CN111454999B

CN111454999B - Method for increasing content of cordyceps polysaccharide in cordyceps militaris

Info

Publication number: CN111454999B
Application number: CN202010127415.0A
Authority: CN
Inventors: 杨胜利; 杨锡; 陈萍; 季小康; 孔潇慧
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2020-02-28
Filing date: 2020-02-28
Publication date: 2022-12-09
Anticipated expiration: 2040-02-28
Also published as: CN111454999A

Abstract

The invention discloses a method for improving the content of cordyceps polysaccharide in cordyceps militaris, which comprises the following steps: inoculating the recombinant cordyceps militaris strain containing the target gene into a fermentation culture medium, culturing at 22-25 ℃ and 120-180 rpm by using a shaking table to obtain fermentation liquor containing cordyceps polysaccharide; the target gene is glucokinase gene gk, phosphoglucomutase gene pgm or pyrophosphorylase gene ugp. The gene mutant strain of the cordyceps militaris is obtained by a transgenic technology, and compared with an original strain, the mutant strain has the advantage that the yield of cordyceps polysaccharide in fermentation liquor is 1.35 times, so that a foundation is laid for further screening of excellent cordyceps militaris varieties.

Description

Method for increasing content of cordyceps polysaccharide in cordyceps militaris

(I) technical field

The invention relates to the field of cordyceps militaris cultivation, and in particular relates to a method for increasing the content of cordyceps polysaccharide in cordyceps militaris.

(II) background of the invention

As a traditional Chinese medicine, the research and application of cordyceps sinensis are always concerned. Cordyceps is a fungus-worm complex formed by parasitizing spores of fungi belonging to Ascomycoa, hypocrea, clavicipitaceae, cordyceps (Cordyceps) on insect larvae and growing fruit bodies from the bodies in summer. Among them, most notably Cordyceps sinensis (Ophio corpuscles sinsis) parasitizing on larvae of mountain bat moth (Hepialus armoricanus) and Cordyceps militaris (Cordyceps militaris) parasitizing on pupae of Lepidoptera. However, c.militaris is different from o.sinensis in that the fruiting body of c.militaris is easier to culture, and is a Cordyceps sinensis (cordyces) model strain, so it is often used as a main research object for various characteristics of Cordyceps sinensis by research teams. The natural active ingredients produced by cordyceps, such as mannitol, nucleoside, amino acid, ergosterol, cordycepic acid, cordycepin, cordyceps Polysaccharide (CP) and the like, have high medicinal value for various organisms, and particularly, the cordyceps polysaccharide has the effects of protecting kidney and liver, reducing blood sugar, resisting bacteria, inflammation, tumor and arrhythmia, improving the immunity of the organism and relieving the fatigue of the organism. Cordyceps polysaccharides are divided into two distinct classes, homo-CPS and heteropolysaccharide (hetero-CPS), based on monosaccharide composition. However, wild or natural cordyceps sinensis becomes more and more scarce due to the influence of factors such as production without consequences, geographical restrictions and adverse weather conditions, so that the large-scale culture and production of cordyceps sinensis mycelia to develop cordyceps sinensis polysaccharide as a new drug with wide application is an inevitable trend.

gk. pgm and ugp are three genes on a metabolic pathway for reacting glucose in cordyceps militaris to generate activated nucleotide sugar, and the three genes are confirmed in a cordyceps militaris genome sequence. The gk, pgm and ugp genes are amplified in cordyceps militaris cells and are introduced into the genome DNA of wild cordyceps militaris, and the yield of cordyceps polysaccharide is improved by over-expressing a target gene by using a strong promoter.

The over-expression of the gene of the polysaccharide synthesized by the cordyceps militaris to improve the yield of the polysaccharide of the cordyceps militaris has not been reported in documents.

Disclosure of the invention

The invention aims to provide a method for improving the content of cordyceps polysaccharide in cordyceps militaris, which obtains a gene mutant strain of cordyceps militaris by a transgenic technology, wherein compared with an original strain, the mutant strain has the advantage that the yield of the cordyceps polysaccharide in fermentation liquor is 1.35 times, and lays a foundation for further screening excellent cordyceps militaris varieties.

The technical scheme adopted by the invention is as follows:

the invention provides a method for improving the content of cordyceps polysaccharide in cordyceps militaris, which comprises the following steps: inoculating the recombinant cordyceps militaris strain containing the target gene into a fermentation culture medium, culturing at 22-25 ℃ and 120-180 rpm by using a shaking table to obtain fermentation liquor containing cordyceps polysaccharide; the fermentation culture medium comprises the following components in percentage by weight: 2% glucose, 0.70% (NH) ₄ ) ₂ SO ₄ ，0.05％K ₂ HPO ₄ ·3H ₂ O，0.05％KH ₂ PO ₄ ，0.05％MgSO ₄ ·7H ₂ 0.10% by weight of L-glycine, the solvent is distilled water, and the pH is natural; the target gene is glucokinase (glucokinase) gene gk, phosphoglucomutase (phosphoglucomutase) gene pgm or pyrophosphorylase (pyrophosphorylase) gene ugp.

