CN113999863B

CN113999863B - Method for improving water utilization efficiency of tomato crops

Info

Publication number: CN113999863B
Application number: CN202111283433.9A
Authority: CN
Inventors: 师恺; 王萍; 丁淑婷; 王娇; 喻景权
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2021-11-01
Filing date: 2021-11-01
Publication date: 2024-01-05
Anticipated expiration: 2041-11-01
Also published as: CN113999863A

Abstract

The invention discloses a method for improving water utilization efficiency of tomato crops, and belongs to the technical field of biology. The method specifically comprises the step of knocking out or silencing the SlALD1 gene in tomato crops. The tomato Slald1 gene mutant is obtained by using a CRISPR/Cas9 gene editing technology, and the mutant can be found to remarkably improve the water utilization efficiency of plants, enhance the drought resistance and can be used for breeding tomato germplasm with high water utilization efficiency.

Description

Method for improving water utilization efficiency of tomato crops

Technical Field

The invention relates to the technical field of biology, in particular to a method for improving the water utilization efficiency of tomato crops.

Background

Tomato (Solanum lycopersicum l.) is one of the most widely cultivated vegetables and commercial crops in the world, belonging to the genus solanum of the family solanaceae. The lycopene-rich health-care food is delicious in taste, is rich in lycopene with an antioxidant health-care function, and is widely favored by consumers. However, tomato plants are relatively tall and bear fruits in continuous flowering, and the water demand is higher than that of common green leaf vegetables, and is sensitive to soil moisture conditions.

As global climate warms, regional rainfall differences, poor drainage, etc., fresh water resources become increasingly scarce. Drought is becoming one of the most serious environmental challenges facing sustainable development of agriculture. Drought stress alters various physiological, biochemical and morphological characteristics of tomato plants. Drought usually results in closed leaf stomata, significant inhibition of photosynthesis, cytoplasmic membrane damage, oxidative stress due to excessive reactive oxygen species, leaf wilting, stem elongationLimited, flower and fruit dropping, etc., seriously affecting the growth of tomatoes and the yield and quality of fruits. Tomatoes, once subjected to drought stress, can lead to reduced yields and even to sterilization, with a great deal of harm. Therefore, it is important to cultivate drought-resistant tomato plants with higher water utilization efficiency to minimize the yield loss caused by drought. The plant water utilization efficiency refers to the CO fixed by the water consumption unit mass of the plant ₂ The amount of (or dry matter produced), i.e. the ratio of the rate of assimilation of photosynthetic carbon to the rate of transpiration during physiological activity of the plant, reflects the water consumption of the plant and the adaptability to the conditions of water deficit. The water utilization efficiency calculation formula of the single plant: plant water utilization efficiency = biomass/water consumption. The water utilization efficiency of plants is gradually becoming an important criterion for drought resistance and water conservation of crops at present. Therefore, the creation of germplasm resources with high water utilization efficiency plays an important role in the growth and development of tomato plants with large water demand.

Arabidopsis ALD1 is a transaminase AGD 2-type defensin 1, capable of removing alpha-amino groups in L-lysine, and catalyzing synthesis of Pipecolic acid (Pip) (Biochemical principles and functional aspects of Pipecolic acid biosynthesis in Plant immunity, plant Physiol, 2017.). The synthetic pathways for pipecolic acid are conserved across species and the same signaling pathway is found in tomato (An engineered pathway for N-hydroxy-pipecolic acid synthesis enhances systemic acquired resistance in tomato, science Signaling, 2019.). In recent years, piperidine acid has been studied extensively as a newly discovered substance capable of significantly improving the resistance of plants to pathogenic bacteria, and its biosynthesis and downstream hydroxylation modification pathways have been studied more clearly (Flavin monooxygenase-generated n-hydroxypipecolic acid is a critical element of plant systemic immunity, cell, 2018.), but there are few reports on its resistance to abiotic stress. Tomato SlALD1 gene was homologous aligned from Arabidopsis ALD1 gene, the biosynthetic pathway of pipecolic acid was equally conserved in tomato, but there was no study about it in drought resistance.

In recent years, rapid gene editing technology, namely regular clustered interval short palindromic repeats (CRISPR)/CRISPR related protein 9 (Cas 9), is highly valued by people, and becomes the hottest gene editing system at present. The CRISPR/Cas9 gene editing technology can specifically identify target sites, so that target genes can be edited at fixed points, gene knockout materials are obtained, offspring can be subjected to selfing screening to obtain target genes, and strains which do not contain Cas9 can be edited, so that the transgenic technology which is quite controversial at present and introduces exogenous genes is avoided. The CRISPR/Cas9 gene editing technology precisely knocks out genes, so that the characters of crops are precisely changed, ideal germplasm is rapidly obtained, and the problems of long period, uncontrollable results and the like of the traditional hybridization breeding are greatly improved.

