WO2019051852A1

WO2019051852A1 - Recombinant metarhizium acridum, preparation method therefor and use thereof

Info

Publication number: WO2019051852A1
Application number: PCT/CN2017/102276
Authority: WO
Inventors: 王云丹; 胡帅; 康乐
Original assignee: 中国科学院动物研究所
Priority date: 2017-09-12
Filing date: 2017-09-19
Publication date: 2019-03-21
Also published as: CN107502562A; CN107502562B; AU2017431448B2; AU2017431448A1

Abstract

Disclosed is a recombinant Metarhizium acridum capable of expressing phosphoglycerate kinase. The gene introduced in the recombinant Metarhizium acridum is the phosphoglycerate kinase gene, which can significantly increase the concentration of fructose-6-phosphate in the obligate bacterium, Metarhizium acridum, and significantly improve the insecticidal efficiency such that the median lethal time, LT50, of Metarhizium acridum is reduced from 7.045 ± 0.211 days to 5.617 ± 0.187 days. In addition, the recombinant Metarhizium acridum is harmless to the environment, biologically safe and non-toxic to humans.

Description

Recombinant Metarhizium anisopliae and preparation method and application thereof

Technical field

The invention relates to a transgenic strain, a preparation method thereof and a use thereof, in particular to a recombinant microorganism of the genus Metarhizium capable of improving the insecticidal efficiency of the obligate bacteria, and the preparation method and application thereof.

Background technique

Insect pathogenic fungi, compared with chemical pesticides, have the advantages of environmental friendliness, strong resistance, large amount of diffusion, and high selectivity. They are widely used as biological pesticides. However, current entomopathogenic fungi as insecticides still have the disadvantage of a longer lethal time. It is an important research direction to study the pathogenesis of fungi and to use genetic engineering to transform fungi and improve the effect of fungal insecticides. E.g:

1. A hydrolase-like gene secreted by a fungus. Overexpression of body wall degrading proteases such as subtilisins Pr1A can increase the rate of fungal penetration into the body wall, significantly increase the virulence of Metarhizium anisopliae, accelerate the rate of lethality and activate the polyphenol oxidase system in the blood cavity. As a result, the worm body is rapidly blackened, the death time of the tobacco hawk moth is reduced by 25%, and the feeding rate of the pest is also reduced by 40%. Fang et al. transferred the chitin hydrolase Bbchitl gene into the Beauveria bassiana genome to obtain an overexpressed engineering strain. The virulence of the engineering strain to the aphids was significantly enhanced. Compared with wild strains, the engineered strain reduced the lethal dose of aphids by 50% and the lethal time by 50%.

2. Modification of fungal metabolic genes. Xia et al. transformed the broad-spectrum Metarhizium by constructing a fungal acid trehalose degrading enzyme (ATM) overexpression vector, enhanced the fungal metabolism of trehalose in the host hemolymph, and promoted the growth of broad-spectrum Metarhizium in insects.

3. Introduction of foreign genes. Androctonus australis neurotoxin AaIT is a specific neurotoxin of Lepidoptera and Diptera. Wang et al. introduced this gene into Metarhizium anisopliae to specifically express neurotoxin in the host blood cavity, and the modified fungus increased the toxicity of Tobacco hawk moth by 22 times.

4. Express genes associated with immunity. Yang et al. expressed the serine inhibitory enzyme Spn43Ac in the Toll signaling pathway of the insect congenital immune recognition pathway in Beauveria bassiana, which reduced the semi-lethal time of the peach aphid by 24% and the mortality rate by 2 times. Fan et al. introduced the Glucose-frustose oxidoreductase GFOR gene into Beauveria bassiana, and the constructed transgenic engineered bacteria can inhibit the host Gram-negative bacterial binding protein (Gram) by synthesizing gluconolactone (GDL). The activity of -negative alcohol binding proteins (GNBPs) inhibits the host's immune response, reducing the lethal time of the fungus by 48 hours, and improving the insecticidal effect.

