to the group of serine/threonine protein kinases and consisting of a protein kinase domain, a self-inhibitory domain and a CaM-like domain (Ludwig A et al, "CDPK-mediated signaling pathways: specific genes and tumors-talk." Journal of Experimental Botany,2004,55(395): 181-.

Previous studies have shown that CDPKs are involved in signaling pathways associated with various biotic and abiotic stresses, and that the mechanisms of action vary. For example, Arabidopsis thaliana CPK3 and CPK13 activate the transcription of PDF1.2 by regulating the heat shock transcription factor HsfB2a, thereby enhancing the resistance of plants to herbivorous insects (Kanchiswamy C.N., et al, "Regulation of Arabidopsis defects responses against Spodopterialatalysis by CPK-mediated calcium signalling," BMC Plant Biology,2010,10: 97). Under the stress of cold damage and salt damage/drought, the expression quantity of the rice CDPK7 gene is increased. Increasing the CDPK7 content can increase the resistance of rice to cold damage and salt damage/drought. Under the stress of salt damage/drought, the expression quantity of genes related to the resistance of over-expressed plants is obviously higher than that of a control, but under the stress of cold damage, the phenomenon does not occur, which shows that the resistance mechanism of CDPK7 to cold damage and salt damage/drought is developed through two independent ways (Saijo Y et al, "Overexpression of a single Ca) ²⁺ "The Plant Journal,2000,23: 319-. The arabidopsis CPK23 negatively regulates the stress resistance, and the resistance of arabidopsis to drought is obviously improved after the arabidopsis CPK23 gene is mutated. After the CPK23 is over-expressed, the stomatal conductance of Arabidopsis thaliana is increased, thereby affecting the resistance to drought (Ma SY, Wu WH.' AtCPK23 functions in Arabidopsis responses to drought and salt stresses.”Plant Molecular Biology,2007,65:511-518)。

Tomato CDPK18L, a member of the CDPKs family, has little research in biological resistance. Therefore, the research on the resistance mechanism of tomato CDPK18L gene to bacterial wilt has theoretical and practical application value.

Disclosure of Invention

The invention aims to provide a gene capable of regulating and controlling resistance of tomatoes to bacterial wilt diseases, and the purpose of improving the resistance of tomatoes to bacterial wilt diseases is achieved through gene modification.

In order to achieve the purpose, the invention adopts the following technical scheme:

the method comprises the steps of firstly carrying out sequence analysis on tomato calcium ion dependent protein kinase CDPK18L (gene number: XM _004232444), searching a PAM sequence, defining a sequence of 20bp before NGG as sgRNA, selecting the sgRNA sequence which is positioned on a gene protein coding region and has high specificity, and further editing the tomato CDPK18L gene by using a gene editing technology to obtain a functional defect type mutation homozygous strain, wherein the strain shows that the resistance to bacterial wilt is remarkably enhanced, and the silencing of the CDPK18L gene has a certain application value in the aspect of improving the resistance of tomato to bacterial wilt.

The invention provides application of a CDPK18L gene with a nucleotide sequence shown as SEQ ID NO.1 in improving bacterial wilt resistance of tomatoes.

The nucleotide sequence of the protein coding region of the CDPK18L gene is shown as SEQ ID NO.1, the length is 1713bp, and the whole gene DNA sequence is shown as SEQ ID NO. 6.

The protein encoded by the CDPK18L gene is calcium ion-dependent protein kinase, consists of 570 amino acids, has a sequence shown in SEQ ID NO.2, belongs to serine/threonine protein kinase, and consists of a protein kinase domain, a self-inhibition domain and a CaM-like domain, and is activated when being combined with calcium ions.

The application comprises the following steps: the expression of tomato CDPK18L gene coding protein is silenced by using a gene editing technology, and then the tomato mutant with enhanced bacterial wilt resistance is obtained.

Further, the tomato CDPK18L gene is silenced by using CRISPR/CAS9 technology. The CRISPR/Cas9 gene editing technology can accurately knock out any gene in a genome, thereby accurately changing the crop character, rapidly obtaining ideal germplasm and greatly shortening the breeding time. Meanwhile, compared with transgenic breeding, exogenous genes can not be introduced when breeding is performed by using the CRISPR/Cas9 gene editing technology. After genome editing is carried out by using the CRISPR/Cas9 technology, plants can be screened out by selfing to obtain a line with an edited target gene and without Cas9, and the use of a transgenic technology for introducing a foreign gene problematically can be avoided in many cases.

