AU2017431448B2

AU2017431448B2 - Recombinant metarhizium acridum, and preparation method and use thereof

Info

Publication number: AU2017431448B2
Application number: AU2017431448A
Authority: AU
Inventors: Shuai HU; Le KANG; Yundan WANG
Original assignee: Institute of Zoology of CAS
Current assignee: Institute of Zoology of CAS
Priority date: 2017-09-12
Filing date: 2017-09-19
Publication date: 2022-03-10
Anticipated expiration: 2037-09-19
Also published as: WO2019051852A1; CN107502562B; AU2017431448A1; CN107502562A

Abstract

Disclosed is a recombinant

Description

Recombinant Metarhizium Acridum, and Preparation Method and Use Thereof

FIELD OF THE INVENTION

[0001] The present invention relates to a transgenic strain, and preparation method and use thereof, and more particularly, to a recombinant Metarhizium Acridum capable of improving an insecticidal efficiency of an obligate fungus Metarhizium acridum, and preparation method and use thereof.

BACKGROUND OF THE INVENTION

[0002] Compared with chemical insecticides, entomopathogenic fungi have the advantages of environmental friendliness, strong stress resistance, capability of mass diffusion, high selectivity and the like, and are widely used as biopesticides. However, the entomopathogenic fungi still have the disadvantage of long lethal time as insecticides currently. It is an important orientation of current research to study pathogenic mechanisms of fungi, use genetic engineering to modify fungi and improve effects of fungal insecticides. For instance:

[0003] 1. Highly express hydrolase genes secreted by fungi. Overexpressing body-wall degrading proteases such as subtilisins PrIA can improve body-wall penetrating speeds of the fungi, which significantly increases a virulence of Metarhizium anisopliae, accelerates a lethal speed and activates an original system of polyphenol oxidases in haemocoele, resulting in rapid blackening of an insect body, reducing a lethal time of tobacco hornworms by 25% and also decreasiing a feeding rate of pests by 40%. Fang et al. transferred Bbchitl genes into beauveria bassiana genomes to obtain overexpressed engineering strains. A virulence of the engineering strains to aphids was obviously enhanced. Compared with wild strains, a lethal dose of the engineering strains to the aphids was reduced by 50%, and a lethal time was shortened by 50%.

[0004] 2. Modify fungal metabolic genes. Xia et al. transformed broad-spectrum Metarhizium by constructing a fungal acid trehalose-degrading enzyme (ATM) overexpression vector to enhance a metabolic ability of the fungi to trehalose in haemolymph of a host , and promote growth of the broad-spectrum Metarhizium in insects.

[0005] 3. Introduce exogenous genes. Androctonus australis neurotoxin AaIT is a specific neurotoxin of lepidoptera and Diptera insects. After Wang et al. introduced the gene into Metarhizium, the neurotoxin could be specifically expressed in haemocoele of a host, and the virulence of the modified fungi to the tobacco hornworms was increased by 22 times.

[0006] 4. Express immune-related genes. Yang et al. expressed a serine inhibitory enzyme Spn43Ac of a Toll signaling pathway - an innate immune recognition pathway of insects in the Beauveria bassiana, which reduced a median lethal time to Myzus persicae by 24% and increased a lethality rate by twice. Fan et al. introduced Glucose-fructose oxidoreductase GFOR genes into Beauveria bassiana, and the constructed transgenic engineering strain could inhibit an activity of Gram-negative bacteria binding proteins (GNBPs) of a host by synthesizing gluconolactone (GDL), inhibit an immune response of the host, reduce a lethal time of the fungi by 48 hours, and improve the insecticidal effect.

[0007] However, there are still some defects to modify the fungi by genetic engineering. For example, Chinese disclosure patent with a publication number CN101755050 discloses that an optimized polynucleotide sequence encoding Androctonus australis neurotoxin AaIT is introduced into Metarhizium anisopliae and expressed, which can improve an insecticidal efficiency and is effectively used for insect control. However, scorpion toxin genes introduced into the fungi are toxic to human beings and may cause a certain risk to human beings.