However, there are still some shortcomings in the current genetic engineering methods to transform fungi. For example, the Chinese Patent Application No. CN101755050 discloses that an optimized polynucleotide sequence encoding the Androctonus australis neurotoxin AaIT is introduced into Metarhizium anisopliae and expressed, which can improve insecticidal efficiency. Effective for insect control. However, the scorpion venom gene introduced into fungi is toxic to humans and poses a certain risk to humans.

In addition, most of the fungi that have been engineered by genetic engineering are not specific to insects. For example, Beauveria bassiana and Metarhizium anisopliae (a broad-spectrum Metarhizium) can also kill beneficial insects while causing ecological disasters while controlling pests.

During the process of fungal infection of the host, cell wall glycoprotein and fungal polysaccharide metabolism are closely related to fungal growth and differentiation, pathogenicity, and adaptation to host immune response. The first step in the host's innate immunity is the identification of foreign pathogens. Pathogen-associated molecular patterns (PAMPs) on the cell wall of fungi, such as β-1,3-glucan, mannose, etc., are recognized by pattern recognition receptor PRRs, including C-type lectins and peptidoglycans. Immune recognition of recognition proteins, Gram-negative bacteria binding proteins (GNBP), etc., causes an immune response.

Metarhizium fungi are widely used in the control of aphids, and represent species such as Metarhizium anisopliae, Metarhizium anisopliae and Metarhizium anisopliae. Different species have different insecticidal ranges. For example, Metarhizium anisopliae and Metarhizium robertsii are broad-spectrum insecticidal fungi, while Metarhizium acridum can only infect Orthoptera, such as aphids, and is host-specific. Obligate bacteria. The cell wall components of Metarhizium include mannan, β-glucan, and chitin. Β-glucan and chitin are close to the cell membrane, forming a cell wall skeleton, and the outer layer of dextran is The structure is covered with loose mannan. Although the obligate fungus Metarhizium anisopliae has better insecticidal effect than the broad-spectrum strain Metarhizium anisopliae, its lethal time is still long, and the insecticidal ability still needs to be further improved.

Summary of the invention

The inventors of the present invention have found through long-term unremitting efforts that the phosphoglycerate kinase gene is absent in the genome of the obligate fungus Metarhizium anisopliae. Introducing the phosphoglycerate kinase gene into the obligate bacteria, Metarhizium anisopliae, by increasing the expression of 3-phosphoglycerate, thereby affecting the synthesis of fungal cell wall polysaccharides, reducing the recognition of the host immune system, and accelerating the growth of Metarhizium anisopliae in the host Breeding, improve the insecticidal ability of obligate bacteria. The inventors of the present invention have noted that 3-phosphoglycerate is involved not only in the glycolysis/gluconeogenesis pathway of fungi but also in the anabolism of polysaccharides on the surface of fungal cell walls. 3-phosphoglycerate can produce fructose-6-phosphate, an important intermediate in the metabolic pathway of fungal sugars. On the one hand, the accumulation of fructose-6-phosphate leads to the accumulation of glucose, which is the precursor of cell wall glucan synthesis; on the other hand, fructose-6-phosphate can be in the Phosphomannose isomerase (PMI). Reversible catalysis converts fructose-6-phosphate to mannose-6-phosphate, mannose-6-phosphate produces GDP-mannose, and GDP-mannose is a precursor of cell wall mannan synthesis. Therefore, 3-phosphoglycerate is an important substance that links glyceric acid metabolism and fungal sugar metabolism. It affects the metabolism of the sugar and the synthesis of the fungal polysaccharide, thereby affecting the recognition of the host immune system, accelerating the propagation of the fungus in the host, thereby improving the insecticidal effect of the fungus.

Accordingly, the present invention provides a recombinant Metarhizium anisopliae capable of expressing phosphoglycerate kinase.