The invention also provides two tomato mutants with enhanced bacterial wilt resistance, wherein the sequence of the coding gene of the tomato mutant is the deletion of the 70 th and 71 th bases in the nucleotide sequence shown in SEQ ID NO. 1; the coding gene sequence of the other mutant is the deletion of the 70 th base in the nucleotide sequence shown in SEQ ID NO. 1.

The invention discovers that the content of the free amino acid in the CDPK18L gene mutant plant is obviously increased by measuring the content of the free amino acid in the tomato. The CDPK18L gene is presumed to regulate and control the resistance of tomato bacterial wilt by influencing the content of free amino acid in plants. The regulation and control means that the CDPK18L changes the nitrogen metabolic process in the plant body and weakens the resistance of the plant to bacterial wilt by influencing the content of free amino acid in the plant body.

The invention also provides a breeding method for improving the resistance of tomatoes to bacterial wilt, which comprises the following steps:

(1) selecting a target fragment containing a PAM structure in a CDPK18L protein coding region with a nucleotide sequence shown as SEQ ID NO.1, and designing a primer based on the first 20 bases of the PAM structure of the target fragment to construct a CRIPR/Cas9 vector;

(2) and transforming the CRIPR/Cas9 vector into receptor tomato material, and culturing to obtain homozygous mutant strain which does not contain exogenous Cas9 protein and is stably inherited.

The PAM structure is NGG, and N represents any base.

Further, the first 20 base sequences of the target fragment PAM structure are shown in SEQ ID No.3 and are defined as sgRNA.

In the step (1), the nucleotide sequences of the primers for constructing the CRIPR/Cas9 vector are shown as SEQ ID NO.4 and SEQ ID NO. 5. Annealing the primer into double strands to construct a CRIPR/Cas9 vector.

In the step (2), the CRIPR/Cas9 vector is transformed into tomato cotyledons by using an agrobacterium-mediated technology.

Specifically, the recipient tomato is tomato conditioner Red.

The invention has the following beneficial effects:

the tomato CDPK18L gene editing mutant is obtained by using a CRISPR/Cas9 gene editing technology, can remarkably enhance the resistance to tomato bacterial wilt, and can be used for breeding bacterial wilt-resistant tomato varieties.

Drawings

FIG. 1 shows the gene editing sites of T1 generation mutant plants obtained in example 2;

compared with common tomatoes which are not subjected to gene editing, the gene editing mutant has base deletion at the position of sgRNA, the common tomatoes which are not subjected to gene editing are called a control, CDPK18L #1 has two base deletion compared with the control, and CDPK18L #2 has one base deletion compared with the control.

FIG. 2 is a histogram of disease index of control and CDPK18L gene mutant tomatoes inoculated with Ralstonia solanacearum in example 3;

wherein, the more serious the disease, the higher the disease index; the disease index of the control plant is obviously higher than that of the mutant plant; the lower case letters a, b represent significant differences between different plants at the 5% level.

FIG. 3 is a diagram showing the plants of example 3 after the control and CDPK18L gene mutant tomato is inoculated with Ralstonia solanacearum;

the higher the leaf wilting degree, the more serious the disease.

FIG. 4 is a graph showing the variation of free amino acid content in the CDPK18L gene mutant and control tomatoes of example 4.

Detailed Description

The present invention will be further described with reference to the following specific examples, which are only illustrative of the present invention, but the scope of the present invention is not limited thereto. Unless otherwise specified, the technical means used in the examples are well known to those skilled in the art, and the raw materials and kits used are commercially available.

The tomato variety used in the examples below was tomato conventional variety CR (tomato Red), and ordinary tomatoes not having been subjected to gene editing were used as controls.

Example 1 construction of CRISPR/Cas9 vector containing specific sgRNA

The DNA sequence of CDPK18L (XM _004232444) was found at NCBI website https:// www.ncbi.nlm.nih.gov/, the sequence of which is shown in SEQ ID NO.6, and inputhttp://crispr.hzau.edu.cn/cgi-bin/ CRISPR2/CRISPRWebsite, find onscore score high and GC content>40% of the sequence CACGGCGGCGGTATTTGTGG (SEQ ID NO.3) located 20bp before the PAM structure in the protein coding region.

