CN106867979B - Application of NtRLK2 gene in bacterial wilt resistance of tobacco - Google Patents

Abstract

The invention relates to a tobacco bacterial wilt resistance-related LRR receptor protein kinase geneNtRLK2The invention obtains an LRR receptor protein kinase gene with 2 times up-regulated expression induced by ralstonia solanacearum through gene chip analysisNtRLK2Partial fragments are obtained through RACE technology to obtain a full-length cDNA sequence, the gene is cloned from a tobacco high-resistance bacterial wilt product line 3 and is used for constructing an over-expression and RNAi expression vector, the gene is transferred into a bacterial wilt product variety Cuibi I in tobacco, inoculation identification shows that RNAi interference of the gene obviously enhances the disease resistance of a tobacco plant to ralstonia solanacearum, preliminary prediction is carried out on the gene which is possibly an interaction gene of an endogenous disease-resistant gene, and the expression of the disease-resistant gene is inhibited. The method lays a foundation for genetic breeding of tobacco bacterial wilt resistance.

Description

Application of NtRLK2 gene in bacterial wilt resistance of tobacco

Technical Field

The invention relates toNtRLK2The application of gene in bacterial wilt resistance of tobacco belongs to the field of plant gene engineering technology.

Background

Plants undergo a complex developmental process from embryogenesis to intact plants, throughout life history. This process is regulated by its own genetic material and environment. In essence, it is a process how to coordinate the living environment and the self genetic information, so that the regulatory genes are orderly expressed in space and time to complete the life activities. This requires that the plant individuals have receptors for receiving internal and external signal molecules, and protein kinases play an important role in several processes of this information transduction. Eukaryotic protein kinases catalyze the amino acid side chains of proteins by transferring the phosphate group of ATP, a function which can be counteracted by the action of protein phosphatases. It is estimated that 1% -3% of the functional genes of eukaryotes are used to encode protein kinases. Protein kinases are mainly classified into two classes, serine/threonine and tyrosine, according to the substrates used, and the tyrosine class is mainly found in animal cells and plants and is mostly serine/threonine. It has been increasingly found that plant cells also contain a class of proteins structurally similar to animal cell Receptor Protein Kinases (RPKs), known as receptor-like protein kinases (RLKs). RLKs are composed of three major components, the extracellular domain, the transmembrane domain, and the intracellular protein kinase domain.

The various rows of RLKs protein kinases exert different physiological functions due to differences in the extracellular domains. As arabidopsis thaliana At1g70130 belonging to the Lectin class RLK (nomenclature:LecRK-b2) The gene responds to an ABA signal in the germination stage of the Arabidopsis seeds and participates in salt stress and osmotic adjustment in the initial growth stage; another Lectin gene is related to the development of pollen. In riceOsWAK1Is a cell wall related RLK protein kinase and has the resistance of rice blast germs. An LRR-RLK gene in Arabidopsis thaliana (RPK2) It is a new factor for controlling the growth of anther. In cornZmLrk-1Expression is induced by fungal infection during endosperm development and seed germination, but not by SA, jasmonic acid and physical damage. In oilseed rape, the S-receptor proteins (SRKs), which form heterodimeric complexes with SLGs, bind to the receptor structure outside the SRP, resulting in conformational changes that in turn cause alternate phosphorylation and dephosphorylation of intracellular kinases, and are involved in pollen-cross-incompatible signaling. Rice (Oryza sativa L.) with improved resistance to stressOsBISERK1Is expressed by4-amino-2, 1, 3-Benzothiadiazole (BTH) induces up-regulated expression, and the gene is presumed to have a defense effect.

Aiming at the background technologies, after tobacco is subjected to different hormone and environmental stress treatment in the early stage, two samples of each treatment mixture and corresponding comparison mixture are obtained, on the basis of obtaining stress-resistant related unigene by Roche 454 sequencing, 2.4 ten thousand tobacco EST unigenes published on the network are combined, a 12X 135K tobacco gene chip with the highest density in the world is designed, a differential expression spectrum of a tobacco fine variety K326 under the inoculation stress of ralstonia solanacearum is researched, 2398 differential genes with the upper and lower regulation times of 2 times are co-separated, a batch of RLKs genes are obtained, and a receptor-like protein gene (LRR receptor-like receptor thionine-protein kinase) is obtained from the RLKs genes. The full length of the gene is cloned from the tobacco Cuibi No. I variety by RACE technology (named asNtRLK2) Including the complete reading frame. The conserved domain and characteristic region analysis shows that the protein contains an extracellular domain, a transmembrane region and an intracellular kinase domain, is similar to the structure of RLK-type kinase, and has 42 percent of similarity with an LRR-RLK-type protein (accession number: NP-001042346) of rice. Further, the gene is cloned from a tobacco high bacterial wilt resistance product line 3 and used for constructing an overexpression and RNAi expression vector, the gene is transferred into a bacterial wilt resistance tobacco variety Cuibi I in tobacco, inoculation identification shows that RNAi interference of the gene obviously enhances disease resistance of plants, preliminary prediction is carried out, the gene is possibly an interaction gene of an endogenous disease resistance gene, and expression of the disease resistance gene is inhibited. This will provide a theoretical basis for the molecular mechanism of tobacco bacterial wilt resistance.