[0008] In addition, most fungi modified by genetic engineering are not specific to the insects. For example, the Beauveria bassiana and the Metarhizium anisopliae (broad-spectrum Metarhizium) can kill beneficial insects while preventing and controlling pests, resulting in an ecological disaster.

[0009] Metabolism of cell wall glycoproteins and fungal polysaccharides is closely related to fungal growth and differentiation, pathogenicity and adaptation to an immune response of a host during fungal infection to the host. The first step of innate immunity of the host is to recognize foreign pathogens. Pathogen-associated molecular patterns

(PAMPs) on a fungal cell wall, such as p-1,3-glucan, mannose, etc., can be immunologically recognized by pattern recognition receptors PRRs, including C-type agglutinin, peptidoglycan recognition protein, Gram-negative bacteria binding protein (GNBP), etc., resulting in immune response.

[0010] Metarhizium fungi, represented by Metarhizium anisopliae, Metarhizium robertsonii, Metarhizium acridum, etc., are widely used in locust control, and different species of fungi have different insecticidal ranges. For example, Metarhizium anisopliae and Metarhizium robertsii are broad-spectrum insecticidal fungi, while Metarhizium acridum can only infect Orthoptera insects such as locusts and is a host-specialized obligate fungus. Cell wall components of the Metarhizium anisopliae include mannan, p-glucan and chitin. The p-glucan and the chitin are close to a cell membrane and form a cell wall skeleton, and the glucan in an outer layer is covered by mannan with a loose structure. Although the obligate fungus Metarhizium acridum has a better insecticidal effect than that of the broad-spectrum fungus Metarhizium robertsii, the Metarhizium acridum still has longer lethal time, and an insecticidal ability still needs to be further improved.

SUMMARY OF THE INVENTION

[0011] After long-term unremitting efforts, the inventors of the present invention have discovered that the genome of the obligate fungus Metarhizium acridum lacks a phosphoglyceric kinase gene. The phosphoglyceric kinase gene is introduced into the obligate fungus Metarhizium acridum to further affect synthesis of fungal cell wall polysaccharide by increasing the expression of 3-phosphoglycerate, reduce recognition of a host immune system, accelerate reproduction of the Metarhizium acridum in the host, and improve insecticidal ability of the obligate fungus. The inventors of the disclosure have noticed that the 3-phosphoglycerate not only participates in glycolysis/gluconeogenesis pathway of fungi, but also participates in anabolism of polysaccharides on surfaces of fungal cell walls. The 3-phosphoglycerate can produce fructose-6-phosphate, which is an important intermediate product in fungal carbohydrate metabolism. On one hand, accumulation of the fructose-6-phosphate will cause accumulation of glucose, while the glucose is a precursor of cell wall glucan synthesis. On the other hand, the fructose-6-phosphate can be converted from the fructose-6-phosphate to mannose-6-phosphate under reversible catalysis of Phosphomannose isomerase (PMI). The mannose-6-phosphate can generate GDP-mannose, which is a precursor of cell wall mannan synthesis. Therefore, the 3-phosphoglycerate is an important substance connecting glycerate metabolism and fungal glycometabolism. By affecting the glycometabolism and fungal polysaccharide synthesis, the 3-phosphoglycerate further affects the recognition of the host immune system and accelerates the propagation of the fungi in the host, thus improving the insecticidal effect of the fungi.

[0012] Therefore, in one aspect, the disclosure provides a recombinant Metarhizium acridum capable of expressing phosphoglyceric kinase.

[0013] Exemplarily, a deposit number of the recombinant Metarhizium acridum in the disclosure is CGMCC NO.14153, which was deposited in China General Microbiological Culture Collection Center on August 29, 2017 (address: No.3, Yard 1, West Beichen Road, Chaoyang District, Beijing).

[0014] Exemplarily, the recombinant Metarhizium acridum capable of expressing phosphoglyceric kinase in the disclosure includes an exogenous nucleotide sequence encoding phosphoglyceric kinase.

