CN101755050A

CN101755050A - Polynucleotide sequences encoding scorpion toxin and transformed insecticidal fungi

Info

Publication number: CN101755050A
Application number: CN200880016082A
Authority: CN
Inventors: 王成树; 吕丁丁
Original assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Current assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Priority date: 2007-05-18
Filing date: 2008-05-19
Publication date: 2010-06-23
Anticipated expiration: 2028-05-19
Also published as: CN101307313A; WO2008141578A1; CN101755050B

Abstract

The invention provides optimized polynucleotide sequences encoding a scorpion Androctonus australis neurotoxin AaIT, which are suitable for being transcribed and expressed in fungi. Also provided are the fungi capable of expressing AaIT, such as Metarhizium anisopliae, which have improved insecticidal efficiency and can be used for insect control in effect.

Description

Polynucleotide sequences encoding scorpion toxin and transformed insecticidal fungi

Encode the polynucleotides of scorpion toxin and the disinsection fungal technical field of conversion

The invention belongs to genetic engineering field, more particularly, the present invention relates to a kind of coding north African scorpion neurotoxin polypeptide A alT of optimization polynucleotides, north African scorpion neurotoxin polypeptide A alT fungal engineering strain can be expressed, and utilize the method for bacterial strain killing insect.Background technology

With the raising that the development and people of social economy are required living standard, the research and application of environment-friendly microbial insecticide are paid attention to by higher and higher.Microbial insecticide species is a lot, it has been found that have kind more than 2000, can be divided into bacterium, fungi, virus, protozoa and nematodes etc. according to microbe species.Be developed at present apply and formed commercial prod mainly have bacterium insecticides, fungi insecticides, viral insecticides.

Fungi insecticides have had applicating history for many years, and the fungal species applied at present are mainly the wider insect pathogenic fungus of some parasitism spectrums, and species mainly has：Muscardine, green muscardine fungus, Paecilomyces varioti, Aschersonia and Verticillium dahliae.The main mechanism of fungi desinsection is actively invaded by insect body wall, belong to contact microbial insecticide, thus there is unique advantage by infection of digestive canal than virus or bacterium entomopathogen, control, insect such as to sucking pest, which are not likely to produce resistance and easily obtained, continues control effect.But with bacterium or viral insecticide similarly, fungus insecticide equally has the slow weakness of insecticidal effect, under suitable condition, generally require time of 3-7 days, this largely hinders the large-area applications of the microbial pesticide including fungus insecticide, especially in the control of explosive insect, microbial insecticide has significant limitation.

Therefore, this area, which it is also desirable to find, more effectively can rapidly kill insect and safe kill insect preparation.The content of the invention

It is an object of the invention to provide a kind of coding north African scorpion neurotoxin polypeptide A alT of optimization polynucleotides.

Another object of the present invention is to provide a kind of fungal engineering strain for expressing north African scorpion neurotoxin polypeptide A alT.

Another object of the present invention is to provide a kind of effective, method for being remarkably improved fungus insecticide insecticide efficiency.

In the first aspect of the present invention there is provided a kind of coding north African scorpion neurotoxin polypeptide A alT polynucleotides, the sequence of described polynucleotides is selected from the group：

(a) there is SEQ ID NO:Nucleotide sequence in 1 shown in 163-375；

(b) there is SEQ ID N0:Nucleotide sequence in 1 shown in 106-375；

(c) there is SEQ ID N0:Nucleotide sequence in 1 shown in 1-375；

(d) with SEQ ID NO:163-375 have at least 75% phase same sex, and coding SEQ ID NO in 1:The nucleotide sequence of amino acid sequence shown in 20-89 in 2, and described polynucleotide sequence can express in fungi；Or

(e) under strict conditions can be with（A) polynucleotides limited hybridize, and described polynucleotide sequence can be expressed in fungi.In the second aspect of the present invention there is provided the purposes of described polynucleotides, the preparation for preparing preventing and treating insect.

In the third aspect of the present invention there is provided a kind of insect haemocoele specific expression promoter, described promoter is selected from the group：

(1) there is SEQ ID NO:The polynucleotides of nucleotide sequence shown in 3；

(2) under strict conditions can be with（1) polynucleotide sequence limited hybridizes and with the polynucleotides for instructing target gene specific expressed function in insect haemocoele；Or (3) with SEQ ID NO:Nucleotide sequence shown in 3 has more than 80% homology and with the polynucleotides for instructing target gene specific expressed function in insect haemocoele.

In the fourth aspect of the present invention there is provided the purposes of described promoter, described promoter is used to instruct target gene specific expressed in insect haemocoele.

In the fifth aspect of the present invention there is provided a kind of construction, described construction contains elements below successively from 5 ' to 3 '：Promoter of the present invention；With

Target gene.

In another preference, described target gene is foreign gene.

In another preference, described target gene is structural gene.

In another preference, described target gene codified has the albumen of specific function.

In another preference, described target gene codified has to the virose albumen of insect.

In another preference, described target gene is located at the downstream of the insect haemocoele specific expressing promoter, and is less than 2000bp (preferably, less than lOOObp with the interval of the promoter;It is furthermore preferred that less than 500bp;Most preferably, less than 300bp).

In another preference, in described construction, between promoter and target gene, also include：Ribosomes translates recognition component, and/or signal peptide encoder element.

In another preference, in described construction,

Described target gene is the encoder element of insect toxins polypeptide；

Described ribosomes translation recognition component has SEQ ID NO:The nucleotide sequence of 9-105 in 1；

Described signal peptide has SEQ ID NO:Amino acid sequence in 2 shown in 1-19.