Further, the nucleotide sequence of the glucokinase gene gk is shown as SEQ ID NO. 1; the nucleotide sequence of phosphoglucomutase gene pgm is shown as SEQ ID NO. 2; the nucleotide sequence of pyrophosphorylase gene ugp is shown in SEQ ID NO. 3.

Further, the recombinant cordyceps militaris strain containing the target gene is prepared by the following method: closely attaching a sterile cellulose film to the surface of a co-culture solid culture medium, mixing a cordyceps militaris spore suspension and an agrobacterium liquid containing a target gene in equal volume, coating the mixture on the sterile cellulose film, carrying out 24-DEG C constant-temperature dark co-culture for 48h, transferring the mixed liquid and the cellulose film to a selective culture medium, closely attaching the cellulose film to the sterile cellulose film without bubbles, pouring a layer of selective culture medium on the surface of the closely attached cellulose film, completely covering the cellulose film, and carrying out 22-25 ℃ (preferably 25 ℃) constant-temperature dark culture; inoculating the mycelium penetrating the upper layer selection culture medium to a subculture medium, culturing at 22-25 deg.C in the dark at constant temperature for 3-4 d (preferably 25 deg.C for 4 days, and subculturing for 5 times), and screening to obtain the final product containing the target geneThe cordyceps militaris; the co-culture solid culture medium is IM +200 mmol.L ^-1 AS (acetosyringone); the selective medium is IM (agar mass concentration of 1.5%) +200 mg. Multidot.L ^-1 Hyg B (hygromycin) +200 mg. L ^-1 Cephalosporin +100 mg. L ^-1 Kan (kanamycin); the subculture medium is Sabouraud medium (Sabouraud medium) +200 mg. L ^-1 Hyg B。

Further, the cellulose film is selected from cellophane (cellophane), nitrocellulose film, etc., preferably cellophane.

Further, the Cordyceps militaris spore suspension is glycerol cryopreserved spore suspension or freshly prepared spore suspension, and the concentration is 10 ⁶ ～10 ⁸ ·mL ^-1 Preferably 10 ⁶ ·mL ^-1 。

Further, the cordyceps militaris spore suspension is prepared by the following method: inoculating Cordyceps militaris CM-001 (Cordyceps militaris) to PDA culture medium, culturing at 24 deg.C in dark place for 7 days, repeatedly washing the surface of PDA culture medium with sterile water on a clean bench to obtain Cordyceps militaris suspension, and filtering with 4 layers of gauze to remove mycelium to obtain Cordyceps militaris spore suspension.

Further, the target gene-containing agrobacterium liquid OD600=0.80, and the target gene-containing agrobacterium liquid is prepared by the following method: inoculating agrobacterium of a target gene to a solid bacterial culture medium by streaking, culturing at the constant temperature of 28 ℃ for 48h, then selecting a single colony to be inoculated to a liquid bacterial culture medium, culturing at the constant temperature of 180rpm and 28 ℃ for 36h, then inoculating the single colony to an agrobacterium pre-culture liquid culture medium, and culturing at the constant temperature of 180rpm and 28 ℃ for 6-8 h until the thallus concentration OD600=0.80 to obtain agrobacterium liquid; the solid bacterial culture medium is LB solid +25 mg.L ^-1 Rif+50mg·L ^-1 Kan (rifampin); the liquid bacterial culture medium is LB liquid plus 25 mg.L ^-1 Rif+50mg·L ^-1 Kan; the liquid culture medium for the agrobacterium preculture is IM +200 mmol. L ^-1 AS (acetosyringone).

Further, the Agrobacterium is Agrobacterium tumefaciens AGL-1.

Furthermore, the upper surface and the lower surface of the cellulose film are both provided with a layer of 1.5-2.5 mm (preferably 2.0 mm) of selective culture medium.

Further, the cephalosporin is selected from any one of cefalotin sodium, cefalexin, ceftriaxone sodium and ampicillin.

Compared with the prior art, the invention has the following beneficial effects: the gene mutant strain of the cordyceps militaris is obtained by a transgenic technology, and compared with an original strain, the mutant strain has the advantage that the yield of cordyceps polysaccharide in fermentation liquor is 1.35 times, so that a foundation is laid for further screening of excellent varieties of the cordyceps militaris.

Description of the drawings

FIG. 1 is a schematic diagram of the construction of the recombinant vector of the present invention.