Disclosure of Invention

The invention provides a method for improving the water utilization efficiency of tomato crops, which provides a basis for cultivating tomato varieties with high water utilization efficiency.

The invention provides application of a SlALD1 gene in improving water utilization efficiency of tomato crops, wherein the nucleotide sequence of a protein coding region of the SlALD1 gene is shown as SEQ ID NO.1, the length of the protein coding region is 1311bp, and the DNA sequence of a whole gene is shown as SEQ ID NO. 6.

Furthermore, the invention also provides application of the protein coded by the SlALD1 gene in improving the water utilization efficiency of tomato crops, and the amino acid sequence of the protein coded by the SlALD1 gene is shown as SEQ ID NO. 2.

The protein coded by the SlALD1 gene is an enzyme for mediating the biosynthesis of the pipecolic acid, consists of 436 amino acids and is a transaminase.

The invention firstly carries out homologous sequence alignment on an arabidopsis ALD1 gene (gene number: AT2G13810, TAIR website "https:// www.arabidopsis.org/") to obtain the SlALD1 gene (gene number: XM_004250704.4, NCBI website "https:// www.ncbi.nlm.nih.gov/") with the highest homology in tomatoes. The sequence analysis is carried out on the SlALD1 gene through a CRISPR P2.0 website (http:// CRISPR. Hzau. Edu. Cn/CRISPR2 /), the PAM sequence is searched, the sequence of 20bp before NGG is defined as sgRNA, the sgRNA coding sequence which is positioned on a gene protein coding region and has high specificity is selected, and the DNA sequence of the sgRNA of the specific targeting SlALD1 gene protein coding region is shown as SEQ ID NO. 3.

The invention also provides a method for improving the water utilization efficiency of the tomato crops, in particular to a method for knocking out or silencing the SlALD1 gene in the tomato crops.

Preferably, the nucleotide sequence of the protein coding region of the SlALD1 gene is shown as SEQ ID NO. 1.

Specifically, the method comprises the following steps:

(1) Selecting a target fragment for gene knockout from a protein coding region of the tomato SlALD1 gene, designing a primer, and constructing a vector for knockout of the SlALD1 gene;

(2) Constructing agrobacterium genetically engineered bacteria containing the vector for knocking out the SlALD1 gene in the step (1);

(3) And (3) transforming the agrobacterium genetic engineering bacteria in the step (2) into tomato crop cells, and culturing to obtain a homozygous mutant strain which does not contain exogenous proteins and is stably inherited.

Preferably, the vector for knocking out the SlALD1 gene is a CRISPR/Cas9 vector.

Further, the nucleotide sequence of the upstream primer for constructing the CRISPR/Cas9 vector is shown as SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 5.

Specifically, the target fragment for gene knockout is a target fragment containing a PAM structure, and the nucleotide sequence of the first 20 bases of the PAM structure of the target fragment is shown as SEQ ID NO. 3.

Preferably, the agrobacterium is agrobacterium GV3101.

According to the invention, the content of hydrogen peroxide in the Slald1 gene mutant plants is found by measuring the hydrogen peroxide content of tomato leaves, and the hydrogen peroxide content in the plants is obviously reduced compared with that in control plants under drought conditions.

Further, the gene regulates and controls the resistance of tomatoes to drought by affecting the content of hydrogen peroxide in plants.

The regulation refers to that the SlALD1 gene changes the active oxygen steady state in a plant body by influencing the hydrogen peroxide content in the plant body, and weakens the drought resistance of the plant.

According to the invention, the water utilization efficiency of plants under the condition of long-term moderate water deficiency is detected, and the Slald1 gene mutant can obviously improve the water utilization efficiency of the plants.

Compared with the prior art, the invention has the following beneficial effects:

the tomato Slald1 gene mutant is obtained by using a CRISPR/Cas9 gene editing technology, and the mutant can be found to remarkably improve the water utilization efficiency of plants, enhance the drought resistance and can be used for breeding tomato germplasm with high water utilization efficiency.

Drawings

FIG. 1 is a gene editing locus diagram of a T1 generation mutant plant obtained in example 2, in which Slald1#1 lacks one base as compared to the control and Slald1#2 lacks 91 bases as compared to the control.

FIG. 2 is a plant map of control and Slald1 gene mutant tomatoes under drought stress.

Fig. 3 is a graph of conductivity under drought stress for control and Slald1 gene mutant tomatoes, wherein lower case letters a, b represent significant differences between the different plants at the 5% level.