Disclosure of Invention

The invention provides tobacco LRR receptor protein kinase genesNtRLK2The application of the gene in bacterial wilt resistance of tobacco. The purpose is to provide tobacco LRR receptor protein kinase geneNtRLK2The coding sequence of gene and its coded protein, providing the protein containing said geneNtRLK2The gene overexpression vector and the RNAi interference vector are applied to improving the resistance of tobacco to ralstonia solanacearum, and then the bacterial wilt resistant tobacco variety (line) is cultivated. Provides gene resources for cultivating new bacterial wilt-resistant tobacco varieties by means of genetic engineering, and has strong capability ofThe application prospect is promising.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention clones the bacterial wilt-resistant tobacco variety line 3 by designing a primerNtRLK2The nucleotide sequence of the gene is shown as SEQ ID NO.1, and the amino acid sequence of the gene is shown as SEQ ID NO. 2.

The invention provides a tobacco LRR receptor protein kinase gene containing the tobacco LRR receptor protein kinase geneNtRLK2Overexpression vectors for genes and RNAi vectors. Introducing a gene expression cassette with a 35S strong promoter into a pCAMBIA1301 vector to be transformed into an intermediate engineering vector, temporarily naming the vector as pSC1301, and introducing based on pSC1301NtRLK2The gene is started by enhanced promoter 35S to construct a overexpression vector pSC1301-NtRLK2(ii) a The RNAi vector is based on the existing modified vector in the laboratory, and the constructed RNAi vector is pSC1300-347-NtRLK2. Separately transforming the above vectorsEHA105The agrobacterium is respectively introduced into the bacterial wilt-sensing variety Cuibi I by a leaf disc method. Carrying out ralstonia solanacearum inoculation identification on transgenic progeny plants, and the result shows thatNtRLK2RNAi interference of the gene obviously enhances the disease resistance of plants, preliminarily predicts that the gene may be an interaction gene of endogenous disease-resistant genes, and inhibits the expression of the tobacco bacterial wilt-resistant gene. This will provide a theoretical basis for the molecular mechanism of tobacco bacterial wilt resistance.

Tobacco of the inventionNtRLK2Compared with wild tobacco, the transgenic tobacco with the gene RNAi interference vector has obviously improved bacterial wilt resistance, and the gene silencing expression has very important application value in tobacco bacterial wilt resistance genetic engineering.

Advantageous effects

The cloned tobacco CC-NBS-LRR disease-resistant gene of the inventionNtRRS2The gene can improve the resistance of the tobacco to the ralstonia solanacearum, and has important application value for genetic improvement of the resistance of the tobacco to the ralstonia solanacearum and cultivation of new varieties (lines) of the ralstonia solanacearum resistant tobacco.

Drawings

FIG. 1 RACE acquisitionNtRLK23 'unknown and 5' unknown sequences of the gene and ORF boxes. A: 5' RACE target fragment;b: 3' RACE target fragment; c: ORF frame fragment of interest.

Figure 2 multiple sequence alignment of NtRLK2 protein kinase domains.

FIG. 3NtRLK2Construction of overexpression vectors and RNAi vectors.

FIG. 4NtRLK2And identifying the overexpression transgenic tobacco T0 generation. M: DL2,000 DNA Marker. 1: a positive control; 2: negative control; the remaining lanes are amplified products using DNA from T0 individual plants as templates.

FIG. 5NtRLK2-RNAiIdentifying transgenic tobacco T0 generation. M: DL2,000 DNA Marker. 1: a positive control; 2: negative control; the remaining lanes are amplified products using DNA from T0 individual plants as templates.

FIG. 6NtRLK2Overexpression and RNAi transgenic tobacco are inoculated with the phenotype of the ralstonia solanacearum.

FIG. 7NtRLK2Disease index after the transgenic and non-transgenic tobacco is inoculated with ralstonia solanacearum.

Detailed Description

[ example 1 ] RACE was obtainedNtRLK2The 3 'unknown sequence and the 5' unknown sequence of the gene