Exemplarily, in the present invention, the recombinant M. anisopliae is deposited under the order of CGMCC No. 14153, and deposited on August 29, 2017 at the General Microbiology Center of the China Microbial Culture Collection Management Committee (Address: Beichen West Road, Chaoyang District, Beijing) No. 3, No. 1).

Illustratively, the recombinant M. anisopliae capable of expressing phosphoglycerate kinase in the present invention comprises an exogenous nucleotide sequence encoding phosphoglycerate kinase.

The recombinant M. anisopliae of the present invention promotes the production of 3-phosphoglycerate by the expression of phosphoglycerate kinase, thereby directly or indirectly enhancing the fructose-6-phosphate in the fungus. And/or the concentration of glucose-6-phosphate to increase insecticidal efficiency.

The nucleotide sequence encoding exogenous phosphoglycerate kinase in the present invention may be any nucleotide sequence of phosphoglycerate kinase which can be expressed in Metarhizium anisopliae. For example, a variant, homologue, derivative or fragment encoding a nucleotide sequence of a phosphoglycerate kinase. Preferably, however, the exogenous nucleotide sequence encoding phosphoglycerate kinase is derived from the broad-spectrum Metarhizium robertsii or the broad-spectrum Metarhizium anisopliae.

Preferably, the exogenous nucleotide sequence encoding phosphoglycerate kinase in the present invention comprises or consists of the following sequences:

a) the nucleotide sequence shown in SEQ ID NO: 1:

b) under stringent conditions with the nucleotide sequence of SEQ ID NO: 1 or its complement

a polynucleotide that hybridizes and encodes a phosphoglycerate kinase or a fragment thereof

Polynucleotide

c) the complement of a) or b) above; or

d) A polynucleotide derived from the nucleotide of SEQ ID NO: 1 due to degeneracy of the genetic code.

The "stringent conditions" described herein may be any of low stringent conditions, medium stringent conditions, and high stringency conditions, preferably high stringency conditions. Illustratively, the "low stringency conditions" may be 30 ° C, 5 x SSC, 5 x Denhardt's solution, 0.5% SDS, 52% formamide; "medium stringent conditions" may be 40 ° C, 5 x SSC, 5 x Denhardt's solution, 0.5% SDS, 52% formamide; "high stringency conditions" may be 50 ° C, 5 x SSC, 5 x Denhardt's solution, 0.5% SDS, 52% formamide. Those skilled in the art will appreciate that the higher the temperature, the more highly homologous polynucleotides can be obtained. In addition, one skilled in the art can select a comprehensive result of a plurality of factors affecting the stringency of hybridization, probe concentration, probe length, ionic strength, time, salt concentration, etc. to achieve a corresponding stringency.

In addition, the hybridizable polynucleotide may be calculated by using a system-determined default parameter by a homology search software such as FASTA or BLAST, and having a polynucleotide encoding the phosphoglycerate kinase of the present invention. 60% or more, about 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more , 79% or more, 80% Or above, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% Or above, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1 or Polynucleotides of the above, 99.2 or above, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more of identity.

For nucleotide sequence identity, the algorithm rules of Karlin and Altschul can be used for BLAST (Proc. Natl. Acad. Sci. USA 87: 2264-2268, 1990; Proc. Natl. Acad. Sci. USA 90: 5873, 1993). to make sure. Programs BLASTN, BLASTX based on BLAST algorithm rules have been developed (Altschul SF, et al: J Mol Biol 215: 403, 1990). When using BLASTN to analyze the base sequence, if the parameters are score=100, wordlength=12; when using the BLAST and Gapped BLAST programs, the system using each program can set default parameter values.

Illustratively, the exogenous nucleotide sequence encoding phosphoglycerate kinase of the invention comprises or consists of the degenerate sequence of SEQ ID NO: 1 or SEQ ID NO: 1, for example by the SEQ ID NO: 1 A nucleotide sequence formed by substituting a preferred codon for P. anthracis.