[0015] The recombinant Metarhizium acridum of the disclosure promotes production of 3-phosphoglycerate by expressing the phosphoglyceric kinase, so as to directly or indirectly improve concentrations of fructose-6-phosphate and/or glucose-6-phosphate in fungi to improve an insecticidal efficiency.

[0016] This paragraph has intentionally been deleted.

[0017] The exogenous nucleotide sequence encoding phosphoglyceric kinase in the disclosure includes or consists of the following sequences:

[0018] a) anucleotide sequence of SEQ IDNO:1;

[0019] This paragraph has intentionally been deleted.

[0020] b) a complementary sequence of a) above; or

[0021] c) a polynucleotide derived from the nucleotide of SEQ ID NO:1 due to degeneracy of a genetic code.

[0022] The "stringency conditions" mentioned herein may be any of low stringency conditions, medium stringency conditions, and high stringency conditions, and are preferably high stringency conditions. For example, the "low stringency conditions" may be 30 °C, 5*SSC, 5*Denhardt solution, 0.5% SDS, and 52% formamide; the "medium stringency conditions" may be 40°C, 5*SSC, 5*Denhardt solution, 0.5% SDS, and 52% formamide, and the "high stringency conditions" may be 50°C, 5*SSC, 5*Denhardt solution, 0.5% SDS, and 52% formamide. Those skilled in the art should understand that the higher the temperature, the more highly homologous polynucleotides can be obtained. In addition, those skilled in the art can select a comprehensive result formed by a plurality of factors such as temperature, probe concentration, probe length, ionic strength, time, salt concentration and the like which affect the stringency of hybridization to realize corresponding stringency.

[0023] In addition, the hybridizable polynucleotides may also be polynucleotides having about 60% or more, about 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or above, 88% or above, 89% or above, 90% or above, 91% or above, 92% or above, 93% or above, 94% or above, 95% or above, 96% or above, 97% or above, 98% or above, 99% or above, 99.1 or above, 99.2 or above, 99.3% or above, 99.4% or above, 99.5% or above, 99.6% or above, 99.7% or above, 99.8% or above, or 99.9% or above identity with the polynucleotide encoding the phosphoglyceric kinase of the disclosure when calculation is carried out by homology search software such as FASTA and BLAST using default parameters set by a system.

[0024] The identity of the nucleotide sequence may be determined by using algorithm rule BLAST (Proc. Natl. Acad. Sci. USA 87: 2264-2268, 1990; Proc. Natl. Acad. Sci. USA 90: 5873, 1993) of Karlin and Altschul. BLASTN and BLASTX programs based on BLAST algorithm rule have been developed (Altschul SF, et al: J Mol Biol 215: 403, 1990). When the BLASTN is used to analyze a base sequence, for example, parameters are set as that score=100 and wordlength=12; and when the BLAST and Gapped BLAST program are used, default parameter values may be set for systems adopting each program.

[0025] Exemplarily, the exogenous nucleotide sequence encoding phosphoglyceric kinase in the disclosure includes or consists of the SEQ ID NO: 1 or a degenerate sequence of the SEQ ID NO:1, for example, a nucleotide sequence formed by replacing a codon in the SEQ ID NO: 1 with a preferred codon of Metarhizium acridum.

[0026] In another aspect, the disclosure also provides an insecticide, including the recombinant Metarhizium acridum of the disclosure, and optionally, a pesticidally acceptable vector. The pesticidally acceptable vector may be one or more of mica powder, light calcium carbonate, pottery clay, talc powder, kaolin, diatomite, attapulgite, bentonite, sepiolite, urea, potassium chloride, sodium sulfate, ammonium sulfate, sodium nitrate, ammonium nitrate and ammonium chloride.

[0027] Another aspect of the disclosure provides an application of the recombinant Metarhizium acridum of the disclosure in preparing an insecticide.

[0028] Preferably, the insecticide of the disclosure is used for killing locusts.

[0029] Optionally, the insecticide of the disclosure may also include other active ingredients capable of killing locusts, for example, one or more of destruxins, pyrethroids, carbamates, nicotinoids, neuronal sodium channel blocker, insecticidal macrolide, y-aminobutyric acid (GABA) antagonist, diflubenzurons and juvenile hormone mimetics.