FIG. 4 is a graph showing the change in hydrogen peroxide content in control and Slald1 gene mutant tomatoes.

FIG. 5 is a graph showing the water utilization efficiency of control group and Slald1 gene mutant tomato under the condition of moderate water deficiency for a long period.

Detailed Description

The invention will be further described with reference to the following examples, which are given by way of illustration only, but the scope of the invention is not limited thereto. Unless otherwise indicated, all technical means used in the examples are well known to those skilled in the art, and all raw materials and kits are commercially available.

The background of the genetically edited tomato used in the examples below was tomato regular wild type variety CR (Condine Red), with CR tomato not genetically edited as a control.

Example 1

Construction of CRISPR/Cas9 vectors containing specific sgrnas.

(1) The DNA sequence of the SlALD1 gene (GenBank: XM_ 004250704.4) is found on NCBI website "https:// www.ncbi.nlm.nih.gov/", the sequence of which is shown as SEQ ID NO.6, and the "http:// CRISPR. Hzau. Edu. Cn/cgi-bin/CRISPR2/CRISPR" website is input to find out that the on score is high, the GC content is more than 40%, and the 20bp base sequence (SEQ ID NO. 3) is positioned before a section of PAM structure of the protein coding region.

CRISPR primers were designed as follows:

CRISPR pre-primer (SEQ ID No. 4): GATTGTGTTCTCCAAACAATCCCAC;

CRISPR post primer (SEQ ID No. 5): AAACGTGGGATTGTTTGGAGAACAC;

(2) 5 mu L of each of the CRISPR front primer and the CRISPR rear primer is taken, uniformly mixed and annealed into double chains by a PCR instrument to be used for encoding single guide RNA (sgRNA), namely a sgRNA coding sequence.

(3) The intermediate vector pMD18-T was subjected to BbsI single cleavage, and after purification by a common DNA purification kit, the annealed double strand was ligated with the vector using T4 ligase at 16℃overnight. The plate was transformed by heat shock at 42℃and the vector pMD18-T was ampicillin-resistant.

(4) Monoclonal colonies were picked and PCR verified using CRISPR pre-and post-vector primers (SEQ ID NO. 7).

(5) The bacterial liquid with correct band size is sent to a company for sequencing, the sequencing result shows that the vector contains sgRNA coding sequence, and the plasmid is connected to a binary expression vector pCAMBIA1301 after HindIII and KpnI are subjected to double digestion. The sequencing result shows that the final vector contains the sgRNA coding sequence, the obtained final plasmid electric shock is transferred into GV3101 agrobacterium competence, and after two days of culture at 28 ℃, spots are picked for PCR verification, so that the agrobacterium strain capable of being used for constructing CRISPR/Cas9 gene editing materials is obtained.

Example 2

And (5) preparing and identifying Slald1 gene mutant materials.

The sterilized tomato seeds were sown in the sowing medium and the cotyledons were cut after 7 days. Transforming the final plasmid prepared in example 1 into cotyledons by agrobacterium infection method, and obtaining T by utilizing totipotency of plant cells ₀ And editing tomato by using a gene.

T ₀ And detecting the tomato seedlings by editing the generation genes. Extraction of T by CTAB method ₀ The genome DNA of the plant generation takes the genome DNA as a template, and the following primers are designed at about 200bp before and after the DNA sequence containing the sgRNA coding sequence, and PCR amplification and sequencing verification is carried out:

verification pre-primer (SEQ ID NO. 8): CATTTCCAGTGAGTTACTCT;

post-verification primer (SEQ ID NO. 9): CTTTCTAGAACCCGGGATTT;

the PCR product obtained was sent to the company for sequencing. Comparing the sequencing result with the segment of gene original sequence by utilizing Snapgene software, selecting a plant with sgRNA coding sequence with base deletion and sequencing to display a single peak, and carrying out self-propagation to obtain T ₀ Seed of the generation.

T as described above ₀ Planting the seed in the growth chamber to obtain T ₁ And (3) replacing plants, and detecting T by using the same method ₁ And (3) base editing of sgRNA coding sequences of the generation plants. Meanwhile, the CRISPR pre-primer (SEQ ID NO. 4) and the carrier post-primer (SEQ ID NO. 7) are utilized for T ₁ And carrying out PCR amplification on the DNA of the generation plant, and detecting whether the DNA contains the Cas9 sequence. Selecting T without Cas9 protein and mutant sgRNA ₁ The generation plants, two lines identified as gene editing plants, designated Slald1#1 and Slald1#2, respectively, were identified, with the gene editing sites shown in FIG. 1. Slald1#1 lacks one base compared to control plants and Slald1#2 lacks 91 bases compared to control plants. The two strains T ₁ After the self-propagation of the generation seeds, stable inheritance T without exogenous gene Cas9 and mutant sgRNA is obtained ₂ And (5) replacing plants.