Obtaining candidate gene segments from the sequencing result of tobacco 454, combining the transcription of tobacco abiotic and biotic stress 454 sequencing into an expression profile gene chip of peanut, screening differential expression of genes before and after induction of ralstonia solanacearum by using chip hybridization before and after inoculation of bacterial wilt resistant varieties to obtain the candidate gene segments, designing a pair of gene primers 9-F (5'-AGCAGACTATCTAAGGGAAG-3') and 9-R (5'-CTTACTCCATCTGCTTTTCTGATCCAC-3'), designing a pair of primers RACE-F (5'-AAGCAGTGGTATCAACGCAGAGTGGCCAT-3') and RACE-R (5 '-ATTCTAGAGGCCGAGGCCGGCCGTGd (T)) 30N-1N-3' (N = A, G, C, or T; N-1= A, G, or C)) according to a template joint sequence. Respectively carrying out 5 ' and 3 ' -RACE reactions by utilizing the P9-R primer and the RACE-F primer as well as the 9-F primer and the RACE-R primer, wherein the 5 ' -RACE reaction condition is 94 ℃ for 5min → (94 ℃ for 30s → 60 ℃ for 30s → 72 ℃ for 2min)30 cycles → 72 ℃ for 10 min; the 3' -RACE reaction conditions were 94 ℃ 5min → (94 ℃ 30s → 72 ℃ 2min)5cycles → (94 ℃ 30s → 65 ℃ 30s → 72 ℃ 2min)30 cycles → 72 ℃ 10 min; and carrying out T-A cloning on purposeful recovery connection of a PCR product according to the size of a target strip gene predicted by bioinformatics, and carrying out sequencing on positive clones sent to Huahua DageneCo.

The obtained 5 'and 3' unknown sequences are spliced to obtain the full-length cDNA sequence thereof, the full-length cNDA primer NtRLK2-FL-F (5'-CACACATTTTTTGTGAATCTTTCTTC-3') and the NtRLK2-FL-R (5'-GCTCTAAAGCAAATCTTGAC-3') primer are designed according to the full-length cDNA sequence, and the full-length cDNA sequence is obtained from the single-stranded cDNA amplification under the reaction condition of 94 ℃ for 5min → (94 ℃ for 30s → 55 ℃ for 30s → 72 ℃ for 3min) for 30 cycles → 72 ℃ for 10 min. The PCR product is purposefully recovered and connected to carry out T-A cloning, and the positive clone is sent to Hua Dai Gen Co Ltd for sequencing and plasmid preservation.

NtRLK2The electrophoresis patterns of the 3 'and 5' unknown sequences of the gene and the full-length cDNA clone are shown in FIG. 1; the full-length cDNA sequence is shown as SEQ ID No.1, the full-length cDNA sequence of the gene is 3352bp, namedNtRLK2The gene was analyzed to encode 992 amino acids, with a 5 'untranslated region of about 122 bp and a 3' untranslated region of 251bp, including a 31bp Poly (A) tail.

The NCBI is used for conservative domain prediction, and the prediction belongs to two supergene families, namely LRRNT-2 (N-terminal leucine-rich family 2) and PKc-like (protein kinase catalysis family), and comprises functional sites of kinases: activation site, ATP binding site, substrate binding site, active loop (also called a loop). Kinase regions derived from Arabidopsis thaliana, grape, rice and castor were found from GenBank, respectively, and homology comparisons were performed using ClustalW software. The results are shown in FIG. 2, although derived from different families, the kinase domain is rather conserved, which is essential for the physiological function of this type of protein.

[ example 2 ]NtRLK2Construction and validation of overexpression vectors

Amplification of a plasmid with an intact reading frame by NtRLK2-OE-F (5'-CGGCTCTAGAACCATGAAGCAAATTCTGATGGACAG-3') and NtRLK2-OE-R (5'-CAACGGTACCCATAACATTCTCCAATGGTTG-3') pairs of primers to include a termination codonNtRLK2Gene

The open reading frame of cDNA is shown,5 'end and 3' end respectively have Xba I and Kpn I restriction sites, and pSC1301 driven by 2 xCaMV 35S promoter and obtained by amplification constructed in the laboratoryNtRLK2The target fragment was digested simultaneously with Xba I and Kpn I, the target fragment was recovered, ligated with T4 ligase overnight at 16 ℃ and transformed into E.coli DH5 α strain to construct pSC1301-NtRLK2The overexpression vector (FIG. 3A).

Two pairs of primers, NtRLK 2-RNAi-SpeI-F (5'-CAACACTAGTGAGCTTTTGTAATATCTGCA-3') and NtRL 2-RNAi-KpnI-R (5'-AATTGGTACCGTCTGTTCCAAGAGCTTCC-3'), and NtRL 2-RNAi-XbaI-F (5'-CAACTCTAGAGTCCGGTCATTAAGCTTCC-3') and NtRL 2-RNAi-Cla I-R (5'-CAACATCGATGACGCTGATTTAATTTGTCA-3'), were designed in their non-conserved regions.

Amplifying with the above two pairs of primers respectivelyNtRLK2Forward and reverse inserts of genes were inserted into the intermediate laboratory-constructed expression vector pSC1300-347 by double digestion and ligation to construct pSC1300-347-NtRLK2 (FIG. 3B). The correct insert was verified by PCR, digestion and sequencing. Transformation of Agrobacterium by liquid nitrogen freeze-thaw methodEHA105For tobacco transgenosis.