The invention also provides an insecticide comprising the recombinant P. anthracis of the invention, and optionally an agrochemically acceptable carrier. The pharmaceutically acceptable carrier may be mica powder, light calcium carbonate, clay, talc, kaolin, diatomaceous earth, attapulgite, bentonite, sepiolite, urea, potassium chloride, sodium sulfate, ammonium sulfate, nitric acid. One or more of sodium, ammonium nitrate, ammonium chloride.

Another aspect of the invention provides the use of the recombinant Rhizoctonia solani of the invention for the preparation of an insecticide.

Preferably, the insecticide of the invention is used to kill aphids.

Optionally, the insecticide of the present invention may also comprise other active ingredients capable of killing aphids. Exemplary, such as metabolite, pyrethroids, carbamates, nicotinics, neurosodium channel blockers, insecticidal macrolides, gamma-aminobutyric acid (GABA) antagonists One or more of the insecticidal ureas and juvenile hormone mimics.

The invention also provides a preparation method of recombinant P. anthracis, comprising the following steps: The nucleotide sequence encoding phosphoglycerate kinase of the present invention is operably introduced into the obligate fungus Metarhizium anisopliae.

The present invention also provides a method of killing aphids comprising the step of administering the recombinant A. sinensis of the present invention. Preferably, the administering comprises spraying the recombinant A. sinensis with the present invention to crops such as corn and wheat.

Illustratively or preferably, the invention has one of the following advantages:

The recombinant Metarhizium anisopliae of the invention can significantly increase the concentration of fructose-6-phosphate in the obligate bacteria, Metarhizium anisopliae, and significantly improve the insecticidal efficiency. For example, the recombinant Metarhizium anisopliae of the present invention can shorten the LT50 of Metarhizium anisopliae from 7.045±0.211 days to 5.617±0.187 days; and is harmless to the environment, has good biosafety, and is non-toxic to humans.

DRAWINGS

1 is a schematic structural view of a recombinant plasmid according to an embodiment of the present invention;

2 is an agarose gel electrophoresis diagram of a transformant in an embodiment of the present invention;

3 is a graph showing experimental results of fructose-6-phosphate content in MAC and MAC+119 transformants according to an embodiment of the present invention;

4 is a graph showing experimental results of density of polysaccharide fibers on the surface of MAC and MAC+199 transformant hyphae according to an embodiment of the present invention;

Fig. 5 is a graph showing the results of an experiment of introducing a phosphoglycerate kinase gene to the semi-lethal time of the planthopper in the embodiment of the present invention.

Detailed ways

The technical solutions in the embodiments of the present invention are clearly and completely described below. It is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative efforts are within the scope of the present invention.

The experimental methods used in the following examples are conventional methods unless otherwise specified.

The materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The invention is described in detail below with reference to the specific embodiments, which are intended to be understood

Example 1 Phosphoglycerate kinase expression plasmid construction method

In this example, a broad-spectrum gene of Plasmodium breve (indicated as MAA) phosphoglycerate kinase gene is described as an example, and its gene bank accession number is XM_007823117 (MAA_05119) D-glycerate 3-kinase [EC: 2.7.1.31], The specific sequence is shown in SEQ ID NO: 1. The sequence of the phosphoglycerate kinase gene is not limited in the present embodiment, and may be a variant, a homologue, a derivative or a fragment of a nucleotide sequence encoding a phosphoglycerate kinase, as long as it can finally express a phosphoglycerate kinase. can.

1. Amplification of the broad-spectrum Roberts angiostrongy phosphoglycerate kinase sequence

The primers MAA_05119F and MAA_05119R were designed to amplify the gene region expressing phosphoglycerate kinase, and the template was cDNA extracted from the mycelium of the broad-spectrum Beauveria bassiana MAA.