[0030] In another aspect, the disclosure also provides a preparation method of the recombinant Metarhizium, comprising the following step(s) of: operably introducing the nucleotide sequence encoding phosphoglyceric kinase of the disclosure into obligate fungus Metarhizium acridum.

[0031] In another aspect, the disclosure also provides a method for killing locusts, including a step of applying the recombinant Metarhizium acridum of the disclosure. Preferably, the application includes spraying the recombinant Metarhizium acridum of the disclosure onto crops, such as corn and wheat.

[0032] Exemplarily or preferably, the disclosure has one of the following advantages:

[0033] the recombinant Metarhizium acridum of the disclosure can significantly increase the concentration of the fructose-6-phosphate in the obligate fungus Metarhizium acridum, and significantly improve the insecticidal efficiency. For instance, the recombinant Metarhizium acridum of the disclosure can shorten such a median lethal time LT50 of the Metarhizium acridum from 7.045 0.211 days to 5.617 0.187 days. In addition, the recombinant Metarhizium acridum is harmless to environment, biologically safe and non-toxic to human beings.

BRIEF DESCRIPTION OF DRAWINGS

[0034] FIG. 1 is a schematic structure diagram of recombinant plasmids according to an example of the disclosure;

[0035] FIG. 2 is an agarose gel electrophoresis diagram of transformants according to the example of the disclosure;

[0036] FIG. 3 is a diagram showing experimental results of fructose-6-phosphate content in MAC and MAC+119 transformants according to an example of the disclosure;

[0037] FIG. 4 is a diagram showing experimental results of polysaccharide fiber density on mycelium surfaces of MAC and MAC+199 transformants according to an example of the disclosure;

[0038] FIG. 5 is a diagram showing experimental results of a median lethal time of migratory locusts by introducing phosphoglyceric kinase genes according to an example of the disclosure.

DETAILED DESCRIPTION OF THE INVENTION

[0039] The following clearly and completely describes the technical solutions in the example of the disclosure. Apparently, the described examples are merely some but not all of the examples of the disclosure. Based on the examples in the disclosure, all other examples obtained by a person of ordinary skill in the art without going through any creative work shall fall within the scope of protection of the disclosure.

[0040] The experimental methods used in the following examples are conventional unless otherwise specified.

[0041] The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0042] The disclosure will be described in detail below with reference to specific examples which are intended to understand but not to limit the disclosure.

[0043] Example 1 Method for constructing phosphoglyceric kinase expression plasmid

[0044] In this example, a phosphoglyceric kinase gene of broad-spectrum Metarhizium robertsonii (MAA) was taken as an example, and a gene bank login number thereof was XM_007823117 (MAA_05119) D-glycerate 3-kinase [EC:2.7.1.31], and a specific sequence was shown in SEQ ID NO: 1. A sequence of the phosphoglyceric kinase gene was not limited in this example, and could be a variant, a homologue, a derivative or a fragment of a nucleotide sequence encoding phosphoglyceric kinase, as long as the sequence could finally express the phosphoglyceric kinase.

[0045] 1. Amplification of phosphoglyceric kinase sequence of broad-spectrum Metarhizium robertsii

[0046] Primers MAA_05119F and MAA_05119R were designed to amplify a gene region expressing phosphoglyceric kinase. A template was cDNA extracted from mycelium of the broad-spectrum Metarhizium robertsonii MAA.

[0047] The primers were designed, XhoI restriction enzyme cutting sites were added at both ends of a product, and primer sequences were as follows:

[0048] MAA_05119F: GGTACCGGGCCCCCCCTCGAGATGTCCACATTCGCAGATGACA (as shown in SEQ ID NO: 2); and

[0049] MAA_05119R: CCGCTCGAGTATCCGCACAACTTCCTTGACCTT (as shown in SEQ ID NO: 3).