FIG. 2 is a PCR identification chart of the gene mutation strain of the invention, wherein M is marker, parallel 1-4 is gk, parallel 5-8 is pgm, parallel 9-12 is ugp, WT is original strain.

FIG. 3 shows the contents of Cordyceps sinensis polysaccharides detected by the phenol sulfate method of the mutant strains and the original strains of the invention.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

the embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.

Example 1 recombinant Cordyceps militaris strains containing Gene gk

TABLE 1 sources of materials

TABLE 2 respective culture Medium quantity Components

The PDA culture medium comprises the following components: 200g/L of potato, 20g/L of glucose, 15-20 g/L of agar, distilled water as a solvent and natural pH.

The LB liquid culture medium comprises: 10g/L of tryptone, 5g/L of yeast extract, 10g/L of NaCl and distilled water as a solvent, and the pH value is 7.0.

The LB solid medium consists of: 10g/L of tryptone, 5g/L of yeast extract, 10g/L of NaCl, 15-20 g/L of agar, distilled water as solvent and pH7.0.

The composition of the IM medium is as follows: 0.145% of KH ₂ PO ₄ ，0.205％K ₂ HPO ₄ ，0.06％MgSO ₄ ·7H ₂ O，0.03％NaCl，0.01‰CaCl ₂ ，0.001‰FeSO ₄ ，0.05％NH ₄ NO ₃ 5mL/L of glycerol, 0.2% of glucose, 5mL/L of trace element stock solution, 40mL/L of MES buffer solution (1 mol/L, pH = 5.5) and distilled water as a solvent; each 10ml of the microelement stock solution comprises the following components: znSO ₄ ·7H ₂ O 0.001g，CuSO ₄ ·5H ₂ O 0.001g，H ₃ BO ₄ 0.001g，(NH ₄ ) ₂ SO ₄ 0.5g，MnSO ₄ ·H ₂ O 0.001g，NaMoO ₄ ·H ₂ 0.001g of O, and the solvent is distilled water.

The composition of the Sabouraud's medium is as follows: 10g/L of peptone, 20g/L of agar, 40g/L of glucose and distilled water as a solvent, wherein the pH is natural.

1. Construction of recombinant vectors

Extracting cordyceps militaris genome DNA: inoculating Cordyceps militaris (Cordyceps militaris) CGMCC 3.14242 in PDA culture medium, and culturing in a constant temperature incubator at 25 deg.C for 7d in an inverted manner. The fungal genome DNA rapid extraction kit (purchased from Biotechnology engineering (Shanghai) GmbH, product number: B518229) and related operation instructions are adopted to extract the genome DNA: (1) taking 50-100mg of fresh fungus or 20mg of dried fruit bodies or hyphae, fully grinding the fungus or the dried fruit bodies or the hyphae in liquid nitrogen into powder, putting the powder into a 1.5mL centrifuge tube, sequentially adding 400 mu L of Buffer Digestion and 4 mu L of beta-mercaptoethanol, and shaking and uniformly mixing the mixture. The cells were completely lysed by a water bath at 65 ℃ for 1 h. (2) Add 200. Mu.l Buffer PF, mix well by inversion, -20 ℃ refrigerator for 5min. (3) Centrifuge at 10000rpm for 5min at room temperature, and transfer the supernatant (500-550. Mu.l) to a new 1.5ml centrifuge tube. (4) Adding isopropanol with the same volume, reversing for 5-8 times to fully and uniformly mix, and standing for 2-3 min at room temperature. Centrifuge at 10000rpm for 5min at room temperature, and discard the supernatant. (5) Adding 1ml of 75% ethanol, reversely rinsing for 1-3min, centrifuging at 10,000rpm for 2min, and discarding the supernatant. (6) Repeating the step (5) once. (7) And opening the cover and inverting the cover for 5-10 min at room temperature until the residual ethanol is completely volatilized. (8) The resulting DNA was dissolved in 50-100. Mu.l of TE Buffer. The extracted DNA can be immediately subjected to the next experiment or stored at-20 ℃.

PCR amplification is carried out by using a primer gk-F1/gk-R1 in Table 3 to obtain glucokinase gene gk (nucleotide is shown as SEQ ID NO. 1) on the genomic DNA of cordyceps militaris, and the nucleotide is utilized

The UniSeamless Cloning and Assembly Kit links the target gene fragment with the vector PCAMBIA-PgpdA-Tcbh1-hph-PtrpC to obtain the recombinant vector PCAMBIA-PgpdA-gk-Tcbh1-hph-PtrpC, as shown in FIG. 1.

TABLE 3 primers

TABLE 4 PCR reaction System

Reaction procedure: pre-denaturation at 98 ℃ for 3min, denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 10s, extension at 72 ℃ for 30s,3 cycles, denaturation at 98 ℃ for 10s, annealing at 65 ℃ for 10s, extension at 72 ℃ for 30s,27 cycles, supplementation at 72 ℃ for 10min, and low-temperature preservation at 4 ℃.