Primers were designed and the XhoI restriction sites were added to both ends of the product. The primer sequences were as follows:

MAA_05119F: GGTACCGGGCCCCCCCTCGAGATGTCCACATTCGCAGATGACA (as shown in SEQ ID NO: 2);

MAA_05119R: CCGCTCGAGTATCCGCACAACTTCCTTGACCTT (shown as SEQ ID NO: 3).

The PCR reaction mixture was: 5 μL of 10×Ex Taq Buffer polymerase buffer, 8 μL of 2.5 mM dNTP, 1 μL of 10 μM upstream and downstream primers, 1 μL of template, 0.25 μL of Takara Ex Taq DNA polymerase, and ultrapure water. To a total volume of 50 μL;

PCR reaction conditions: pre-denaturation at 95 ° C for 5 min, 94 ° C for 30 sec, 58 ° C for 30 sec, 72 ° C for 1.5 min (35 cycles); finally 72 ° C for 10 min.

The PCR reaction product was electrophoresed on an agarose gel having a mass fraction of 1.0%, and the product was recovered using a gel recovery kit.

2. Construction of engineering strains

The pDHt-RFP-Bar plasmid was digested with XhoI endonuclease and then digested, and the product obtained in step 1 was recombined with a recombinase to form a new plasmid pDHt-GLYK-RFP-Bar (as shown in Fig. 1). After transformation and PCR identification, a positive E. coli transformed strain was obtained. Glyceric acid kinase specific primer MAA_05119F/R Sequencing confirmed that the desired vector was obtained.

Agrobacterium tumefaciens mediated transformation (ATMT) was used to construct the fungal genetic transformation system: the obtained vector was transformed into Agrobacterium AGL-1, and the positive Agrobacterium AGL-1 transformed strain was selected after PCR identification, YEB medium (including 50 mg/ml Carb and 50 mg/ml Kan) were expanded. The cells were collected, and the _OD660 was resuspended in an appropriate amount of IM liquid medium to 0.15, and cultured at 28 ° C in the dark to a bacterial concentration of OD ₆₆₀ of 0.5-0.8.

At the same time, a wild-type obligate bacterium, Metarhizium anisopliae (recorded as MAC) conidia spore suspension was prepared. The MAC was inoculated on a PDA plate and cultured. After 14 days of culture, the appropriate amount of wild-type obligate bacteria, Metarhizium anisopliae MAC conidia, was scraped from PDA plates into 1 mL of 0.05% Tween-20 sterile water. After vortexing, the hyphae were removed by filtration with glass wool. The filtrate was collected. After centrifugation at 12,000 rpm for 3 min, wash twice with Tween-20 sterile water, resuspend and count with a hemocytometer, and adjust the wild-type Pseudomonas aeruginosa MAC spore suspension to about 10 ⁶ points per mL of suspension. Spores, spare.

100 μL of each of the AGL-1 bacterial solution cultured in the IM medium and the conidia suspension of the wild-type obligate microorganism, Metarhizium anisopliae, was evenly spread on an IM medium plate. After co-cultivation for 48 h, the co-culture was washed with sterile water, and cultured in the dark with M-100 medium containing sishamycin and glufosinate for 7-10 days until the emergence of resistant colonies. Resistant fungal tissue is ready for use. The fungal genome was extracted and the transformants were verified by PCR with specific primers.

3. Fungal genome validation

The genome of the transformants was verified using a full-scale Golden Plant Tissue PCR Kit (AD301) kit.

Pick the above-mentioned resistant fungal tissue, add 40 ul of PD1 Buffer, vortex or mix with a pipette. Incubate in a 95 ° C metal bath for 10 min (preheat the equipment in advance), then add 40 μL PD2Buffer, mix and use as a template for PCR validation. The specific primers used were MAA_05119F and RFP-R (the NCBI GenBank accession number of the RFP-R sequence is: AB166761.1, and the specific sequence is TTAGGCGCCGGTGGAGTG (as shown in SEQ ID NO: 4).