[0050] A mixture of a PCR reaction was as follows: 5 L of 10*Ex Taq Buffer polymerase buffer, 8 L of 2.5 mM dNTP, 1 L of 10 M upstream primer and 1 L of 10 M downstream primer, 1 L of template, 0.25 L of Takara Ex Taq DNA polymerase, and ultrapure water added to a total volume of 50 L;

[0051] PCR reaction conditions: predegeneration for 5 minutes at 95°C, for 30 seconds at 94°C, for 30 seconds at 58°C, extension for 1.5 minutes at 72°C (35 cycles); and finally extension for 10 minutes at 72°C.

[0052] After the PCR reaction products were electrophoresed by agarose gel with a mass fraction of 1.0%, the products were recovered by a gel extraction kit.

[0053] 2. Construction of engineering strains

[0054] After pDHt-RFP-Bar plasmids were enzyme-digested by XhoI endonuclease, and then subjected to gel extraction. The plasmids were recombbined with the products obtained in step 1 with recombinase to form new plasmids pDHt-GLYK-RFP-Bar (as shown in FIG. 1). After transformation and PCR identification, positive Escherichia coli transformed strains were obtained. A desired vector was obtained by sequencing with primer MAA_05119F/R specific for glycerate kinase.

[0055] A fungal genetic transformation system was constructed using an agrobacterium tumefaciens mediated transformation (ATMT): the obtained vector was transformed into Agrobacterium AGL-1, then positive Agrobacterium AGL-1 transformed strains were selected after PCR identification, and then expanded in a YEB medium (containing 50 mg/ml Carb and 50 mg/ml Kan) for culture. The strains were collected, cultured with appropriate IM liquid medium to suspend OD6 6 0 to 0.15, and cultured in dark at 28 until the concentration OD 6 6 0of the strain liquid was 0.5 to 0.8.

[0056] Meanwhile, a conidium suspension of wild type obligate fungus Metarhizium acridum (MAC) was prepared. The MAC was inoculated on a PDA plate for cultivation. After the MAC was cultured for 14 days, an appropriate amount of the conidia of the wild type obligate fungus Metarhizium acridum MAC was scraped from the PDA plate to 1 mL of sterile water containing 0.05% Tween-20. After vortex shaking, myceliawere filtered with glass cotton, and the filtrate was collected. After the filtrate was centrifuged at 12000 rpm for 3 minutes, thefiltrate was washed with Tween-20 sterile water twice, resuspended and then counted with a blood counting plate, and the conidia suspension of wild type obligate fungus Metarhizium acridum MAC was adjusted to contain about 106 conidia per mL of suspension for later use.

[0057] 100 pL of the AGL-1 fungus liquid cultured in the IM medium and 100 PL of the conidium suspension of the wild type obligate fungus Metarhizium acridum MAC were mixed and evenly coated on IM medium plate. After the mixture was co-cultured for 48 hours, the co-cultures were washed with sterile water, and cultured in a M-100 medium containing cephalothin and glufosinate in the dark for 7 to 10 days until resistant colonies appeared. After separating monosporas, resistant fungal tissues were preserved for later use. Fungal genomes were extracted and transformants were verified by PCR with specific primers.

[0058] 3. Verification of fungal genomes

[0059] The genomes of the transformants were verified using a TransGen Plant Tissue PCR Kit (AD301).

[0060] The above resistant fungal tissues were selected, and added with 40 L of PD1 Buffer. And the mixture was vortexed , or blown with a pipettor. The mixture was incubated in a metal bath at 95°C for 10 minutes (the metal bath was preheated in advance), then added with 40 L of PD2 Buffer. After blending, the mixture could be directly used as a template for PCR verification. The specific primers used were MAA_05119F and RFP-R (NCBI GenBank login number of the RFP-R sequence was AB166761.1, and the specific sequence was TTAGGCGCCGGTGGAGTG (as shown in SEQ ID NO: 4).