2. Transformation of E.coli DH 5. Alpha

Adding 6 μ L of the constructed recombinant vector into 100 μ L of Escherichia coli DH 5 α competence, and standing on ice for 30min; heat shock is carried out in 42 ℃ water bath for 30s, and the mixture is cooled for 2min on ice; adding 800 μ L LB liquid culture medium into the competence, culturing at 37 deg.C and 180rpm, shaking for 1h; centrifuging at 3500rpm for 10min, discarding supernatant on a super clean bench, and keeping 100 μ L of bacterial liquid; the re-suspended bacterial liquid is coated on an escherichia coli culture medium and cultured for 24h at 37 ℃. Single colonies were picked and verified by PCR with HF-check/HR-check primers to check if the transformation was successful.

Inoculating Escherichia coli positive clone into Escherichia coli liquid culture medium, extracting plasmid DNA with SanPrep column type plasmid DNA small amount extraction kit, and extracting DNA with 35 μ L ddH ₂ And dissolving the O. The extracted DNA can be immediately subjected to the next experiment or stored at-20 ℃.

3. Transformation of Agrobacterium tumefaciens

Adding 5 mu L of the plasmid DNA solution extracted in the step 2 into 100 mu L of AGL-1 competence of Agrobacterium tumefaciens (Agrobacterium tumefaciens), freezing with liquid nitrogen for 8s, and carrying out water bath at 37 ℃ for 5min; adding 800 μ L LB liquid culture medium into the competence, culturing at 28 deg.C and 180rpm, shaking for 1h; centrifuging at 3500rpm for 10min, discarding supernatant on a super clean bench, and keeping 100 μ L of bacterial liquid; the heavy suspension liquid is coated on an agrobacterium culture medium and cultured for 36h at 28 ℃. And selecting a single colony, carrying out PCR verification by using an HF-check/HR-check primer, checking whether the transformation is successful or not, and screening positive clones.

4. Transformation in homologous recombinant vector Cordyceps militaris

(1) Agrobacterium tumefaciens mediated genetic transformation of filamentous fungi

Single colonies were picked from the Agrobacterium culture medium of step 3 and inoculated into 3mL of liquid LB medium (50 mg. L) ^-1 Kan), 28 ℃,180rpm, shake culture for 36h. Transferring the strain into an agrobacterium tumefaciens pre-culture liquid culture medium, culturing at constant temperature of 28 ℃ and 180rpm for 6-8 h, wherein the thallus concentration is OD OD600=0.80, and an agrobacterium liquid is obtained.

(2) Cordyceps militaris spore suspension

Inoculating Cordyceps militaris CM-001 (Cordyceps militaris) to PDA culture medium, culturing at 24 deg.C in dark for 7 days, and repeatedly washing the surface of PDA culture medium with sterile water on a clean bench to obtain Cordyceps militaris suspension. Filtering the bacterial suspension with 4 layers of gauze to remove mycelium, and obtaining cordyceps militaris spore suspension. And (3) taking trace cordyceps militaris spore suspension, and determining the concentration of cordyceps militaris spores in the spore suspension by using a blood counting plate.

(3) Transformation of

200 μ L of the concentration of the step (2) is 10 ⁶ And (3) uniformly mixing the/mL cordyceps militaris spore suspension and the Agrobacterium tumefaciens bacterial liquid with OD600=0.80 in the step (1) in equal volume to obtain a mixed bacterial liquid.

Closely attaching sterile cellophane to the surface of a co-culture solid culture medium, uniformly coating mixed bacteria liquid on the surface of the cellophane, carrying out constant-temperature light-proof co-culture at 24 ℃ for 48 hours, transferring the mixed bacteria liquid together with the cellophane to the surface of a selective culture medium (the coating strain side is upward, and the thickness of the culture medium is 2 mm), pouring a layer of selective culture medium on the surface of the cellophane to completely cover the cellophane (the thickness of the culture medium is 2 mm), carrying out constant-temperature light-proof culture at 25 ℃ for 4 days, allowing the cordyceps militaris hygromycin-resistant strain hyphae to penetrate through the upper selective culture medium, picking up the hyphae penetrating through the selective culture medium, inoculating the hyphae to a subculture medium, carrying out constant-temperature light-proof culture at 25 ℃ for 4 days, carrying out transfer culture on the next generation after the hyphae grows out, and carrying out co-culture for five generations to obtain the cordyceps militaris hygromycin-resistant strain, namely the recombinant strain cordyceps militaris (cordyceps militaris containing the gene gk (shown in SEQ ID NO. 1).