CRISPR primers were designed as follows:

GATTGCACGGCGGCGGTATTTGTGG for CRISPR pre-primer (SEQ ID NO. 4);

AAACCCACAAATACCGCCGCCGTGC as a CRISPR rear primer (SEQ ID NO. 5);

and (3) taking 5 mu l of each CRISPR (clustered regularly interspaced short palindromic repeats) front primer and rear primer, uniformly mixing, and annealing into a double chain by using a PCR (polymerase chain reaction) instrument. The intermediate vector pMD18-T is subjected to single enzyme digestion by BbsI, purified by a common DNA purification kit, and then the double strand and the vector are connected by T4 ligase and are connected overnight at 16 ℃. The plates were heat-treated at 42 ℃ to transform them into ampicillin resistance.

Monoclonal colonies were picked and screened using CRISPR pre-primer (SEQ ID No.4): GATTGCACGGCGGCGGTATTTGTGG and post-vector primer (SEQ ID NO. 7): CTACTTATCGTCATCGTCTTTG, PCR verification was performed.

And (3) sending the bacterial liquid with the correct band size to a sequencing company for sequencing, wherein the sequencing result shows that the vector contains a sgRNA sequence, the quality-improved particles are subjected to double enzyme digestion by Hind III and Kpn I, and then are connected to a final vector pCAMBIA 1301. And a sequencing result shows that the final vector contains sgRNA, the obtained final plasmid is electrically shocked into a GV3101 agrobacterium infected state, and spots are picked for PCR verification after two-day culture at 28 ℃ to obtain the agrobacterium strain which can be used for constructing the CRISPR/Cas9 gene editing material.

Example 2 CDPK18L Gene mutant Material preparation and characterization

The sterilized tomato seeds were sown in the sowing medium, and the cotyledons were cut 7 days later. The final plasmid prepared in example 1 is transformed into cotyledons by an agrobacterium infection method, and T is obtained by utilizing totipotency of plant cells ₀ Tomato is edited by generation genes.

T ₀ And (5) carrying out generation gene editing tomato seedling detection. Extraction of T by CTAB method ₀ And (3) generating genome DNA of a plant, taking the genome DNA as a template, designing the following primers at about 200bp before and after the DNA sequence containing the sgRNA, and performing PCR amplification sequencing verification:

GAGGGCTTATGGTTTTCTTC for the pre-verification primer (SEQ ID No.8)

Verified primers (SEQ ID No.9): CAATTCTCTTGACAGCCACA

The obtained PCR product was sent to sequencing company for sequencing. Comparing the sequencing result with the gene original sequence by using DNAMAN software, selecting a plant with sgRNA sequence subjected to base deletion and sequencing to display a single peak, and performing self-cross breeding to obtain T ₀ Seeds of generations.

Above T ₀ Planting seeds in growth chamber to obtain T ₁ And (5) plant generation. Detection of T Using the same method as described above ₁ Base editing condition of sgRNA sequence of generation plant. Meanwhile, the CRISPR pre-primer (SEQ ID NO.4) and the carrier post-primer (SEQ ID NO.7) are used for carrying out T pair ₁ And carrying out PCR amplification on DNA of the generation plants to detect whether the DNA contains a Cas9 sequence. Selecting T with sgRNA variation and without Cas9 protein ₁ The generation plants, two lines determined as gene-editing plants, were named CDPK18L #1 and CDPK18L #2, respectively, and the gene-editing sites thereof are shown in FIG. 1. CDPK18L #1 lacks two bases compared to control plants and CDPK18L #2 lacks one base compared to control plants. The two strains T ₁ After seed generation sowing, stably inherited T which does not contain exogenous gene Cas9 and has sgRNA variation is obtained ₂ And (5) plant generation.

The following examples all use the two homozygous lines T described above ₂ The plants were used as material for the experiments.

Example 3 investigation of disease resistance of CDPK18L Gene editing mutants

The ralstonia solanacearum strain is inoculated on a solid propagation culture medium, and is activated after being cultured in a constant temperature incubator at 28 ℃ for 2 days to be used as a raw plate. Dipping viscous milky white bacterial liquid with fluidity from the original plate by using a transplanting ring on a new solid propagation culture medium, and culturing for 1 day in a constant temperature incubator at 28 ℃. Resuspend the broth with sterile water and resuspend the OD ₆₀₀ Adjusted to 1.0. 50ml of bacterial liquid is filled into the root of each tomato, and the tomato is placed at 25 ℃, the relative humidity of 95 percent air, 12 hours of illumination and 12 hours of darkness and the light intensity is 200 mu mol m ^-2 s ^-1 After culturing for 10 days in the environment of (1), observing the disease condition of the plants. The disease symptoms of the plants are classified into five grades of 0,1, 2, 3 and 4, and the grading standard is as follows: level 0, leaves are normal without wilting; grade 1, wilting of 1% -25% of leaves; grade 2, 26% -50% of leaves are wilted; grade 3, 51% -75% of leaves are wilted; grade 4, 76% -100% of the leaves will wilt.