[0061] PRC system was as follows:

Tissue Extract 4 pL

Forward Primer (10 M) 0.4 pL

Reverse Primer (10 M) 0.4 pL

2*TansDirect PCR SuperMix 10 pL

ddH 20 5.2 pL

Total 20 pL

[0062] The PCR product was electrophoresed by 1% agarose gel, and Marker was D2000. Experimental results of the agarose gel electrophoresis were shown in FIG. 2. In FIG. 2, lanes 1 to 8 are resistant fungi, while lanes 9 to11 are controls (wild type obligate Metarhizium acridum MAC). It could be seen from FIG. 2 that the lanes 1 to 8 had ribbons between 1000bp and 2000bp (theoretical ribbon is 1559bp), but no ribbons were found in the MAC samples of the controls in the lanes 9 to 11, indicating that that the MAA05119 gene with RFP had been transferred into the genome of the wild type obligate Metarhizium acridum MAC, and the above-mentioned resistant fungus was the recombinant obligate fungus Metarhizium acridum (MAC+119). The recombinant obligate fungus Metarhizium acridum was sent to China General Microbiological Culture Collection Center (address: No.3, Yard 1, West Beichen Road, Chaoyang District, Beijing) for deposition with a deposit name of MAC119, a deposit number of CGMCC NO.14153 and a deposit date of August 29, 2017.

[0063] Example 2 Content determination of fructose-6-phosphate in mycelia of the recombinant obligate fungus Metarhizium acridum

[0064] The content of the fructose-6-phosphate (F6P) in the mycelia was determined by using PicoProbe Fructose-6-Phosphate Fluorometric Assay Kit (BioVision).

[0065] 1. Making of standard curve:

[0066] A F6P standard liquid was diluted to 1 nmol/4L, and then 0 L, 2 L, 4 L, 6 L, 8 pL and 10 L of the diluted liquid were respectively added to a 96-well white ELISA plate to enhance a luminous intensity. Assay Buffer was filled until a volume of each hole was 50 L. 50 L of Reaction mix was added. Meanwhile, the F6P Assay Buffer was used to replace the F6P Converter in the Reaction mix as a control. Preparation methods of the Reaction mix and the control were shown in Table 1 below.

[0067] Table 1 Preparation of Reaction mix and control

Reaction mix Control

F6P Assay Buffer 40 L 42 L

F6P Enzyme Mix 2 L 2 L

F6P Converter 2 L ----

F6P Substrate 2 L 2 L

F6PProbe 4 L 4 L

Total 50 L 50 L

[0068] 2. Preparation of sample:

[0069] The recombinant obligate fungus Metarhizium acridum obtained in Example 1 was cultured on an IM medium plate. After the Metarhizium acridum was cultured for 14 days, mycelia of the recombinant obligate fungus Metarhizium acridum were taken, washed 3 times with 0.1*PBS, and filtered with a 0.22 m filter screen to collect the mycelia. The samples were freeze-dried at -45°C with a freeze dryer. About 1 mg of samples was taken, weighed as m, added with 7% perchloric acid to crack cell walls (remove effects of proteins), and then the samples were grinded with a grinding rod. The solution was neutralized with K 2 C3 to make a pH between 6.5 and 8.0. After centrifugation, the supernatant was transferred to a new centrifuge tube and a total volume V was recorded for later use.

[0070] In order to eliminate background interferences caused by NADH and NADPH in the samples, a blank control group was set up.

[0071] 3. Content determination of fructose-6-phosphate

[0072] The mycelium samples of the above-mentioned recombinant obligate fungus

Metarhizium acridum were added to wells of an ELISA plate, with a sample addition amount of 50 L per well, 50 L of Reaction mix was added, and the mycelium samples of the wild obligate fungus Metarhizium acridum were used as controls. Fluorescence Ex/Em=535/587nm was measured after incubation at 37°C for 5 minutes in dark. When F6P is 0, a value obtained is 0, and the background interference is removed from the obtained data. A standard curve was drawn to obtain a trendline and an equation. The data obtained from the samples was substituted to obtain a corresponding concentration. Specific results were shown in FIG. 3.

[0073] As shown in FIG. 3, the fructose-6-phosphate contents in the MAC and the MAC+119 were 1522.2 nmol/g and 3439.5 nmol/g respectively. The fructose-6-phosphate content of the recombinant obligate fungus Metarhizium acridum obtained after transferring the phosphoglyceric kinase gene was increased, indicating that the introduction of the gene enhanced accumulation of the fructose-6-phosphate in the fungus.