(4) Identification of hygromycin-resistant strain gene of cordyceps militaris

Extracting Cordyceps militaris hygromycin resistant strain genome DNA, and dissolving the obtained DNA with 50-100 mu l of TE Buffer. The extracted DNA can be immediately subjected to the next experiment or stored at-20 ℃. Taking the extracted genome DNA of the hygromycin-resistant strain of the cordyceps militaris, carrying out PCR (polymerase chain reaction) verification by using an HF-check/HR-check primer, and checking whether the transformation is successful or not, wherein the result is shown in figure 2.

(5) Detection of polysaccharide content in transgenic strain

Collecting Cordyceps militaris CM-001 (WT in figure 3) and Cordyceps militaris tide respectivelyFresh spore suspension of a mycin-resistant strain, concentration 10 ⁶ Perml, 500. Mu.L of the suspension was inoculated into a fermentation medium, incubated at 25 ℃ and 120rpm for 7 days with shaking.

20 mu L of fermentation liquor is taken and diluted to 5mL by deionized water, the total sugar content is determined by a sulfuric acid-phenol method (concentrated sulfuric acid is 5mL,5% phenol is 1mL, and a sample is 1 mL), and the determination is repeated for three times.

Diluting 50 μ L of fermentation liquid with deionized water to 1mL, determining glucose residue concentration by DNS method (DNS reagent 0.5mL, water 0.25mL, sample 0.25mL, boiling water bath 5min, constant volume to 5 mL), and repeating determination for three times. The total sugar content minus the glucose residue content resulted in the cordycepic polysaccharide content, which is shown in table 7 and fig. 3.

Example 2 recombinant Cordyceps militaris strains containing the Gene pgm

The extraction of the genomic DNA of the Cordyceps militaris CGMCC 3.14242 is the same as that in example 1.

Amplifying by using a primer pgm-F2/pgm-R2 to obtain a phosphoglucose mutase gene pgm (SEQ ID NO. 2) on the genomic DNA of the cordyceps militaris, and amplifying by using the primer pgm-F2/pgm-R2

Linking the target gene fragment with the plasmid by the Uni Seamless Cloning and Assembly Kit to obtain the recombinant vector PCAMBIA-PgpdA-pgm-Tcbh1-hph-PtrpC.

TABLE 5 primers

Other operations are the same as the embodiment 1, the recombinant cordyceps militaris strain containing gene pgm is obtained, the extracted genomic DNA of the hygromycin resistant strain of cordyceps militaris is taken, the HF-check/HR-check primer is used for carrying out PCR verification, and whether the transformation is successful or not is checked, wherein the result is shown in figure 2; and (3) measuring the total sugar content and the glucose residue concentration of the transgenic strain. The total sugar content minus the glucose residue content gave the cordycepic polysaccharide content, which is shown in table 7 and fig. 3.

Example 3 recombinant Cordyceps militaris Strain containing Gene ugp

Amplifying by using primer ugp-F3/ugp-R3 to obtain pyrophosphorylase gene ugp on Cordyceps militaris genome DNA, and amplifying by using primer ugp-F3/ugp-R3

Linking the target gene fragment with the plasmid by the Uni Seamless Cloning and Assembly Kit to obtain the recombinant vector PCAMBIA-PgpdA-ugp-Tcbh1-hph-PtrpC.

TABLE 6 primers

ugp-F3	GCAGACATCACAATGGTTGTGGCAGGGGGGAGGAGGG
		ugp-R3	TTTCGCCACGGAGCTTAATGCTCAAGCAGGCGTAGCGAG
Plasmid-F	AGCTCCGTGGCGAAAGCCTGACGCA
		Plasmid-R	CATTGTGATGTCTGCTCAAGCGGGGT
HF-check	CTATTCCTTTGCCCTCGGACGA
		HR-check	ATGCCTGAACTCACCGCGACGT

Other operations are the same as example 1, a recombinant cordyceps militaris strain containing gene ugp is obtained, extracted genomic DNA of the hygromycin-resistant cordyceps militaris strain is subjected to PCR verification by using HF-check/HR-check primers, and whether the transformation is successful is checked, wherein the result is shown in figure 2; and (3) measuring the total sugar content and the glucose residue concentration of the transgenic strain. The total sugar content minus the glucose residue content resulted in the cordycepic polysaccharide content, which is shown in table 7 and fig. 3.