As can be seen from fig. 2 and 3, the CDPK18L mutant can significantly improve the resistance to bacterial wilt.

Example 4 determination of free amino acid content in CDPK18L mutant and control tomato

Adding 200 μ l H into 60mg of tomato leaf of one month seedling age ₂ Homogenizing O, adding 800 μ l methanol acetonitrile solution (1:1, v/v), standing at-20 deg.C for 1 hr to precipitate protein, filtering, centrifuging at 14000g for 20min, collecting supernatant, freeze drying, and storing at-80 deg.C. Samples were separated using an Agilent 1290Infinity LC ultra performance liquid chromatography system. Mass spectrum analysis is carried out by using a 5500QTRAP mass spectrometer (AB SCIEX) in a positive ion mode, and the ion pair to be detected is detected by using an MRM mode. Chromatographic peak area and retention time were extracted using Multiquant software. And correcting retention time by using the standard substance of the amino acid and the derivative to identify the metabolite.

As shown in fig. 4, the content of free amino acids in CDPK18L mutant was significantly increased compared to the control plants, and nitrogen metabolism was altered in vivo.

Sequence listing

<110> Zhejiang university

<120> a method for improving resistance of tomato to bacterial wilt

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1713

<212> DNA

<213> tomato (Solanum lycopersicum)