Example 3 genetic transformation of tobacco and PCR identification of transgenic tobacco

Transforming tobacco by adopting the agrobacterium tumefaciens mediated leaf disc method, and respectively carrying plasmids pSC1301-NtRLK2The agrobacterium of the overexpression vector and the pSC1300-347-NtRLK2 RNAi interference vector is transformed into a tobacco variety Cuibian I (CB-1) by a leaf disc method, 15mg/L Hyg is used for screening leaf buds and root growth, 500mg/L (Cef) is used for inhibiting the growth of the agrobacterium in the culture process, the culture condition is that the temperature is 25 +/-2 ℃, and the illumination is carried out for 14h day/10 h night every day. Co-culture medium: MS culture medium +0.1mg/L NAA +1 mg/L6-BA, induced screening culture medium: MS culture medium +0.1mg/L NAA +1 mg/L6-BA +15mg/L Hyg +500mg/L Cef, rooting culture medium: MS culture medium +15mg/L Hyg +500mg/L Cef.

For PCR detection of overexpressed transgenic tobacco, the DNA was synthesized from the 35S promoter andNtRLK2design of a pair of primer primers 35S-F (5'-TGATGTGATATCTCCACTGACGTAAG-3') andNtRLK2-R (5'-ATAACATTCTCCAATGGTTG-3'), CTAB method for extracting DNA of transgenic and non-transgenic tobacco, using DNA of two transgenic plants as template and DNA of untransformed tobacco as control, using designed 35S-F andNtRLK2-R is subjected to PCR amplification.

The PCR reaction system is as follows: 10 × buffer 2.0 μ l, dNTP 1.5 μ l, 35S-F0.5 μ l,NtRLK2-R0.5 μ l, Taq enzyme 0.1 μ l, ddH₂O14.4 mul, 1.0 mul of template DNA, and 20 mul of total volume. The reaction procedure is as follows: 94 ℃ 5min → (94 ℃ 30s → 58 ℃ 30s → 72 ℃ 60 s) 40 cycles → 72 ℃ 10min → hold at 4 ℃. For RNAi interference vector transgenic plants, TNOS primers (Tnos-F: GATCGTTCAAACATTTGGCAATAAAG and Tnos-R: CCGATCTAGTAACATAGATGACAC) are designed, DNA of transgenic and non-transgenic tobacco is extracted by a CTAB method, DNA of the two transgenic plants is used as a template, DNA of untransformed tobacco is used as a control, and the designed Tnos-F and Tnos-R are used for PCR amplification. The PCR reaction system is as follows: 10 × buffer 2.0 μ l, dNTP 1.5 μ l, Tnos-F0.5 μ l, Tnos-R0.5 μ l, Taq enzyme 0.1 μ l, ddH₂O14.4 mul, 1.0 mul of template DNA, and 20 mul of total volume. The reaction procedure is as follows: 94 ℃ 5min → (94 ℃ 30s → 55 ℃ 30s → 72 ℃ 30 s) 40 cycles → 72 ℃ 10min → hold at 4 ℃.

The overexpression vector transgenic plant takes a promoter downstream forward primer and a gene downstream reverse primer as identification primers to obtain a strip with the length of 1970bp (figure 4), the overexpression vector is taken as a positive control, a non-transgenic plant is taken as a negative control to obtain 61 positive transgenic overexpression plants, and the positive rate is 80.2%. Tnos-F and Tnos-R are used as identification primers, and a non-transgene is used as a negative control, so that the obtained positive transgenic plant can be amplified to a Tnos fragment of 256bp (figure 5), 58 positive plants are obtained, and the positive rate is 79.3%.

[ example 4 ] identification of bacterial wilt resistance in transgenic plants

Injecting ralstonia solanacearum into the transgenic plants identified as positive in the 8-leaf stage by using veins respectively, inoculating 3 leaves into each plant, identifying the disease resistance of the transgenic plants, and taking non-transgenic plants as a control group at the same time. After 2 weeks of inoculation, the control group was seen to begin to develop disease, while the leaves of the transgenic plants began to develop allergic plaques, and the stems of a few plants became black and began to develop mild disease. After one month, the overall morbidity was observed, the non-transgenic control group had significant morbidity, one third of the plants withered and died, and most of the leaves were withered, yellow and green. The transgenic groups showed different degrees of disease resistance, and RNAi interfering plants showed more obvious resistance than the overexpression transgenic plants (FIG. 6). Observing inoculated leaves, and finding that the leaves of the control group are seriously withered, yellow, wilted and shriveled; the over-expression transgenic plant inoculated leaves have scabs, a small amount of spread, allergic death of part of leaves and withered death of a small part of leaves; the leaf inoculation position of RNAi expression transgenic plant shows allergic death, hardly spreads and shows strong resistance (FIG. 6).