TABLE 7 Cordyceps polysaccharide content of Cordyceps militaris transgenic strain and Cordyceps militaris original strain

gk(g·L ^-1 )	pgm(g·L ^-1 )	ugp(g·L ^-1 )	Cordyceps.militaris WT(g·L ^-1 )
				4.25	4.68	3.91	3.67
3.72	4.85	3.53	3.31
				4.05	4.39	3.75	3.39

Sequence listing

<110> Zhejiang industrial university

<120> method for increasing content of cordyceps polysaccharide in cordyceps militaris

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1650

<212> DNA

<213> Unknown (Unknown)

<400> 1

atgggcctgc aagaagaaac caaaaaggtc gtgtcgcagt ttgaattctc cgacgcagac 60

atcaacatcc atgtcgccga attcattcag cagatgaaca ctggtctcga gcaggatggc 120

accagcgtta gccagatccc gacctacgtc actgccgtcc ccaatggcac tgaaaagggg 180

ctctatcttg ccgtcgacct cggtggcacc aacttccgcg tctgctccat catgctcaat 240

ggtgacacca ccttcaacct gacctacaac aaggttgcca tccccaagga actcatggtt 300

gccaagacag ccaaggagct ctttgctttc cttgctaagc agatcgagct cttccttcgc 360

gaacaccacg ccgatcactt cgaaagccac gtccgccgac gccacacggc cagcactccc 420

ctgggctacc gcgacgaaca cattttccgc cttggcttca cctttagctt ccctgtccag 480

cagcttggaa tcaataaggg taagcttatc cgatggacca agggcttcga tattcctgat 540

gccattggca aggatgtttg cgctctgctc caagacgaga ttgacagact gcgactcccc 600

gtcaaggtcg ctgcgctcgt caacgacact gtcggaaccc tcatggcccg ctcctatacc 660

tcagtcggca aacaccaatc gattctcggc gctatttttg gcaccggtac caatggtgcg 720

tacatggaaa agacttccaa gatcaagaag cccattaccg gcgaatacga cacttctact 780

ggtgaaatgg ttgtcaacac cgaatggggc tcgttcgaca accagctcaa cgttcttccc 840

gtcacacctt gggacaagaa gcttgaccag gatagtgtga acaaaggctt ccaaatgttt 900

gagaagcgca tctctggcat gtttctcggt gagattgtgc gattggctat cgtagacatg 960

cttgaaaata aatctaccgg ccttttccag gacaccaact ccagcttcaa cgatcgcgtc 1020

accaccacca gcattgaccc caagtctctg ctcttcaagc agtggggctt ggacagtgct 1080

gtcatgtcgg tcgccgccag cgacaacacc cctgagcttt ccaccctgcg acaggagttg 1140

gaaaatactt tgggcgtgta ctctgcctcg ctcgaggacg cgcaggcgtt caaggccatc 1200

tccaacgcag tcgcgcgccg cgccgctcga ctttctgctg tcgccattgg tgctattgcc 1260

atccagtccg gcaaacttga ggattctgag tgcgagctta tcgatatcgg tgtggatggt 1320

agtcttgttg agcactaccc cttcttccgc gacatgattt acgaagctct ccgagtgacg 1380

gacagcatcg gccctaaggg cgctgataag attcgcatcg gtattgccaa ggatggaagc 1440

ggtgttggcg ctgctttaat tgcgttggtt gctgctagcc gcgagcagcc tggcgatttc 1500

ctggccgact tgcgtaccga tatcaagcgc ggccttgacc gtcttcccca acacatcgag 1560

gagtcgcccc tgtcgaacaa tgctgtgctt gccattggcg ccgccgcagc cattggtgtt 1620

gcggcgttgt ggtactggag gcgtcattag 1650

<210> 2

<211> 1662

<212> DNA

<213> Unknown (Unknown)