<400> 1

atgggcaaca tatgtttttc tagctcaaaa gttagtggtt ctaacagcaa caccccttcc 60

accaccacca caaataccgc cgccgtgaat ggccaccgta atcggcggag ctcagcgaac 120

ccggtttctg caacaacaaa tacatcaaga aaacaagagg ggtctcatta caatcgacag 180

aaaggtaagg ataacggtgg ggttaagcaa caaacgagaa attctcagaa aaatgttaag 240

cataatacga ggaagcaaag tgggattatt ccttgtggga aaagaacgga ttttgggtat 300

gataaagatt ttgataacaa gtttacaatc ggaaagttgt tgggtcatgg acaatttgga 360

tacacatatg ttgcaacaga caagtctaat ggaaatcgtg tggctgtcaa gagaattgaa 420

aagaaaaaga tggttgttcc aattgcagtt gaggatgtaa aacgagaagt caagatattg 480

aaggccttag ccggtcacga gaatgtagtt gatttctata atgcatttga ggatgataac 540

tatgtttaca tagtaatgga gttatgtgag ggtggagaac tgttggaccg cattttggcc 600

aaaaaggaca gccgttatac cgagaaagat gcagcaatag ttgtcggtca gatgttaaaa 660

gttgccgctc agtgtcactt acatggattg gtgcatcgtg atatgaaacc tgagaatttt 720

ctctttaaat cttcaaagga ggactcatca ttaaaggcca cagattttgg tctttcagac 780

ttcataagac cagggaagaa attccaagat atagttggaa gtgcatatta cgtagcccca 840

gaggtattaa agcgtaaatc tggacctgaa tcagatgtgt ggagcattgg cgtaattaca 900

ttcattttac tttgtggtcg tcggcccttc tgggataaaa cagaggatgg catattcaag 960

gaggtcttac gaaacaaacc tgattttcgt cgcaagccat ggccaactat aagcaacagt 1020

gctaaagatt ttgttaagaa attattggtg aaagatcctc gtgctagact tactgctgcc 1080

caggccctgt cacatccatg ggtccgtgaa ggaggtgatg catctgagat tccactagac 1140

atatctgtct tgtccaacat gcggcaattt gtcaaataca gtcgattaaa gcaatttgca 1200

ttacgggcat tggctagcac acttgatgag gaggagctgg cagatgtccg ggaccagttt 1260

tctgcaattg atgtggataa aaatggtgtt attagccttg aagaaatgag acaggccctt 1320

gccaaggatc tcccctggaa gatgaaagaa tcgcgggttc ttgagattct tcaagcgatt 1380

gatagtaaca cagacgggct tgttgatttc ccggagtttg ttgcagcgac tctacatgtg 1440

catcagttag aggagcataa tttgttaaaa tggcagcaaa gatcgcaaac tgcttttgag 1500

aaatttgacg ttgatagaga tggattcata actccagaag aacttagaat gcataccggc 1560

ttaaaaggct ctatagaccc attgctcgaa gaagcagata tcgacaaaga tggaaagata 1620

agcttatcag aattccggag gcttctaaga actgcaagta taagttcgcg aatggtgaat 1680

agtccaacgg tcagaggctc tcgcaaaatt tag 1713

<210> 2

<211> 570

<212> PRT

<213> tomato (Solanum lycopersicum)