The disease resistance of the whole inoculated plant is specifically evaluated through the disease index. In 54 strainsNtRLK2In the identification of the over-expression transgenic plants, 6 plants have no morbidity, other 48 plants have morbidity in different degrees, each transgenic plant is classified according to the tobacco resistance identification disease classification standard, the disease index is calculated to be 35.9, and the preliminary judgment is as the resistance (MR) according to the tobacco bacterial wilt resistance evaluation standard shown in the table 2. When 51 RNAi-expressing transgenic plants were evaluated in the same manner, 10 plants were found to have no disease, 2 plants were found to have withered, and the remaining 35 plants had slight disease, and the disease index was calculated to be 19.6, showing resistance (R). After the control group of 48 non-transgenic plants was inoculated with ralstonia solanacearum, the disease was basically developed, and the disease index was calculated to be 61.8 according to statistics, which was expressed as susceptible (S) (FIG. 7). The inoculation identification shows thatNtRLK2RNAi interference of the gene obviously enhances the disease resistance of plants, preliminarily predicts that the gene may be an interaction gene of endogenous disease-resistant genes, and inhibits the expression of the tobacco bacterial wilt-resistant gene. This will provide a theoretical basis for the molecular mechanism of tobacco bacterial wilt resistance.

The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.

SEQUENCE LISTING

<110> Fujian agriculture and forestry university

Application of <120> NtRLK2 gene in bacterial wilt resistance of tobacco

<130>18

<160>18

<170>PatentIn version 3.3

<210>1

<211>3352

<212>DNA

<213> full-length cDNA sequence of NtRLK2

<400>1

acagactact gatgatcagt cgatgggggc gaaattaagg aagaacaaat gcatacctgg 60

ccataggttg gttagagtat tgtatcagag atagaagaaa caaagggaac tgtgaaacaa 120

aaatgagaac ctcattgtgt tgtagcatta ttctgttaag tttcgtcttc atttggctga 180

ataatgtaac agtaacagtg ttaggctctt ccttcagcga cctcgacacg ttgttgaagc 240

tcaaggaagc catgaaagga tcaaaagcca aacccgacgc gcttcaagat tggaaattct 300

caacctctat ctccgctcac tgttcattct ccggcgtcac ctgcgaccgc cagaacctcc 360

gcgtcgtggc ccttaacgtc tcctttgttc cccttttcgg cagcattccg ccggagatag 420

gcctcttgga caagctcgag agccttaccc tctcatcgga caatctcacc aaggagcttc 480

ccatggagct cgccaatctc acctccctca ggctcctcaa catctcgcac aaccttttct 540

ctggtcgctt ccccggcgat atcaccgtgg ccatgacaga actcgaaacg ctggacatct 600

acgacaacag cttcagcgga accttaccag aggagttcgt gagactggag aagctccggt 660

ccctcaacct ctctggaaac tatttctccg gcgagattcc tgagagttac tctgagttcg 720

aaagcttgga ggttctgaac ctggccacaa acagcttaac cggcaagatt ccgagaagct 780

tggtgaaatt gaagaagctg aaaagactat ccctcgggta tgataattcc tactcagatg 840

tagtacctac agaattcggt tcgttcgagt cgttgcaact gcttgatttg tccagctgta 900

acttgagcgg tgagattcct cccacgctcg gcgcgttaac tcacttgcac actctcttcc 960

ttcaaatgaa caaccttacc ggaaccattc cttcacaact ctccactatg ataagcctca 1020

agtcgttgga tctctcctac aacgagttaa cgggcgagtt tccgttgaca ttctctaagc 1080

tcaccaatct cacgctaatc aatttcttcc ataacaaact ccgaggcaac atccctccct 1140

tcgttgggga cctcccgaac ctggagacct ttcaggtttg gggtaacaac ttctccaacg 1200

tgcttccacc caaccttggc caaaacgcca gattcttata cttcgacgtc actaataacc 1260

acttcactgg agagctccct agggacctgt gcaaatccgg caggttgaga acgttcttgg 1320