The following examples are given for two homozygous lines T as described above ₂ The generation plants were used as materials for experiments.

Example 3

Drought resistance research of Slald1 gene mutants.

Tomato plants with 4 leaves and one core are selected in a tray, and water is fully poured at the bottom of the tray, so that the plants are ensured to be full of water. And pouring out unabsorbed water in the plug after 3-5 hours, and starting the water control drought treatment. The ambient temperature is controlled at about 25 ℃, the relative humidity of air is about 75 percent, and the light intensity is about 400 mu mol/m ² And/s. Drought treatment is carried out for 7 days, the wilting condition of plants is observed and photographed and recorded. The wilting condition of the plant can be characterized by the relative conductivity of the leaf, the relative conductivity is high to indicate that the cell membrane permeability is larger, the cell damage is serious, the leaf wilting degree is high, and the plant is more sensitive to drought.

From fig. 2 and 3, it can be seen that the Slald1 gene mutant is capable of significantly improving drought resistance of tomato plants.

Example 4

And (5) measuring the hydrogen peroxide content of the Slald1 gene mutant and the tomato of the control group.

(1) Extracting hydrogen peroxide:

grinding tomato leaf with 0.3g liquid nitrogen, adding 3mL HClO ₄ (1M) homogenizing, and fully vortex mixing. Centrifuge at 6000rpm at 4℃for 5min, aspirate 2.5mL of supernatant into a new centrifuge tube, add 4M KOH dropwise while vortexing until pH 6-7. 0.05g of activated carbon was added, vortexed well for 30s, at 4℃and 12000rpm, and centrifuged for 5min. Sucking the supernatant into a clean centrifuge tube, and passing through a 0.22 μm filter membrane to obtain the extracted hydrogen peroxide.

(2) Preparing a reaction buffer solution:

to 100mL of potassium acetate solution (100 mM, pH 4.4) was added 0.0548g of ABTS to prepare a reaction buffer, which was sonicated for storage in the dark.

(3) Measuring hydrogen peroxide content:

1mL of sample hydrogen peroxide, 1mL of reaction buffer and 4 mu L of 1-POD (catalase) are sucked, the mixture is uniformly mixed by vortex, the mixture is placed for 3min at room temperature, and the absorption value of the hydrogen peroxide is measured at a wave band of 412 nm. And calculating according to a standard curve of the hydrogen peroxide to obtain the hydrogen peroxide content.

As can be seen from FIG. 4, under drought conditions, the hydrogen peroxide content in the Slald1 gene mutant is significantly reduced compared with that of the control plant, the steady state of active oxygen is protected, the degree of oxidative stress is reduced, and the drought resistance is improved.

Example 5

Under the condition of moderate water deficiency in a long period, the water utilization efficiency of the Slald1 gene mutant and the tomato in the control group is changed.

Tomato plants as long as 4 leaves and one heart are selected for long-term water deficit treatment, a control group CK (75% -85% of relative water content of soil) and a moderate water deficit treatment group Drright (45% -55% of relative water content of soil) are selected, and soil moisture is monitored by a weighing method and the water filling amount is recorded each time. And (3) placing the plant roots, stems and leaves subjected to long-term moderate water deficit treatment in a baking oven at 65 ℃ to constant weight, measuring the biological yield, and calculating the water utilization efficiency of the plant according to a formula. FIG. 5 shows the change in water utilization efficiency of Slald1 gene mutants and control tomato plants under long term moderate water deficit. As shown in FIG. 5, under the long-term moderate water deficit treatment, the water utilization efficiency of the Slald1 gene mutant plants is obviously higher than that of the control group plants. The result shows that under the long-term moderate water deficiency treatment, the Slald1 gene mutant plant can improve the water utilization efficiency, thereby improving the drought resistance of the plant and having application value in practical production.

Sequence listing

<110> university of Zhejiang

<120> a method for improving water use efficiency of tomato crops

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1311

<212> DNA

<213> tomato (Solanum lycopersicum L.)