<400> 2

Met Gly Asn Ile Cys Phe Ser Ser Ser Lys Val Ser Gly Ser Asn Ser

1 5 10 15

Asn Thr Pro Ser Thr Thr Thr Thr Asn Thr Ala Ala Val Asn Gly His

20 25 30

Arg Asn Arg Arg Ser Ser Ala Asn Pro Val Ser Ala Thr Thr Asn Thr

35 40 45

Ser Arg Lys Gln Glu Gly Ser His Tyr Asn Arg Gln Lys Gly Lys Asp

50 55 60

Asn Gly Gly Val Lys Gln Gln Thr Arg Asn Ser Gln Lys Asn Val Lys

65 70 75 80

His Asn Thr Arg Lys Gln Ser Gly Ile Ile Pro Cys Gly Lys Arg Thr

85 90 95

Asp Phe Gly Tyr Asp Lys Asp Phe Asp Asn Lys Phe Thr Ile Gly Lys

100 105 110

Leu Leu Gly His Gly Gln Phe Gly Tyr Thr Tyr Val Ala Thr Asp Lys

115 120 125

Ser Asn Gly Asn Arg Val Ala Val Lys Arg Ile Glu Lys Lys Lys Met

130 135 140

Val Val Pro Ile Ala Val Glu Asp Val Lys Arg Glu Val Lys Ile Leu

145 150 155 160

Lys Ala Leu Ala Gly His Glu Asn Val Val Asp Phe Tyr Asn Ala Phe

165 170 175

Glu Asp Asp Asn Tyr Val Tyr Ile Val Met Glu Leu Cys Glu Gly Gly

180 185 190

Glu Leu Leu Asp Arg Ile Leu Ala Lys Lys Asp Ser Arg Tyr Thr Glu

195 200 205

Lys Asp Ala Ala Ile Val Val Gly Gln Met Leu Lys Val Ala Ala Gln

210 215 220

Cys His Leu His Gly Leu Val His Arg Asp Met Lys Pro Glu Asn Phe

225 230 235 240

Leu Phe Lys Ser Ser Lys Glu Asp Ser Ser Leu Lys Ala Thr Asp Phe

245 250 255

Gly Leu Ser Asp Phe Ile Arg Pro Gly Lys Lys Phe Gln Asp Ile Val

260 265 270

Gly Ser Ala Tyr Tyr Val Ala Pro Glu Val Leu Lys Arg Lys Ser Gly

275 280 285

Pro Glu Ser Asp Val Trp Ser Ile Gly Val Ile Thr Phe Ile Leu Leu

290 295 300

Cys Gly Arg Arg Pro Phe Trp Asp Lys Thr Glu Asp Gly Ile Phe Lys

305 310 315 320

Glu Val Leu Arg Asn Lys Pro Asp Phe Arg Arg Lys Pro Trp Pro Thr

325 330 335

Ile Ser Asn Ser Ala Lys Asp Phe Val Lys Lys Leu Leu Val Lys Asp

340 345 350

Pro Arg Ala Arg Leu Thr Ala Ala Gln Ala Leu Ser His Pro Trp Val

355 360 365

Arg Glu Gly Gly Asp Ala Ser Glu Ile Pro Leu Asp Ile Ser Val Leu

370 375 380

Ser Asn Met Arg Gln Phe Val Lys Tyr Ser Arg Leu Lys Gln Phe Ala

385 390 395 400

Leu Arg Ala Leu Ala Ser Thr Leu Asp Glu Glu Glu Leu Ala Asp Val

405 410 415

Arg Asp Gln Phe Ser Ala Ile Asp Val Asp Lys Asn Gly Val Ile Ser

420 425 430

Leu Glu Glu Met Arg Gln Ala Leu Ala Lys Asp Leu Pro Trp Lys Met

435 440 445

Lys Glu Ser Arg Val Leu Glu Ile Leu Gln Ala Ile Asp Ser Asn Thr

450 455 460

Asp Gly Leu Val Asp Phe Pro Glu Phe Val Ala Ala Thr Leu His Val

465 470 475 480

His Gln Leu Glu Glu His Asn Leu Leu Lys Trp Gln Gln Arg Ser Gln

485 490 495

Thr Ala Phe Glu Lys Phe Asp Val Asp Arg Asp Gly Phe Ile Thr Pro

500 505 510

Glu Glu Leu Arg Met His Thr Gly Leu Lys Gly Ser Ile Asp Pro Leu

515 520 525

Leu Glu Glu Ala Asp Ile Asp Lys Asp Gly Lys Ile Ser Leu Ser Glu

530 535 540

Phe Arg Arg Leu Leu Arg Thr Ala Ser Ile Ser Ser Arg Met Val Asn

545 550 555 560

Ser Pro Thr Val Arg Gly Ser Arg Lys Ile

565 570

<210> 3

<211> 20

<212> DNA

<213> tomato (Solanum lycopersicum)

<400> 3

cacggcggcg gtatttgtgg 20

<210> 4

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gattgcacgg cggcggtatt tgtgg 25

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aaacccacaa ataccgccgc cgtgc 25

<210> 6

<211> 5386

<212> DNA

<213> tomato (Solanum lycopersicum)