ccaccggtaa cttcttttac ggcaccattc ctgaaggaat aggaggttgc gtttcgttgg 1380

agaagataag aattagtgat aacttcctcc aaggccaggt tcctcctggg atctttaaat 1440

tgccagctgt ccagatcatc gagatggcga ataaccgttt taacggaaat attccttctg 1500

atatttccgg ggattccctc agcatcctaa ccctctccac taacaacttc gccggcagga 1560

tcgcgccgga gctcaagaat ctccagaaac tgcagacgct tgcgcttgac gcgaaccagt 1620

tcgttggaga gattccaggg gaggtgtttg acttgccggc gttgatcaag gtcaacttga 1680

gcggcaacaa cctcaccggt gagattccgg agtcggtgat tcactgtggt tctctgacgg 1740

cggttgattt tagccggaac atgctcaccg gagaaattcc caaggggata aaaagcctca 1800

cagttctaag catcttgaac ctctcgcgca accacatcac cggaactgtc cccgacgaga 1860

ttcgcttcat gacgagcctc aacacgctgg atctctccaa caacaacttc attggaagag 1920

tccccacggg tggccagttc gtggccttca atgacaagtc gtttgcaggg aaccctaacc 1980

tctgctctcc gcaccagccg tattgtcctt cctccgtcaa cactgcctct ggaaaaagcc 2040

acaatcctct gagttcaaaa tcaactaagg tagttataat cgtgatcggg atctccacgg 2100

cagtgctcct ggctatggtg acggtataca ttatgaggaa gaggaagcac cagaaagaaa 2160

tgtcgtggaa gctgacggcg ttccagtcaa cgctgaaaat gaaggcagag gaggtggtgg 2220

aatgcttgaa ggaagagaac atcattggaa aaggaggagc aggaatcgtg taccgcggga 2280

caacaccgaa gggaacggag gtggcaatca agagacttgt ggggcaagga agtggaagaa 2340

acgattacgg tttcaaggcg gagatagaaa cgttagggaa gataaggcac aggaacataa 2400

tgaggctctt ggggtacgtg tcaaataagg acacgaacct gttgctgtat gagtacatgc 2460

cgaatggaag cttgggagag tggctgcatg gtgcgaaggg agggcacctc acgtgggaaa 2520

tgagataccg cattgcggtg gaggctgcca aggggctctg ctacttgcac catgattgct 2580

cgcccttgat cattcacagg gatgttaagt ccaataacat cttgcttgat gaggactttg 2640

aggctcacgt tgctgatttt gggctcgcca agttcttgca ggaccctgga gcgtctcagt 2700

ccatgtcctc cattgctggc tcctacggct acattgctcc agagtacgct tacacgctga 2760

aagtggacga gaagagcgat gtatacagct ttggagtagt gctgttggag ctgatcgtag 2820

gaaggaagcc agtgggtgag ttcggagatg gtgttgacat cgttggatgg gtcaacaaga 2880

ccatgtcgga gctgtctcag ccgtctgatg cggcttccgt gttggcagtg gtggacccca 2940

ggctcaatgg gtatccattg ggcagcgtca tccacatgtt caacatagct atgatgtgtg 3000

ttagagaaat tggccatgct aggcctacca tgagggaagt tgtttatatg ctcactaatc 3060

cacctcaatc taccacccat cataacctaa ttaatctcta gttcattacc ctttttaatt 3120

tcccctttgt aaataaatta acacagatga aactgtgcaa aatataataa ccttcatcta 3180

tatatatatg ggtagacgtg tattaatacc aaatgtaaaa taggtttgaa ttttggtttg 3240

atgttatttg tcaaagggag gggtttgtcc tgattgtgtt attatcagaa gttttgtata 3300

aaagataata tatgttgttg caaaaaaaaa aaaaaaaaaa aaaaaaaaaa aa 3352

<210>2

<211>992

<212>PRT

<213> amino acid sequence

<400>2

Met Arg Thr Ser Leu Cys Cys Ser Ile Ile Leu Leu Ser Phe Val Phe

1 5 10 15

Ile Trp Leu Asn Asn Val Thr Val Thr Val Leu Gly Ser Ser Phe Ser

20 25 30

Asp Leu Asp Thr Leu Leu Lys Leu Lys Glu Ala Met Lys Gly Ser Lys

35 40 45

Ala Lys Pro Asp Ala Leu Gln Asp Trp Lys Phe Ser Thr Ser Ile Ser

50 55 60

Ala His Cys Ser Phe Ser Gly Val Thr Cys Asp Arg Gln Asn Leu Arg

65 70 75 80

Val Val Ala Leu Asn Val Ser Phe Val Pro Leu Phe Gly Ser Ile Pro

85 90 95

Pro Glu Ile Gly Leu Leu Asp Lys Leu Glu Ser Leu Thr Leu Ser Ser

100 105 110

Asp Asn Leu Thr Lys Glu Leu Pro Met Glu Leu Ala Asn Leu Thr Ser

115 120 125

Leu Arg Leu Leu Asn Ile SerHis Asn Leu Phe Ser Gly Arg Phe Pro

130 135 140

Gly Asp Ile Thr Val Ala Met Thr Glu Leu Glu Thr Leu Asp Ile Tyr

145 150 155 160

Asp Asn Ser Phe Ser Gly Thr Leu Pro Glu Glu Phe Val Arg Leu Glu

165 170 175

Lys Leu Arg Ser Leu Asn Leu Ser Gly Asn Tyr Phe Ser Gly Glu Ile

180 185 190