[0074] Example 3 Thickness determination of cell wall polysaccharide from mycelia of the recombinant obligate fungus Metarhizium acridum

[0075] 1. Preparation of samples by high pressure freezing and freeze-substitution

[0076] The recombinant obligate fungus Metarhizium acridum obtained in Example 1 was cultured on an IM medium plate. After the Metarhizium acridum was cultured for 14 days, mycelia of the recombinant obligate fungus Metarhizium acridum was collected, washed twice with sterilized 0.1 mol/L PBS buffer (pH 7.4), and centrifuged to remove water. The mycelia were selected and put into a metal dish used for loading samples in a Leica EM PACT 2 high-pressure freezer, and added with a proper amount of freezing protection liquid to quickly fix the samples in liquid nitrogen and high-pressure environment.

[0077] The samples were taken out from the freezer and transferred to a sample tube of a Leica EM AFS2 automatic freeze substitution system in liquid nitrogen. Before transfer, 1% osmic acid-acetone solution was added to the sample tube. Freeze-substitution procedures were set as follows:

[0078] keeping -90 for 10 hours; warming up to -30°C (2°C per hour); keeping -30°C for 8 hours; and warming up to 20°C (2°C per hour). After warming up to 20°C, pure acetone solution was used to substitution every hour for thrice in total.

[0079] 2. Sample preparation and transmission electron microscope observation

[0080] In a process of resin permeation, a penetrating fluid was replaced every 12 hours, and a ratio of Epson812 resin to pure acetone in the replaced penetrating fluid was 1:3, 1:1, 3:1, and 1:0 in turn. The permeation lasted for 3 days in case of pure resin and new resin was replaced every 12 hours. After completion of permeation, Epson812 resin was used for polymerization in a polymerization furnace at 45°C for 48 hours to prepare embedding blocks. After trimming, the blocks were sliced with an ultra-thin slicer and scooped up with a 100-mesh copper mesh. The thickness of the ultra-thin section was 60 nm. The section was stained with uranyl acetate and lead citrate. Then, the mycelium section morphology of the recombinant obligate fungus Metarhizium acridum (MAC+119) was observed and photographed under 80 KV voltage using a JEM-1400 transmission electron microscope, and the wild type obligate fungus Metarhizium acridum (MAC) was taken as a control. Experimental results were shown in FIG. 4. It could be seen from FIG. 4 that polysaccharide fibers on the cell wall of the MAC were sparse, while polysaccharide fibers on the cell wall of the MAC+119 were dense. Dense polysaccharide fibers could strengthen an immune system against locusts.

[0081] Example 4 Determination of insecticidal efficiency of the recombinant obligate fungus Metarhizium acridum

[0082] Recombinant obligate fungus Metarhizium acridum (MAC+119) was inoculated on a PDA medium for culture, spores of the recombinant obligate fungus Metarhizium acridum were scraped, and an appropriate amount of peanut oil was added to suspend the spores for vortex oscillation, then the spores were collected after the mixture was filtered with glass cotton, and resuspended with peanut oil. The spores were counted by using a cell counting plate under a microscope, and a final concentration was 1x10 6 spores /ml through repeated resuspension and counting. 2 L of spore suspension was collected and dripped under back decks of gregarious male Locusta migratoria manilensis 4 days after eclosion; and as comparison, the gregarious male asiatic migratory locusts were treated with peanut oil and the spores of the wild type obligate fungus Metarhizium acridum (MAC). A number of dead asiatic migratory locusts was recorded every 12 hours. Finally,

Kaplan-Meier method in SPSS 20.0 software was used to calculate a median lethal time (LT50) and compare an insecticidal toxicity of the wild type obligate fungus Metarhizium acridum and an insecticidal toxicity of the transformed strains. Experimental results were shown in FIG. 5.

[0083] As shown in FIG. 5, the median lethal time of the wild type obligate fungus Metarhizium acridum (MAC) was 7.045 0.211 days, and the median lethal time of the recombinant obligate fungus Metarhizium acridum (MAC+119) to the migratory locusts after introducing glycerate kinase genes was 5.617 0.187 days, indicating that the introduction of the glycerate kinase gene improved the virulence of the obligate fungus Metarhizium acridum.