<400> 2

atggacgtca agactgttga gtttaagcct ttccaggacc aaaaggctgg cacctccggt 60

cttcgcaaga aggtcaccac cttccagcag gcccactaca gcgagtcttt cgttgccagc 120

cttctcctct ccatccccga aggtgtcgag ggatcctttc tcgtcatcgg tggtgatggc 180

cgctactgga accccgaggt gatccagctg attgccaaga ttggtgccgc gtacggcgtc 240

aagaagctcc tcatcggcca aaatggcatc ctgtcaaccc cggctgcgag ccatgtcatc 300

cgccttcgca aggctaccgg tggtatcctt ctgactgcca gtcacaaccc cggcggcccc 360

aaggaagact ttggcatcaa atacaacctg gccaacggtg gccccgcccc cgagtccgtg 420

acgaacaaga tctttgagac ttccaagact ttgacctcct ataagatcac ctctatcccc 480

gacattgaca ttgtcactat tggcacccag acctacggtg ctctcgaggt ggagattatt 540

gacagcacgg ccgactacgt cgctatgctc aaggacattt tcgactttgg caccatcaag 600

aagtttttcg cttcgcaccc cgacttcaag gttctctttg acggtcttca cggcgtcact 660

ggcccttatg gaaccgccat tttcgaaaag gagcttggtc ttactggcgc cacccagaac 720

tgcgtgccta gccccgactt caacggcggt caccccgatc ccaacctggt ctacgcccac 780

tctctcgtcg aagttgtcga caagcacaac attccctttg gcgccgcctc ggacggcgac 840

ggcgaccgca acatgattta cggtgccaat gcctttgtct cgcccggcga ctccctcgcc 900

atcatcgctc accacgccaa gctcattccc tacttccaga agcacggtgt taacggcctg 960

gcccgctcca tgcccacctc gggcgctgtt gacctcgtcg ccaaggcgca gggtctcgac 1020

tgctacgagg tccccaccgg ctggaagttc ttctgcgccc tctttgacgc caagaagctg 1080

tccatctgcg gcgaggagag cttcggcacg ggcagcgacc acattcgtga aaaggacggt 1140

ctctgggccg ttgtcgcctg gctcaacatc attgccgccc tcggtgtgca gaaccccgag 1200

tctacccctt ccatcaagca gatccaaaag gacttttgga cgcaatacgg acgcacattc 1260

ttcacccgct acgactacga gaatgttgac tccgacggtg ccaacaaggt tgttggcgag 1320

ctgcaggcgc tggtggctaa ccccaacact gtcggcagca agattggcga gcgcaccgtc 1380

actgccgctg gcaacttctc ctacaccgac ctcgacggct ccgtctcgtc taaccagggt 1440

ctctacgcca ccttttcctc tggcagccgc atcgtcgttc gtctctccgg caccggctcc 1500

tccggcgcga ccatccgtct ctacctcgag cagcacagca gcgaccccgc cacatacgac 1560

ctggatgccc aggacttcct caaggccgag gtcaagtttg ccacggagct tctcaagttc 1620

aaggagcatg tcggccgcga cgagcctaat gtccgcactt ga 1662

<210> 3

<211> 1659

<212> DNA

<213> Unknown (Unknown)