<400> 1

atgttttctc tttgcatgca acctagtgct agtttgaaag ttcaaagaga ggaaactatt 60

gggagtagag gttataatta ttcaacaaga gtagctcgca atccaaactt gaaaaagttg 120

caaaccaact atttgtttcc tgagatatta gaaagggagc ttaaacatgt ggagaagtac 180

ccaaatgcta aagtaattag ccttggaatt ggtgatacca cgcagccatt accccaacct 240

gtagctttaa gcatgtctaa ttatgcacgt gctctttcaa cacctcaagg gtatactggc 300

tacggactgg aacaagggaa caaggaacta agaagagcaa ttgcagaaac aatatataaa 360

gatcttttgg tagaagaaac tgagatcttt gtgtctgatg gtgcacaatg tgatctctca 420

agagttcagc tcctcttagg ttccaatgtg tcaattgctg tacaggatcc atcatttcca 480

ggatatatag attcaagtgt gattatgggg cagagtggtg atttgaagaa tgattcaggg 540

agatatggaa atataaaata catgaaatgc aacctagaga acgatttctt tccagatctg 600

tccaaaactg aaagaacaga tgttatcttc ttctgttctc caaacaatcc cactggtcat 660

gcagcatcta ggcaacaatt gcagcaactt gtagagtttg cacaagtaaa tggttcaatt 720

attgtgtatg atgcagctta ttctgcatat atttcagact caagccctaa atcaatttat 780

gaaatcccgg gttctagaaa ggttgccatt gagatctcat ctttctcaaa gacggctgga 840

ttcacaggcg ttcgtctagg atggactgta gtgcctaagg agctatttta tctaaatgga 900

tttcctgtta tacacgattt caatcgcata atatgtacta gctttaacgg tgcttccaat 960

atagctcagg ctggtggatt ggcttgccta tccccggaag gtttcaagga agttatgttt 1020

aaagtagact actataaaga gaatgcaagg atcttagttg aaactttcac ttcactaggg 1080

tttcgagttt atggaggtag caatgcgcct tatgtttggg ttcattttcc aggttcgaaa 1140

tcatggaatg tgttcaattg gattcttgat aagactcaca tcattacagt tcctggaatt 1200

ggatttggtc cagctggtga aggatacata agggtttctg cttttggacg cagagagaac 1260

atcttggaag catctaaaag actcataacc ttactttgtc acacaaatta a 1311

<210> 2

<211> 436

<212> PRT

<213> tomato (Solanum lycopersicum L.)