The PRC system is as follows:

The resulting PCR product was electrophoresed on a 1% agarose gel and Marker was D2000. The results of agarose gel electrophoresis are shown in Figure 2. In Figure 2, lanes 1-8 are resistant fungi and lanes 9-11 are controls (wild-type obligate anthracnose MAC). As can be seen from Figure 2, lanes 1-8 have a band between 1000 bp and 2000 bp (the theoretical band is 1559 bp), while the control MAC samples in lanes 9-11 have no bands, indicating MAA05119 with RFP. The gene has been transferred to the wild-type obligate Metarhizium anisopliae MAC genome, and the above-mentioned resistant fungus is the recombinant obligate fungus Metarhizium anisopliae (recorded as MAC+119). The recombinant obligate fungus, Metarhizium anisopliae, was deposited with the General Microbiology Center of the China Microbial Culture Collection Management Committee (address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing). The deposit name is MAC119 and the deposit number is CGMCC NO. .14153, the deposit date is August 29, 2017.

Example 2 Determination of fructose-6-phosphate content of recombinant adenobacteria

The content of fructose-6-phosphate (F6P) in hyphae was determined using a PicoProbe Fructose-6-Phosphate Fluorometric Assay Kit (BioVision).

1. Make a standard curve:

The F6P standard solution was diluted to 1 nmol/μL, and 0, 2, 4, 6, 8, and 10 μL were added to a 96-well white enzyme plate to enhance the luminescence intensity. Fill with Assay Buffer to a volume of 50 μL per well. 50 μL of Reaction Mix was added. At the same time, F6P Assay Buffer was used as a control instead of F6P Converter in the reaction mixture. The preparation method of the reaction mixture and the control is shown in Table 1 below.

Table 1 Preparation of reaction mixture and control

2. Sample preparation:

The recombinant obligate microorganism Aspergillus oryzae obtained in Example 1 was cultured on an IM medium plate. After 14 days of culture, the mycelium of the recombinant adenobacteria, Metarhizium anisopliae, was washed three times with 0.1×PBS, and the mycelium was collected by filtration through a 0.22 μm sieve. The sample was lyophilized using a freeze dryer at -45 °C. Take about 1 mg of the sample, weigh it as m, add 7% perchloric acid to lyse the cell wall (to remove the effect of the protein), and grind the sample with a grinding rod. The solution was neutralized using K ₂ CO ₃ to bring the pH to 6.5-8.0. After centrifugation, transfer the supernatant to a new centrifuge tube and record the total volume V for use.

In order to exclude NADH in the sample, NADPH produced background interference, and a blank control group was set.

3. Determination of fructose-6-phosphate content

Add the mycelial sample of the above-mentioned recombinant obligate microorganism, Metarhizium anisopliae, to the well of the microplate, add 50 μL per well, and add 50 μL of reaction mixture to the wild-specific bacteria. A mycelial sample of the fungus was used as a control. Fluorescence Ex/Em = 535 / 587 nm was measured after incubation for 5 min at 37 ° C in the dark. The value obtained when F6P is 0 is 0, and the obtained data is removed from the background interference. Draw a standard curve to get the trend line and formula. The data obtained from the sample is taken in to obtain the corresponding concentration. The specific results are shown in Figure 3.

As shown in FIG. 3, the fructose-6-phosphate contents of MAC and MAC+119 were 1522.2 nmol/g and 3439.5 nmol/g, respectively. The content of fructose-6-phosphate in the recombinant obligate microorganism, Metarhizium anisopliae, which was transferred to the phosphoglycerate kinase gene, increased, indicating that the introduction of this gene enhanced the accumulation of fructose-6-phosphate in the fungus.