<400> 3

atggttgtgg caggggggag gagggttaca gtgcagaaga gaatcacggc taccgatatc 60

tccaaacctc ccaaggtatt agttaggtac tccaagagtg ctcttccctc tcacctccgt 120

cctaccgcca ctggcaagga cgaggagaac aatggtttcg agaagcgtca tcacggcaag 180

acgcgcagcc acatggcctt tgagaacacc tctaccaatg ttgccgcggc ccagatgcgc 240

aatgccctca caaacctcgc cgagacggtc gaggacccca agcagaagaa gctcttcgaa 300

accgaaatgg acaacttctt cgctctcttc cgccgctact tgaacgacaa ggccaaggga 360

aacgtcgttg actgggaacg catccgcccc cctgctgccg gccaggtcgt cgactatgag 420

gacctcgcca actccgagtc agttcagttt ctcaacaagc ttgccgtcct caagctcaat 480

ggtggtctcg gtacctccat gggctgcgtt ggccccaagt ccgtcattga ggtccgcgac 540

ggcatgtcct tcctcgacct ttccgtccgt cagatcgagt tcctcaaccg cacatacgac 600

gtcaatgtcc ctttcctcct catgaactcg ttcaacacca acgacgatac cgctgccatc 660

atcaagaagt acgagggcca caacgtcgat atcctcacct tcaaccagtc ccgctacccc 720

agaatcttca aggactctca gctccctgtt cccagcaact acaactcggc cattagcgag 780

tggtaccctc ctggtcacgg tgacgtcttc gagtctctct acaactctgg tgttctagac 840

cagctcctcg agcgcggcat cgagatcatc ttcctctcca acgttgataa cctgggtgcc 900

gtagttgacc tgcgcatcct acagcacatg atggagacca aggccgagta cattatggaa 960

ctcaccaaca agaccaaggc cgacgttaag ggtggtacta ttatcgacta tgatggctcc 1020

gtccgcctgc tcgaaatcgc ccaggttccc aaggagcacg tgaatgactt caagtcgatt 1080

aagaagttca agtacttcaa caccaacaac atctggctca acctccgtgc tatcaagcgc 1140

gttgtcgaga acgacgagct tgagatggag attattccca atgccaagac catccctggc 1200

gacaagaagg gcgagtctga catttccatt atgcagctcg agactgctgt cggcgccgct 1260

attcgccact tcaaaaatgc ccacggtgtc aacgtccccc gtcgccgctt ccttcccgtc 1320

aagacatgct cggacctcat gctggtcaag tccgatctct acactctcaa gcacggtcag 1380

ctccagatga gcgccaaccg cttcggtgat gctcccctta tcaagcttgg tagcgacttc 1440

aagaaggtct ccgacttcca gaagcacatt ccttctatcc ccaaggttct cgagctggac 1500

cacctgacca tcaccggtgc tgtgaacctg ggccgtggtg tcacgctcaa gggcactgtt 1560

attattgtcg ccaccgaggg aagcaccatt gatatccccc ccggctctat tctcgaaaac 1620

gtcgtcgttc agggctcgct acgcctgctt gagcattaa 1659

Claims

1. A method for improving the content of cordyceps polysaccharide in cordyceps militaris is characterized by comprising the following steps: inoculating cordyceps militaris recombinant bacteria of over-expressed target genes into a fermentation culture medium, culturing at 22-25 ℃ and 120-180 rpm by using a shaking table to obtain fermentation liquor containing cordyceps polysaccharide; the fermentation culture medium comprises the following components in percentage by weight: 2% glucose, 0.70% (NH) ₄ ) ₂ SO ₄ ，0.05％K ₂ HPO ₄ ·3H ₂ O，0.05％KH ₂ PO ₄ ，0.05％MgSO ₄ ·7H ₂ O,0.10% l-glycine, solvent distilled water, pH natural; the target gene is a glucokinase gene gk;

the recombinant cordyceps militaris strain for over-expressing the target gene is prepared by the following method: by using

Linking the target gene fragment with a vector PCAMBIA-PgpdA-Tcbh1-hph-PtrpC by the Uni Seamless Cloning and Assembly Kit to obtain a recombinant vector PCAMBIA-PgpdA-gk-Tcbh1-hph-PtrpC; adding the recombinant vector into the escherichia coli DH 5 alpha competence, extracting plasmid DNA, and transforming agrobacterium tumefaciens to obtain agrobacterium liquid containing a target gene; closely attaching an aseptic cellulose film to the surface of a co-culture solid culture medium, then mixing the cordyceps militaris spore suspension and the agrobacterium liquid containing a target gene in equal volume, coating the mixture on the aseptic cellulose film, carrying out 24-DEG C constant-temperature light-resistant co-culture for 48 hours, transferring the mixed liquid and the cellulose film to a selective culture medium, closely attaching the cellulose film to a bubble-free state, pouring a layer of selective culture medium on the surface of the closely attached cellulose film, completely covering the cellulose film, and carrying out 22-25-DEG C constant-temperature light-resistant culture; transferring hypha penetrating through the upper layer selection culture medium into a subculture medium, culturing at the constant temperature of 22-25 ℃ for 3-4 days in a dark place, and screening to obtain cordyceps militaris recombinant bacteria over-expressing target genes; the co-culture solid culture medium is IM +200 mmol.L ^-1 Acetosyringone; the selection medium is IM +200 mg.L ^-1 Hygromycin B +200 mg. L ^-1 Cephalosporin +100 mg. L ^-1 Kanamycin; the subculture medium is a Sabouraud's medium +200 mg. L ^-1 Hygromycin B.

2. The method of claim 1, wherein the glucokinase gene gk has the nucleotide sequence shown in SEQ ID No. 1.

3. The method of claim 1, wherein the Cordyceps militaris spore suspension has a concentration of 10 ⁶ ～10 ⁸ ·mL ^-1 。

4. The method of claim 1, wherein the cordyceps militaris spore suspension is prepared as follows: inoculating Cordyceps militaris (Cordyceps militaris) to PDA culture medium, culturing at 24 deg.C in dark place for 7 days, repeatedly washing the surface of PDA culture medium with sterile water on a clean bench to obtain Cordyceps militaris suspension, and filtering the suspension with 4 layers of gauze to remove mycelium to obtain Cordyceps militaris spore suspension.

5. The method according to claim 1, wherein the agrobacterium strain solution containing the target gene has OD600=0.80.

6. The method of claim 1, wherein the agrobacterium solution containing the target gene is prepared by the following method: inoculating agrobacterium of a target gene to a solid bacterial culture medium by streaking, culturing for 48h at the constant temperature of 28 ℃, then selecting a single colony to be inoculated to a liquid bacterial culture medium, culturing for 36h at the constant temperature of 180rpm and 28 ℃, then inoculating the single colony to an agrobacterium preculture liquid culture medium, and culturing for 6-8 h at the constant temperature of 180rpm and 28 ℃ until the thallus concentration OD600=0.80 to obtain agrobacterium liquid; the solid bacteria culture medium is LB solid plus 25 mg.L ^-1 Rifampicin +50 mg. L ^-1 Kan kanamycin; the liquid bacterial culture medium is LB liquid plus 25 mg.L ^-1 Rifampicin +50 mg. L ^-1 Kanamycin; the liquid culture medium for the agrobacterium tumefaciens preculture is IM +200 mmol.L ^-1 Acetosyringone.

7. The method according to claim 1, wherein the Agrobacterium is Agrobacterium tumefaciens (Agrobacterium tumefaciens) AGL-1.