<400> 2

Met Phe Ser Leu Cys Met Gln Pro Ser Ala Ser Leu Lys Val Gln Arg

1 5 10 15

Glu Glu Thr Ile Gly Ser Arg Gly Tyr Asn Tyr Ser Thr Arg Val Ala

20 25 30

Arg Asn Pro Asn Leu Lys Lys Leu Gln Thr Asn Tyr Leu Phe Pro Glu

35 40 45

Ile Leu Glu Arg Glu Leu Lys His Val Glu Lys Tyr Pro Asn Ala Lys

50 55 60

Val Ile Ser Leu Gly Ile Gly Asp Thr Thr Gln Pro Leu Pro Gln Pro

65 70 75 80

Val Ala Leu Ser Met Ser Asn Tyr Ala Arg Ala Leu Ser Thr Pro Gln

85 90 95

Gly Tyr Thr Gly Tyr Gly Leu Glu Gln Gly Asn Lys Glu Leu Arg Arg

100 105 110

Ala Ile Ala Glu Thr Ile Tyr Lys Asp Leu Leu Val Glu Glu Thr Glu

115 120 125

Ile Phe Val Ser Asp Gly Ala Gln Cys Asp Leu Ser Arg Val Gln Leu

130 135 140

Leu Leu Gly Ser Asn Val Ser Ile Ala Val Gln Asp Pro Ser Phe Pro

145 150 155 160

Gly Tyr Ile Asp Ser Ser Val Ile Met Gly Gln Ser Gly Asp Leu Lys

165 170 175

Asn Asp Ser Gly Arg Tyr Gly Asn Ile Lys Tyr Met Lys Cys Asn Leu

180 185 190

Glu Asn Asp Phe Phe Pro Asp Leu Ser Lys Thr Glu Arg Thr Asp Val

195 200 205

Ile Phe Phe Cys Ser Pro Asn Asn Pro Thr Gly His Ala Ala Ser Arg

210 215 220

Gln Gln Leu Gln Gln Leu Val Glu Phe Ala Gln Val Asn Gly Ser Ile

225 230 235 240

Ile Val Tyr Asp Ala Ala Tyr Ser Ala Tyr Ile Ser Asp Ser Ser Pro

245 250 255

Lys Ser Ile Tyr Glu Ile Pro Gly Ser Arg Lys Val Ala Ile Glu Ile

260 265 270

Ser Ser Phe Ser Lys Thr Ala Gly Phe Thr Gly Val Arg Leu Gly Trp

275 280 285

Thr Val Val Pro Lys Glu Leu Phe Tyr Leu Asn Gly Phe Pro Val Ile

290 295 300

His Asp Phe Asn Arg Ile Ile Cys Thr Ser Phe Asn Gly Ala Ser Asn

305 310 315 320

Ile Ala Gln Ala Gly Gly Leu Ala Cys Leu Ser Pro Glu Gly Phe Lys

325 330 335

Glu Val Met Phe Lys Val Asp Tyr Tyr Lys Glu Asn Ala Arg Ile Leu

340 345 350

Val Glu Thr Phe Thr Ser Leu Gly Phe Arg Val Tyr Gly Gly Ser Asn

355 360 365

Ala Pro Tyr Val Trp Val His Phe Pro Gly Ser Lys Ser Trp Asn Val

370 375 380

Phe Asn Trp Ile Leu Asp Lys Thr His Ile Ile Thr Val Pro Gly Ile

385 390 395 400

Gly Phe Gly Pro Ala Gly Glu Gly Tyr Ile Arg Val Ser Ala Phe Gly

405 410 415

Arg Arg Glu Asn Ile Leu Glu Ala Ser Lys Arg Leu Ile Thr Leu Leu

420 425 430

Cys His Thr Asn

435

<210> 3

<211> 20

<212> DNA

<213> tomato (Solanum lycopersicum L.)

<400> 3

tgttctccaa acaatcccac 20

<210> 4

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gattgtgttc tccaaacaat cccac 25

<210> 5

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

aaacgtggga ttgtttggag aacac 25

<210> 6

<211> 5857

<212> DNA

<213> tomato (Solanum lycopersicum L.)