Pro Glu Ser Tyr Ser Glu Phe Glu Ser Leu Glu Val Leu Asn Leu Ala

195 200 205

Thr Asn Ser Leu Thr Gly Lys Ile Pro Arg Ser Leu Val Lys Leu Lys

210 215 220

Lys Leu Lys Arg Leu Ser Leu Gly Tyr Asp Asn Ser Tyr Ser Asp Val

225 230 235 240

Val Pro Thr Glu Phe Gly Ser Phe Glu Ser Leu Gln Leu Leu Asp Leu

245 250 255

Ser Ser Cys Asn Leu Ser Gly Glu Ile Pro Pro Thr Leu Gly Ala Leu

260 265 270

Thr His Leu His Thr Leu Phe Leu Gln Met Asn Asn Leu Thr Gly Thr

275 280 285

Ile Pro Ser Gln Leu Ser Thr Met IleSer Leu Lys Ser Leu Asp Leu

290 295 300

Ser Tyr Asn Glu Leu Thr Gly Glu Phe Pro Leu Thr Phe Ser Lys Leu

305 310 315 320

Thr Asn Leu Thr Leu Ile Asn Phe Phe His Asn Lys Leu Arg Gly Asn

325 330 335

Ile Pro Pro Phe Val Gly Asp Leu Pro Asn Leu Glu Thr Phe Gln Val

340 345 350

Trp Gly Asn Asn Phe Ser Asn Val Leu Pro Pro Asn Leu Gly Gln Asn

355 360 365

Ala Arg Phe Leu Tyr Phe Asp Val Thr Asn Asn His Phe Thr Gly Glu

370 375 380

Leu Pro Arg Asp Leu Cys Lys Ser Gly Arg Leu Arg Thr Phe Leu Ala

385 390 395 400

Thr Gly Asn Phe Phe Tyr Gly Thr Ile Pro Glu Gly Ile Gly Gly Cys

405 410 415

Val Ser Leu Glu Lys Ile Arg Ile Ser Asp Asn Phe Leu Gln Gly Gln

420 425 430

Val Pro Pro Gly Ile Phe Lys Leu Pro Ala Val Gln Ile Ile Glu Met

435 440 445

Ala Asn Asn Arg Phe Asn Gly Asn Ile Pro SerAsp Ile Ser Gly Asp

450 455 460

Ser Leu Ser Ile Leu Thr Leu Ser Thr Asn Asn Phe Ala Gly Arg Ile

465 470 475 480

Ala Pro Glu Leu Lys Asn Leu Gln Lys Leu Gln Thr Leu Ala Leu Asp

485 490 495

Ala Asn Gln Phe Val Gly Glu Ile Pro Gly Glu Val Phe Asp Leu Pro

500 505 510

Ala Leu Ile Lys Val Asn Leu Ser Gly Asn Asn Leu Thr Gly Glu Ile

515 520 525

Pro Glu Ser Val Ile His Cys Gly Ser Leu Thr Ala Val Asp Phe Ser

530 535 540

Arg Asn Met Leu Thr Gly Glu Ile Pro Lys Gly Ile Lys Ser Leu Thr

545 550 555 560

Val Leu Ser Ile Leu Asn Leu Ser Arg Asn His Ile Thr Gly Thr Val

565 570 575

Pro Asp Glu Ile Arg Phe Met Thr Ser Leu Asn Thr Leu Asp Leu Ser

580 585 590

Asn Asn Asn Phe Ile Gly Arg Val Pro Thr Gly Gly Gln Phe Val Ala

595 600 605

Phe Asn Asp Lys Ser Phe Ala Gly Asn Pro Asn Leu CysSer Pro His

610 615 620

Gln Pro Tyr Cys Pro Ser Ser Val Asn Thr Ala Ser Gly Lys Ser His

625 630 635 640

Asn Pro Leu Ser Ser Lys Ser Thr Lys Val Val Ile Ile Val Ile Gly

645 650 655

Ile Ser Thr Ala Val Leu Leu Ala Met Val Thr Val Tyr Ile Met Arg

660 665 670

Lys Arg Lys His Gln Lys Glu Met Ser Trp Lys Leu Thr Ala Phe Gln

675 680 685

Ser Thr Leu Lys Met Lys Ala Glu Glu Val Val Glu Cys Leu Lys Glu

690 695 700

Glu Asn Ile Ile Gly Lys Gly Gly Ala Gly Ile Val Tyr Arg Gly Thr

705 710 715 720

Thr Pro Lys Gly Thr Glu Val Ala Ile Lys Arg Leu Val Gly Gln Gly

725 730 735

Ser Gly Arg Asn Asp Tyr Gly Phe Lys Ala Glu Ile Glu Thr Leu Gly

740 745 750

Lys Ile Arg His Arg Asn Ile Met Arg Leu Leu Gly Tyr Val Ser Asn

755 760 765

Lys Asp Thr Asn Leu Leu Leu Tyr Glu Tyr Met Pro Asn Gly SerLeu

770 775 780

Gly Glu Trp Leu His Gly Ala Lys Gly Gly His Leu Thr Trp Glu Met

785 790 795 800

Arg Tyr Arg Ile Ala Val Glu Ala Ala Lys Gly Leu Cys Tyr Leu His

805 810 815

His Asp Cys Ser Pro Leu Ile Ile His Arg Asp Val Lys Ser Asn Asn

820 825 830

Ile Leu Leu Asp Glu Asp Phe Glu Ala His Val Ala Asp Phe Gly Leu

835 840 845

Ala Lys Phe Leu Gln Asp Pro Gly Ala Ser Gln Ser Met Ser Ser Ile

850 855 860

Ala Gly Ser Tyr Gly Tyr Ile Ala Pro Glu Tyr Ala Tyr Thr Leu Lys

865 870 875 880