Example 3 Determination of Polysaccharide Thickness of Recombinant Organisms of Metarhizium anisopliae Mycelium Cell Wall

1. High pressure freezing-freezing alternative preparation sample

The recombinant obligate microorganism, Metarhizium anisopliae, in Example 1 was cultured on an IM medium plate. After 14 days of culture, the recombinant adenobacteria, Metarhizium anisopliae, was collected, washed twice with sterilized 0.1 mol/L PBS buffer (pH 7.4), and centrifuged to remove water. Pick the hyphae into a metal dish for loading in a high pressure freezer (Leica EM PACT2 high-pressure freezer), add an appropriate amount of cryoprotectant, and quickly sample the sample in liquid nitrogen and high pressure. It is fixed in the environment.

The sample in the freezer was taken out and transferred to a sample tube of a Leica EM AFS2 automatic freeze substitution system in liquid nitrogen. Prior to transfer, a 1% citric acid-acetone solution was added to the sample tube. Set the freezing replacement procedure as follows:

-90 ° C for 10 hours; temperature to -30 ° C (2 ° C per hour); -30 ° C for 8 hours; temperature to 20 ° C (2 ° C per hour). After heating to 20 ° C, replace it with pure acetone solution every hour for 3 times.

2, sample preparation and transmission electron microscope observation

During the resin infiltration process, the permeate was replaced every 12 hours. The ratio of Epson 812 resin to pure acetone in the replaced permeate was 1:3, 1:1, 3:1, 1:0. Infiltrated for 3 days in pure resin and replaced with new resin every 12 hours. After the end of the infiltration, the mixture was polymerized in a 45 ° C polymerization furnace for 48 hours with Epson 812 resin to prepare an embedding block. After trimming, use an ultra-thin slicer to slice and cut the pieces with 100 mesh copper mesh. The thickness of the ultrathin section was 60 nm, and the sections were stained with uranyl acetate and lead citrate. Then, JES-1400 transmission electron microscope was used to observe the hyphal slice of the recombinant obligate microorganism (MAC+119) at 80KV. The morphology was photographed and the wild-type obligate bacteria, Metarhizium anisopliae (MAC), was used as a control. The experimental results are shown in Figure 4. As can be seen from Fig. 4, the polysaccharide fibers on the cell wall of the MAC strain are sparse, and the polysaccharide fibers on the cell wall of the MAC+119 strain are dense. The dense polysaccharide fiber strengthens the immune system against aphids.

Example 4 Determination of insecticidal efficiency of recombinant adenobacteria

The recombinant obligate bacteria, Metarhizium anisopliae (MAC+119), was inoculated on PDA medium, and the spores of the recombinant obligate bacteria, Metarhizium anisopliae, were scraped, and the appropriate amount of suspended oil of peanut oil was added to vortex and vortexed, and filtered with glass wool. Spores were collected and resuspended in peanut oil. The cell count plate was counted under a microscope, and the final concentration was 1 × 10 ⁶ spores/ml by repeated resuspension and counting. 2 μL of the spore suspension was pipetted under the dorsal deck of the male East Asian migratory locusts 4 days after emergence, and treated with peanut oil and wild type obligate bacteria, Metarhizium anisopliae (MAC) spores. The number of dead insects was recorded every 12 hours. Finally, the semi-lethal time (LT50) was calculated by Kaplan-Meier method in SPSS 20.0 software, and the insecticidal virulence of wild-type and transformed strains was compared. The experimental results are shown in Figure 5.

As shown in Figure 5, the semi-lethal time of the wild-type obligate microorganism, Metarhizium anisopliae (MAC), was 7.045±0.211d, and the recombinant bacterium, Metarhizium anisopliae, was introduced after the introduction of the glycerate kinase gene. (MAC+119) The semi-lethal time for the planthopper is 5.617±0.187d. This indicates that the introduction of the glycerate kinase gene increases the virulence of the obligate bacteria, Metarhizium anisopliae.