<400> 6

atgttttctc tttgcatgca acctagtgct aggtgaactt tttttatcac ttcaactctt 60

ttatttattt attttttttc ttttctatca cttatttctt ctttcaaata atatatatgc 120

agtttgaaag ttcaaagaga ggaaactatt ggtatgagat tttaatttat tttaaattat 180

tattgttatt ttttttataa agaatttatt ttaaattatt ttattgtctt tcattttcat 240

tatgatatat tgatgttatt attcatgcag ggagtagagg ttataattat tcaacaagag 300

tagctcgcaa tccaaacttg aaaaagttgc aaaccaacta tttgtttcct gaggttagta 360

taattatact atatactctg atagatcgtt tggtgtatag aataagaata aatagtattg 420

aatacgaaaa tagtttgaaa taaaattctg acgtcatgtt tggaataact tatttcatca 480

attatatcat agtattaagt aataggataa attattctat atacatgatc gaataagtta 540

tcgtagaata attaattcta agataacgta tttccaacca aacaacctcc ttagggcttt 600

catgcttggt tctttaattt atccttaaaa ttacatgagt cgagataggg ccatctgaat 660

aaggtcgggg atgtaattaa tgtcaaattg atataatgat ataaaatagt gttgatattt 720

tagtaatatt tgaaacttga aaaagaaaca ccaaaaaata aatttaatat gcataaggtt 780

ttatcattta agaagcttta aaatattcaa taatgagaga ataaaaagag agaaaggcaa 840

atgaaaaaga taaatataaa aataataatg tagattcatg aaaatcataa tcagaatata 900

atcatgtaac aaaatagatt gtcatgtaag aaagaaatat tataattaac taaacactat 960

ttcatttctt ggattatctc aatgattctc atcttaaata aggtgaaaaa ataatcttat 1020

atctcttatc aaaaaaattc tttttagatt tatcaataca tagagatttg cttaacaaaa 1080

taaggggccc gaaatatatt gagaactcaa gagattattt tagtattttt atgatcgatc 1140

tatccctgaa tctaggtaat tttttttttt tgctttttaa tatatatata tatatatata 1200

tatatatata tatatatata tatatatata tatatatttg atggtgaggt attaattgtg 1260

tatttgtctt atttcacatg acagatatta gaaagggagc ttaaacatgt ggagaagtac 1320

ccaaatgcta aagtaattag ccttggaatt ggtgatacca cgcagccatt accccaacct 1380

gtagctttaa gcatgtctaa tgtgcgtaac ataaatcatc aactattttt actgctcaat 1440

gtgtttaaat tgacttgttt ttactgattt ttgattttta agttattttt gtttgtttgt 1500

tatagagcgt tcaaataata taaacgtttt aaaaagtatt ttgtaagctg aaaatgtact 1560

aaaatattac aagaatacaa aagtcagata tgggacattc ctaacatatt tttgactttt 1620

agcttatata tatatatcac gtttaaaaaa tcaatccaaa cacacaaata tatatattat 1680

aaatgttaca ataatatttt tgatttaccc ctaaataagc tggaattttc aaatgctttt 1740

ggttgttaat attaccaaaa ggccaacgga tggaataaaa taagtttgaa tattttaagc 1800

attttccaca aaaggatttc ggggaagttt aaggatttct cttgtctaaa agatcaaaaa 1860

taaattaatc taacatatat acactataat aaaatgacta ttagcgatat ttaattctta 1920

attatcgcta aaatatatat ttttagcaac aattgtcact ttttatatat gtctctaaag 1980

tctttagcga caataatttt aataacatta aactaataca aataaaaact ttaaccctct 2040

ttattagtgt caatatttaa taccaataaa aattattttt attatagtaa tattagcaca 2100

tgtttttaaa aatattcgaa gaataattca aaattttaaa gaagaccata gagaaaccgg 2160

agttgacttc aaagtccaaa taatgtaatt ccacaacctt tatttttatg ttttgattta 2220

attttactgt catatcattc taaatgaaca cccctgtttt aaacattgga ccctagacgt 2280

caaacaacaa aatcttttac tctaaaaatt attatgatat tttctttcgt cctattttat 2340

gtgaggtatt ttaatttggt ataaactttt taaatttttt ttttaaaatt tatgatctag 2400

aataaactat aaaaatttat gcaattgtag atcattttat taaaaataac ataaatattt 2460

tagattaaat tattatttaa tataaaaata tatcgttcat tataattttt acttgcagta 2520

tgcacgtgct ctttcaacac ctcaagggta tactggctac ggactggaac aagggaacaa 2580

ggtgggtcat actctttctt tattttctga gttaaatata tttatatcga tgtgttttgt 2640

acgaaagatc agaaaatatt taaaaattat tttttttgat tgtagatgga tactttattt 2700

tatattttgt atttgataaa taagtaagaa aatattattt caagggtact tcttcatatt 2760

tattgaattt ataggacata tatatttatt aagaaaaata tttagggata taatttaaaa 2820

ttatattttt cgctattatt cttttttaaa atcataaaat ataatgttgc aagtagtgca 2880

attaacctcc tagaatatat cacattttat taaaggaaaa aaataaatat gaaaaaaatt 2940

taaatatcta tttaaacttt aaacaattta attattttga acaatgaaaa aaacctaaaa 3000

aaacagttaa tatgaaatta agaaagtata ttttatctaa caaaatacgt gcaaaaattt 3060

caaagtgaag gttgagggag gagccaagtg aatttggaat atcacttgcg cacgtgtttt 3120

ccctgctttt attagagaag ttattttttt ttttttgaga aactttgtat taacttgagg 3180

gaaacagttt gactaaccaa acatagaaag attcaaacta acgtacttcc tttttattgc 3240

tgaccaaaca aaattaaagt aatattattg attgaatttg acaggaacta agaagagcaa 3300

ttgcagaaac aatatataaa gatcttttgg tagaagaaac tgagatcttt gtgtctgatg 3360

gtgcacaatg tgatctctca agagttcagg tatacttgca tattttcatt tttaatcggt 3420

ttaaaaaaga cataatttac aaacatgatt tttaacttga cgtcatccag taattatgac 3480

atttaacttt ggatatgcac aagtagacat ttaaacttgt ataaaattga acaaatagat 3540

acattcgtcc tacatgacat cctatatgat aattttactt cctacgtggc atcctacgtg 3600

tactatgtca tataggacat gtgtgtttac ttattcattt ttatataagt ttaagtgtct 3660

acttgtgcac actcaaaatt ggaggacata attttccgct gaagtcaagt taagaatcac 3720