Val Asp Glu Lys Ser Asp Val Tyr Ser Phe Gly Val Val Leu Leu Glu

885 890 895

Leu Ile Val Gly Arg Lys Pro Val Gly Glu Phe Gly Asp Gly Val Asp

900 905 910

Ile Val Gly Trp Val Asn Lys Thr Met Ser Glu Leu Ser Gln Pro Ser

915 920 925

Asp Ala Ala Ser Val Leu Ala Val Val Asp Pro Arg Leu Asn Gly Tyr

930 935 940

Pro Leu Gly Ser Val Ile His Met Phe Asn Ile Ala Met Met Cys Val

945 950 955 960

Arg Glu Ile Gly His Ala Arg Pro Thr Met Arg Glu Val Val Tyr Met

965 970 975

Leu Thr Asn Pro Pro Gln Ser Thr Thr His His Asn Leu Ile Asn Leu

980 985 990

<210>3

<211>20

<212>DNA

<213> Artificial sequence

<400>3

agcagactat ctaagggaag 20

<210>4

<211>27

<212>DNA

<213> Artificial sequence

<400>4

cttactccat ctgcttttct gatccac 27

<210>5

<211>29

<212>DNA

<213> Artificial sequence

<400>5

aagcagtggt atcaacgcag agtggccat 29

<210>6

<211>31

<212>DNA

<213> Artificial sequence

<220>

<221>misc_feature

<222>(30)..(31)

<223>n is a, c, g, or t

<400>6

attctagagg ccgaggcggc cgacatgdtn n 31

<210>7

<211>26

<212>DNA

<213> Artificial sequence

<400>7

cacacatttt ttgtgaatct ttcttc 26

<210>8

<211>20

<212>DNA

<213> Artificial sequence

<400>8

gctctaaagc aaatcttgac 20

<210>9

<211>36

<212>DNA

<213> Artificial sequence

<400>9

cggctctaga accatgaagc aaattctgat ggacag 36

<210>10

<211>31

<212>DNA

<213> Artificial sequence

<400>10

caacggtacc cataacattc tccaatggtt g 31

<210>11

<211>30

<212>DNA

<213> Artificial sequence

<400>11

caacactagt gagcttttgt aatatctgca 30

<210>12

<211>29

<212>DNA

<213> Artificial sequence

<400>12

aattggtacc gtctgttcca agagcttcc 29

<210>13

<211>29

<212>DNA

<213> Artificial sequence

<400>13

caactctaga gtccggtcat taagcttcc 29

<210>14

<211>30

<212>DNA

<213> Artificial sequence

<400>14

caacatcgat gacgctgatt taatttgtca 30

<210>15

<211>26

<212>DNA

<213> Artificial sequence

<400>15

tgatgtgata tctccactga cgtaag 26

<210>16

<211>20

<212>DNA

<213> Artificial sequence

<400>16

ataacattct ccaatggttg 20

<210>17

<211>26

<212>DNA

<213> Artificial sequence

<400>17

gatcgttcaa acatttggca ataaag 26

<210>18

<211>24

<212>DNA

<213> Artificial sequence

<400>18

ccgatctagt aacatagatg acac 24

Claims (2)

1. Ralstonia solanacearum induced up-regulation expression of LRR receptor protein kinase geneNtRLK2An RNAi interference vector for a gene characterized by: ralstonia solanacearum induced up-regulation expression of LRR receptor protein kinase geneNtRLK2The nucleotide sequence is shown as SEQ ID NO. 1; the RNAi interference vector has the structure shown in figure 3; the construction method of the RNAi interference vector comprises the following steps: in thatNtRLK2Two pairs of primers NtRLK 2-RNAi-SpeI-F are designed in the gene non-conserved region: 5'-CAACACTAGTGAGCTTTTGTAATATCTGCA-3' and NtRL 2-RNAi-Kpn I-R: 5'-AATTGGTACCGTCTGTTCCAAGAGCTTCC-3' and NtRKK 2-RNAi-Xba I-F: 5'-CAACTCTAGAGTCCGGTCATTAAGCTTCC-3' and NtRL 2-RNAi-Cla I-R: 5'-CAACATCGATGACGCTGATTTAATTTGTCA-3' amplified with the above two pairs of primers respectivelyNtRLK2The forward and reverse inserts of the gene were inserted into the constructed intermediate expression vector pSC1300-347 by double digestion and ligation to construct pSC1300-347-NtRLK 2.

2. The tobacco of claim 1, induced by ralstonia solanacearum to up-regulate expression of LRR receptor protein kinase geneNtRLK2The RNAi interference vector of the gene is applied to the bacterial wilt resistance of tobacco.

Images