<400> 6

agagaaaatg ttaaatatag aaaatcaaaa gtaagaaatt gcaaatattc tccctccatt 60

cttccatgct gaaaataaaa aataagaggg cttatggttt tcttcaaaat aaaaaaagta 120

tgtttttgac cattagcatg gtccatcacc tcctgtctct tcttcctttc ttcctcttcc 180

tatttcctat aatctttcat cttttaatta attttccctc ttttctattc tccctatatt 240

atccataatc ttgattcttg attttttgtt tcaaacatct gaaaattttc aactttgagg 300

attttaatca tatatcataa tgggcaacat atgtttttct agctcaaaag ttagtggttc 360

taacagcaac accccttcca ccaccaccac aaataccgcc gccgtgaatg gccaccgtaa 420

tcggcggagc tcagcgaacc cggtttctgc aacaacaaat acatcaagaa aacaagaggg 480

gtctcattac aatcgacaga aaggtaagga taacggtggg gttaagcaac aaacgagaaa 540

ttctcagaaa aatgttaagc ataatacgag gaagcaaagt gggattattc cttgtgggaa 600

aagaacggat tttgggtatg ataaagattt tgataacaag tttacaatcg gaaagttgtt 660

gggtcatgga caatttggat acacatatgt tgcaacagac aagtctaatg gaaatcgtgt 720

ggctgtcaag agaattgaaa agaaaaaggt tttttttttc tttccccatc ctctgctata 780

tctaattctt atggagttgt gtagtgcacc aaatttggaa tctgtgaaaa tttctgttca 840

atcctaatta taggttcaac tatttcttct ttaattattt ttaaatgtct tttgactttg 900

gttgactcag aagaatatac attaactact gaattgcgaa ttcacatgct ttatcctttc 960

tgtttttagt tcatgtctct gtttatttgg ttcaatcagt gtatttgttt agcttttgcg 1020

gttacaaaat actatcttct gctaatcttg aaataccaat ttaagttgtt gttaattttt 1080

aatggattgc taactggtga agctgtgctt tttaagagac ataaatatat cgaaaactat 1140

aggtttatgg aagctgtttg gttaattatg atggttgtgg ttctaagcat tgacatatag 1200

gaacacctaa cactggacct tagttttctg tgattagtgc tgcttgttgt tattatgtac 1260

agttaaatgg aaaatggctt ccttgcctgg tttagagaga gtcagttttt aatcaatagg 1320

tagtggtagc ttctttggtt ttctgatgaa tggacttatc tgaaagtgac tgcacaagtc 1380

ttggttattg atgcatgacg caactattta gttcgtcatc ggcttctatg gagaataact 1440

cttctttaag gtttgtccaa ctttgtctcc tattatctct gcacaccagt tatgatgtgt 1500

tcatccttct ggaatgatgg ggttattcat gcaaataaga atatttgcgg aagtttcttt 1560

tttagaagct tgttaagttt tatactattt ttgcataatc aattgcctta tcttgaactt 1620

cttgatgttc cagtttatta caactatagc ataactctag tgaatcattg cagatggttg 1680

ttccaattgc agttgaggat gtaaaacgag aagtcaagat attgaaggcc ttagccggtc 1740

acgagaatgt agttgatttc tataatgcat ttgaggatga taactatgtt tacatagtaa 1800

tggagtaagt ttcgttatta agagctctgt atggattcgt caggtcatag ttctttcctt 1860

acaatcgatt atgctaatct aaaggaaagt tgattgatta caaatttgtt ttcctgtagg 1920

ttatgtgagg gtggagaact gttggaccgc attttggcca agtaagtagt ataaaccagg 1980

tttacttaat atcgtgattt gtggtgcttg ctctataatt tatttcttgt taagaagaat 2040

acttatgtaa gttatcaatg atttcctttg attagaaagg acagccgtta taccgagaaa 2100

gatgcagcaa tagttgtcgg tcagatgtta aaagttgccg ctcagtgtca cttacatgga 2160

ttggtgcatc gtgatatgaa acctgaggtt tgcaagaagt tatgtacttc ctttggttta 2220

ctaatgctgc tttatgtttc ttctcttaca cacatttctt ttcttgtaga attttctctt 2280

taaatcttca aaggaggact catcattaaa ggccacagat tttggtcttt cagacttcat 2340

aagaccaggt gattggatgt ccacaaatct actcaatgac atattttagt ttaaactcat 2400

ttttcgtatt tgagtaaaga tctttttgct atggtgtatg aacttcaatt cttcataaat 2460

ctgttaaagc cgtcaaagat gtttttggtt cttccttaga tagcaaaaac ttataacttt 2520

aaatcaataa atgcagggaa gaaattccaa gatatagttg gaagtgcata ttacgtagcc 2580

ccagaggtat taaagcgtaa atctggacct gaatcagatg tgtggagcat tggcgtaatt 2640

acattcattt tactttgtgg tcgtcggccc ttctgggata aaacagagga tggcatattc 2700

aaggaggtga gctgctaata tttattctta tagctctgca gctgggcaac attttaaatt 2760

gtgattcttt cttggaaatt tgtggaattg tgttatgatc tttaagctct tctaggaaat 2820

aaactttgta ttctgtcaaa gtggcatatt taccaatatt aactttaata cattttaaaa 2880

aattgcataa ttctctgtct gattagccaa ttttacattt gagatttcaa aattttactc 2940

caaatatggt actgatgatg aatctcctgt atagttttgc tttattattc ttagttcttg 3000

attagcttag tctgcattcc atagttggta ttgaaatttc ttaaacctga aattttcttg 3060

ttctcttttg agttcattga agctacggct gtatctttga atttgggttg ttggttattt 3120

aaataaaatc ttattcgaat gtgttattta attcctttga gaagtgtaac ttgttcattg 3180

tcatgtttga tgaagtattt gtgcttttag ctgatttagt attgtttata actccgcttc 3240

tactatgcta aggtcttacg aaacaaacct gattttcgtc gcaagccatg gccaactata 3300

agcaacagtg ctaaagattt tgttaagaaa ttattggtga aagatcctcg tgctagactt 3360

actgctgccc aggccctgtg taagtaatta tattctgatt tagtacaatc tttttaagtg 3420