[0084] An increased concentration of 3-phosphoglycerate could increase a content of fructose-6-phosphate, and directly or indirectly caused accumulation of glucose and mannose-6-phosphate finally, affected glycometabolism and cell wall formation of fungi, accelerated reproduction of the fungus in a host, and affected recognition of a host immune system, thus improving an insecticidal effect of the fungus.

[0085] In this example, the median lethal time LT50 of the recombinant obligate fungus Metarhizium acridum was shortened from 7.045 0.211 days to 5.617 0.187 days, which significantly improved an insecticidal efficiency of the obligate fungus Metarhizium acridum. And obviously, that introduced gene was harmless to the environment and had good biological safety.

[0086] According to the disclosure, the accumulation of the glucose and/or the mannose-6-phosphate is directly or indirectly improved by introducing the glycerate kinase gene so as to enhance the insecticidal efficiency of fungal pesticides. According to this principle, the insecticidal efficiency can also be improved by increasing the accumulation concentration of the glucose and/or the mannose-6-phosphate through other ways.

[0087] Those described above are merely preferred examples of the disclosure, but are not intended to limit the disclosure. Any modifications and equivalent substitutions made without departing from the principle of the disclosure shall all fall within the scope of protection of the disclosure.

[0088] Reference to any prior art in this specification is not, and should not be taken as, an acknowledgement or any form of suggestion that such prior art forms part of the common general knowledge.

[0089] It will be understood that the terms "comprise" and "include" and any of their derivatives (e.g. comprises, comprising, includes, including) as used in this specification, and the claims that follow, is to be taken to be inclusive of features to which the term refers, and is not meant to exclude the presence of any additional features.

Claims

THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS:

1. A recombinant Metarhizium acridum capable of expressing phosphoglyceric kinase and increasing the expression of 3-phosphoglycerate, comprising an exogenous nucleotide sequence encoding phosphoglycerate kinase, wherein the exogenous nucleotide sequence encoding phosphoglyceric kinase comprises or consists of the following sequences:

a) a nucleotide sequence of SEQ ID NO:1;

b) a complementary sequence of a) above; or

c) a polynucleotide derived from the nucleotide of SEQ ID NO:1 due to degeneracy of a genetic code.

2. The recombinant Metarhizium acridum of claim 1, wherein a deposit number thereof is CGMCC NO.14153.

3. The recombinant Metarhizium acridum of claim 1, wherein the exogenous nucleotide sequence encoding phosphoglyceric kinase can increase a concentration of fructose-6-phosphate in the recombinant Metarhizium acridum relative to wild-type Metarhizium acridum.

4. The recombinant Metarhizium acridum of claim 1, wherein the exogenous nucleotide sequence encoding phosphoglyceric kinase comprises or consists of the SEQ ID NO: 1 or a degenerate sequence of the SEQ ID NO:1.

5. An insecticide, comprising the recombinant Metarhizium acridum of any one of claims 1 to 4, and optionally, a pesticidally acceptable vector.

6. Use of the recombinant Metarhizium acridum of any one of claims 1 to 4 in preparing an insecticide for killing locusts.

7. The use of claim 6, wherein the insecticide also comprises other active ingredients for killing locusts.

8. The use of claim 7, wherein the other active ingredients are selected from a group consisting of destruxins, pyrethroid, carbamate, neonicotinic acid, neuronal sodium channel blocker, insecticidal macrolide, y-aminobutyric acid (GABA) antagonist, diflubenzuron and chlorbenzuron.

9. A preparation method of the recombinant Metarhizium acridum of any one of claims 1 to 4, comprising the following step of:

operably introducing a nucleotide sequence encoding phosphoglyceric kinase into obligate fungus Metarhizium acridum.

10. The method of claim 9, wherein the introducing operation is performed by agrobacterium tumefaciens mediated transformation.

11. A method for killing locusts, comprising a step of applying the recombinant Metarhizium acridum of any one of claims 1 to 4.