The increase of the concentration of 3-phosphoglycerate can increase the content of fructose-6-phosphate, and finally directly or indirectly cause the accumulation of glucose and mannose-6-phosphate, affecting the sugar metabolism and cell wall formation of the fungus, and accelerating the fungus. The reproduction in the host affects the recognition of the host immune system, thereby enhancing the insecticidal effect of the fungus.

In this example, the semi-lethal time LT50 of the recombinant obligate microorganism was reduced from 7.045±0.211 days to 5.617±0.187 days, which significantly improved the insecticidal efficiency of the obligate fungus Metarhizium anisopliae. And obviously, the introduced gene is harmless to the environment and has good biosafety.

The invention enhances the insecticidal efficiency of fungal pesticides by directly or indirectly increasing the accumulation of glucose and/or mannose-6-phosphate by introducing a glycerate kinase gene. According to this principle, the accumulation concentration of glucose and/or mannose-6-phosphate can also be increased by other means to improve the insecticidal efficiency. The above is only the preferred embodiment of the present invention, and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc., which are within the spirit and principles of the present invention, should be included in the scope of the present invention. within.

Claims

Recombinant Metarhizium anisopliae, which is capable of expressing phosphoglycerate kinase.
The recombinant M. anisopliae according to claim 1, which is deposited under the symbol CGMCC No. 14153.
The recombinant M. anisopliae according to claim 1 or 2, which comprises an exogenous nucleotide sequence encoding phosphoglycerate kinase.
The recombinant M. anisopliae according to claim 3, wherein the exogenous nucleotide sequence encoding phosphoglycerate kinase is derived from the broad-spectrum Metarhizium robertsii or the broad-spectrum fungus Metarhizium anisopliae ( Metarhizium anisopliae), preferably, the exogenous nucleotide sequence encoding phosphoglycerate kinase is capable of increasing the concentration of fructose 6-phosphate in the recombinant M. anisopliae relative to wild-type M. anisoplia.
The recombinant M. anisopliae according to claim 3, wherein the exogenous nucleotide sequence encoding phosphoglycerate comprises or consists of the following sequence:

a) the nucleotide sequence of SEQ ID NO: 1;

b) a polynucleotide capable of hybridizing to the nucleotide sequence of SEQ ID NO: 1 or its complement, and encoding a phosphoglycerate kinase or a fragment thereof;

c) the complement of a) or b) above; or

d) A polynucleotide derived from the nucleotide of SEQ ID NO: 1 due to degeneracy of the genetic code.
The recombinant M. anisopliae according to claim 5, wherein the exogenous nucleotide sequence encoding phosphoglycerate kinase comprises the degenerate sequence of SEQ ID NO: 1 or SEQ ID NO: 1 or by SEQ ID NO: 1 or the degenerate sequence composition of SEQ ID NO: 1.
An insecticide comprising the recombinant M. anisopliae according to any one of claims 1 to 6, and optionally an agrochemically acceptable carrier.
Use of the recombinant M. anisopliae according to any one of claims 1 to 6 for the preparation of an insecticide, preferably an insecticide for killing aphids.
The use according to claim 8, said insecticide further comprising other active ingredients for killing aphids, preferably said other active ingredients are selected from the group consisting of Pyrethroid, urethane, neonicotinic acid, neuronal sodium channel blocker, insecticidal macrolide, gamma-aminobutyric acid (GABA) antagonist, diflubenzuron and chlorfenapyr The group consisting of.
The method for preparing a recombinant Metarhizium anisopliae according to any one of claims 1 to 6, comprising the steps of:

The nucleotide sequence encoding a phosphoglycerate kinase (preferably the nucleotide sequence as defined in claim 5 or 6) is operably introduced into the obligate fungus Metarhizium anisopliae, preferably, the introduction is by Agrobacterium tumefaciens-mediated method.
A method of killing aphids comprising the step of using the recombinant A. sinensis according to any one of claims 1-6.