gtttatgtat tatgccttta aaaaacaatg ttgtctttct atatttgaaa gtaattgaac 3780

tttaaacttt tatttatcct taatcaataa tttatagtcg ctcaaatatt aaagacaaga 3840

tttataccac aaattctaga gatttttctt attgtactta ctaggggtgt taaaaatgag 3900

gccaattata gataactcat ccaatccgtc caaaattttc agggttgaat ttaggcataa 3960

tacataaata tagcctttaa cttggctttg aatcacattt atacctttca actttgggtg 4020

tgcacaagta gacacttaaa cttgtataaa gttgaacaaa tagacacatg tcctacgtat 4080

catcctacat ttcaaatttt gtcctacgtg tattgtgtca tgtagaattt atgtgtttat 4140

ttatttaaaa gttggatagt taaaatgctt gcttgtgcat tatgaaagtt gaaggtcaaa 4200

gttaaaattt taagtcaagt ttagggtcta atatatgtat tatgccttga atttaagata 4260

atttgaattg actataatct caattctcaa ctcattcgaa tcttacccga tttaaaagaa 4320

aatctttaat tgaatccaac ttcatctcta atttcaaccc attttaaaac ttttaattac 4380

tatattatca catactccct agttgtcatt gacctgcctt gtgccacaac aaattctttc 4440

ttgcagctcc tcttaggttc caatgtgtca attgctgtac aggatccatc atttccagtg 4500

agttactctt gctctcattt gtcttaatta aatttgcttt caacttaatt atttatactg 4560

ttataaacag agatataggt ggaggtaggt ggagttcacg ggttcggacg aatccactag 4620

tttttcgtag attctatatt tgtgttagaa aaatttaaat aaatatatat atatatatta 4680

acatgtgaac ctccaaacta ctaactttgg ctccgcctac agggatatat agattcaagt 4740

gtgattatgg ggcagagtgg tgatttgaag aatgattcag ggagatatgg aaatataaaa 4800

tacatgaaat gcaacctaga gaacgatttc tttccagatc tgtccaaaac tgaaagaaca 4860

gatgttatct tcttctgttc tccaaacaat cccactggtc atgcagcatc taggcaacaa 4920

ttgcagcaac ttgtagagtt tgcacaagta aatggttcaa ttattgtgta tgatgcagct 4980

tattctgcat atatttcaga ctcaagccct aaatcaattt atgaaatccc gggttctaga 5040

aaggtaatat tatgaaactt ttttagtgaa aaatgactcc tcccttccgt tttatatgac 5100

tctgcacgaa gtttaaaaaa gtaaaagaaa cttgtggtcc aaaatgaatg atagaaattt 5160

gtgtgattaa attgtaaatc atttcattaa ggttaaaata aatattttat agttaaatag 5220

ttactaatat aaaaacatgt cattcttttt gaaactaatt aaaaaggaaa gtaagtcaaa 5280

taaattgaga cagaggaaat ataacttata gattcatctt taaactgatt attatttctt 5340

actacaggtt gccattgaga tctcatcttt ctcaaagacg gctggattca caggcgttcg 5400

tctaggatgg actgtagtgc ctaaggagct attttatcta aatggatttc ctgttataca 5460

cgatttcaat cgcataatat gtactagctt taacggtgct tccaatatag ctcaggctgg 5520

tggattggct tgcctatccc cggaaggttt caaggaagtt atgtttaaag tagactacta 5580

taaagagaat gcaaggatct tagttgaaac tttcacttca ctagggtttc gagtttatgg 5640

aggtagcaat gcgccttatg tttgggttca ttttccaggt tcgaaatcat ggaatgtgtt 5700

caattggatt cttgataaga ctcacatcat tacagttcct ggaattggat ttggtccagc 5760

tggtgaagga tacataaggg tttctgcttt tggacgcaga gagaacatct tggaagcatc 5820

taaaagactc ataaccttac tttgtcacac aaattaa 5857

<210> 7

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

ctacttatcg tcatcgtctt tg 22

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

catttccagt gagttactct 20

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

ctttctagaa cccgggattt 20

Claims

1. The application of the knockout SlALD1 gene in improving the water utilization efficiency of tomato crops is disclosed, wherein the nucleotide sequence of a protein coding region of the SlALD1 gene is shown as SEQ ID NO. 1.

2. The application of the protein coded by the knock-out SlALD1 gene in improving the water utilization efficiency of tomato crops is disclosed, wherein the amino acid sequence of the protein coded by the SlALD1 gene is shown as SEQ ID NO. 2.

3. A method for improving the water utilization efficiency of tomato crops is characterized in that the SlALD1 gene in the tomato crops is knocked out; the nucleotide sequence of the protein coding region of the SlALD1 gene is shown as SEQ ID NO. 1.

4. A method as claimed in claim 3, comprising the steps of:

(3) And (3) transforming the agrobacterium genetic engineering bacteria in the step (2) into tomato cells, and culturing to obtain a homozygous mutant strain which does not contain exogenous proteins and is stably inherited.

5. The method of claim 4, wherein the vector for knocking out the SlALD1 gene is a CRISPR/Cas9 vector.

6. The method of claim 5, wherein the nucleotide sequence of the upstream primer that constructs the CRISPR/Cas9 vector is shown in SEQ ID No.4 and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 5.

7. The method of claim 4, wherein the target fragment for gene knockout is a target fragment comprising a PAM structure, and the first 20 bases of the PAM structure of the target fragment has a nucleotide sequence shown in SEQ ID No. 3.

8. The method of claim 4, wherein the agrobacterium genetically engineered bacterium is agrobacterium GV3101 strain.