atgattacgt tttacaatta cgaagcatga ttatcggaga agtaactcaa ggtccaaaag 3480

attcatatac tgaatttgtc aattttgatt cggcaacttc attagcaatg tgttggatgt 3540

ccatttatca attcttgcta tatagtccat gcttctgcta aatttcaaat aattatattg 3600

aataattttc attgttttca cttaattaga tgttactggt attctcgtga cctttgaatt 3660

gatgatgcaa taaatggtag ttttttcata ctgatatata tgaacatttc agcacatcca 3720

tgggtccgtg aaggaggtga tgcatctgag attccactag acatatctgt cttgtccaac 3780

atgcggcaat ttgtcaaata cagtcgatta aagcaatttg cattacgggt aacttcatag 3840

ctttcttact ttcataaaaa gtagagaaca ttaacttcat gcaatttcat tatctggcag 3900

gcattggcta gcacacttga tgaggaggag ctggcagatg tccgggacca gttttctgca 3960

attgatgtgg ataaaaatgg tgttattagc cttgaagaaa tgagacaggt atttccctta 4020

tttcatggtc tagttagttt cttcctgtac agtttctcta agtttctggc taacatcgta 4080

agcacttata ttcctgtctt tgcaacaaag cattgtgtaa tataatgtca tttatgttat 4140

cacttatgac acccaattct aatgcaggcc cttgccaagg atctcccctg gaagatgaaa 4200

gaatcgcggg ttcttgagat tcttcaagcg gtaagctaat atatttagga atgaaagtat 4260

atcactataa taatatggca tgtaagatca agttattact atgaaatacc ttctataacg 4320

tcaagctggg acgtgtgttt gcaaccaatt tagtccctac tcctatgaaa gggaataagg 4380

aaagaaaagg actaacgcac ctaagagcca tccacaaaaa ggaaaaagcg aagatgaaaa 4440

ggaatgtgat gtctgtcaca tagtagttct gtaaatttcc ggcttatgag tccatgcgat 4500

aatctgaggg tttactcaat gattgcaaac gctttttatc tgcctgtgta tactgcattt 4560

cctacagttg aagcattttg ttcattgatt tttcagattg atagtaacac agacgggctt 4620

gttgatttcc cggagtttgt tgcagcgact ctacatgtgc atcagttaga ggagcataat 4680

ttgttaaaat ggcagcaaag atcgcaaact gcttttgaga aatttgacgt tgatagagat 4740

ggattcataa ctccagaaga acttagaatg gttagtatgt cgtattttct tgttcaagtg 4800

atcaacactg ttgtatatat aaattctagc tttcaaatcc tacagagcgt gattttttta 4860

ttcttagatt gaattaaaga taaaacaaaa tattcatatg tggcttttac ttgtatgcag 4920

cataccggct taaaaggctc tatagaccca ttgctcgaag aagcagatat cgacaaagat 4980

ggaaagataa gcttatcaga attccggagg cttctaagaa ctgcaagtat aagttcgcga 5040

atggtgaata gtccaacggt cagaggctct cgcaaaattt agtcagagat gtgaaagtta 5100

tccatgagaa aaaaccaact tcatttacat gttctcatgt gatgtgctgc tgcaattctg 5160

tatgtagagt tttgccagaa aaggaagttg ctttctccta aacaaccagc agcaattaag 5220

gtttgtagca tacattcttt gtcacttttt ctggggttct ctttgagtat gtatgtatgt 5280

atgtaatagc acctcattaa tgataaatca taaaagtata catgtatcac cttttttgaa 5340

cttgtcatta tgtaacaaac aaacaaaaaa acttttggcc catgca 5386

<210> 7

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ctacttatcg tcatcgtctt tg 22

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gagggcttat ggttttcttc 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

caattctctt gacagccaca 20

Claims

1. The nucleotide sequence is shown as SEQ ID NO.1CDPK18LThe application of the gene in improving bacterial wilt resistance of tomato is characterized by comprising the following steps: silencing tomato by gene editing technologyCDPK18LExpressing the gene coding protein to obtain the tomato mutant with enhanced bacterial wilt resistance.

2. Use according to claim 1, for treating tomato using CRISPR/CAS9 technologyCDPK18LThe gene is silenced.

3. Use according to claim 1, wherein the tomato mutant is a tomato mutantCDPK18LThe nucleotide sequence of the coding gene is that the 70 th and 71 th bases are deleted or the 70 th base is deleted compared with the nucleotide sequence shown as SEQ ID NO. 1.

4. A breeding method for improving the resistance of tomatoes to bacterial wilt, which is characterized by comprising the following steps:

5. The method for breeding tomato with improved resistance to bacterial wilt according to claim 4, wherein the first 20 base sequences of the PAM structure of the target fragment are shown as SEQ ID No. 3.

6. The breeding method for improving the bacterial wilt resistance of tomato as claimed in claim 5, wherein the nucleotide sequence of the primer for constructing the CRIPR/Cas9 vector is shown as SEQ ID No.4 and SEQ ID No. 5.

7. A method as claimed in claim 4, wherein in step (2), the CRIPR/Cas9 vector is transformed into tomato cotyledons by Agrobacterium-mediated transformation.

8. The method of claim 4, wherein the recipient tomato is tomato conditioner Red.