In another preference, the encoder element of described insect toxins polypeptide is north African scorpion neurotoxin polypeptide A alT encoder element.In another preference, described north African scorpion neurotoxin polypeptide A alT has SEQ ID NO:Amino acid sequence in 2 shown in 20-89.

In another preference, the coded sequence of described signal peptide has SEQ ID NO:Nucleotide sequence in 1 shown in 106-162.In another preference, described north African scorpion neurotoxin polypeptide A alT encoder element is selected from the group：

(a) there is SEQ ID NO:Nucleotide sequence in 1 shown in 163-375；

(b) there is SEQ ID N0:Nucleotide sequence in 1 shown in 106-375；

(c) there is SEQ ID N0:Nucleotide sequence in 1 shown in 1-375；

(e) under strict conditions can be with（A) polynucleotides limited hybridize, and described polynucleotide sequence can be expressed in fungi.In the sixth aspect of the present invention there is provided a kind of carrier, described carrier contains described polynucleotides or described construction.

In the seventh aspect of the present invention, there is provided a kind of cell, described cell：

Contain described carrier；Or

The described polynucleotides or described construction of external source are integrated with its genome.

In another preference, described cell is recombinant fungus cell.

In another preference, described fungi is selected from：Green muscardine fungus or muscardine.

In another preference, described fungal cell is spore form. In the eighth aspect of the present invention there is provided a kind of spore, described spore is produced by described fungal cell.

In the ninth aspect of the present invention there is provided a kind of preparation for preventing and treating insect, described preparation contains（A) cell and/or described spore described in；And（B) acceptable carrier in Pesticide Science.

In another preference, described preparation contains the X 10 of 1 X 10¹²Individual/ml (preferably 1 X 10³-1 X 10^1QIndividual/ml;More preferably 1 X 10⁴-1 X 10⁸Individual/ml) described in spore（Can be to be dense Shrink forms or dilute form）.

In the tenth aspect of the present invention there is provided a kind of method for preventing and treating insect, methods described includes：Give the object for needing to prevent and treat insect or described spore is applied in place.

In another preference, described insect is selected from（But it is not limited to）：Lepidopterous insects, dipteral insect, coleopteron.In the eleventh aspect of the present invention there is provided a kind of carrier, described carrier contains described insect haemocoele specific expression promoter, is used as promoter element.

In another preference, described carrier is also containing the target gene being connected with described insect haemocoele specific expression promoter operability.

The other side of the present invention, due to this disclosure, is obvious to those skilled in the art.Brief description of the drawings

Fig. 1 shows the fusion sequence of north African scorpion neurotoxin polypeptide A alT gene orders and other functional sequences, and it contains mRNA 5'- non-translational regions, signal coding sequence, AalT coded sequences, and two ends carry Bam HI restriction enzyme sites.

Fig. 2A shows north African scorpion neurotoxin polypeptide A alT expression vector pMcl lprAalT structural representation.

Fig. 2 B show expression vector pBarGPEl structural representation.

Fig. 3 shows the result of fungal transformation and expression checking.

A, is tested using green muscardine fungus GFP-549 transformants induced expression, shows that green fluorescent protein GFP signal is just expressed only when fungal infection to insect haemocoele；

B, A optical microscope picture；

C, RT-PCR are detected, are shown using primer ToxU and ToxL amplification：When transformant AaIT-549 grows in saprophytic culture medium Sa Shi dextrose broths, toxin gene is not expressed, only in insect hemolymph（Including in vitro）Just expressed during growth；

D, time series RT-PCR are analyzed, and show quickly to be expressed when fungi grows in insect hemolymph；

E, Western hybridization verification, show transformant AaIT-549 in insect blood cultured in vitro（Swimming lane 3) or the interior expression AalT polypeptides of the just dead maduca sexta larva body of infection（Swimming lane 4-8), when transformant grows in minimal medium or Sa Shi glucose culture solutions（Swimming lane 1,2), toxin polypeptide will not be expressed；

F, G, transformant AaIT-549 isolated growths in insect hemolymph are used to inject calliphorid after 72 hours（F, on）And maduca sexta（G, it is left）Larva, the situation for causing under typical polypide Shou Shrink phenomenons, the F or G right sides to be injected at after the wild-type strain 549 grown in insect hemolymph.

Fig. 4 shows the wild types of ARSEF 549（WT) and toxin conversion bacterial strain（AaIT-549) to maduca sexta under identical concentration（And Aedes aegypti a)（B) survival curve during biologicall test.

A, it is respectively 5 X 10 to determine spore concentration C1-C3⁵, 1 X 10⁶With 2 X 10⁷Conidium/milliliter.Control（Control it is) the corresponding situation of the negative control only handled with 0. 05% Tween-20.It is maduca sexta larva just dead after the infection of wild type ARSEF 549 on interior figure, dead body Shou Shrink larva after the lower infection for AaIT-549； B, it is respectively 1 x 10 to determine spore concentration C1-C3⁴, 1 X 10⁵With 5 x 10⁵Conidium/milliliter.Control（Control it is) the corresponding situation of the negative control only handled with 0. 05% Tween-20.It is Aedes aegypti adult just dead after the infection of wild type ARSEF 549 on interior figure, the adult of dead wing expansion after the lower infection for AaIT-549.

Fig. 5 shows the wild types of ARSEF 549（WT) and toxin conversion bacterial strain（AaIT-549) the frass dry weight after infection maduca sexta compares.

Fig. 6, which is shown, picks out at random the toxicity test that 10 positive transformants of Bbl 3 inject silkworm.

Fig. 7 shows the Monochamus alternatus survival rate that different strains infect.

Fig. 8 shows different raw test worms and infects result.（A) 5 age silkworms inject 50 μ bacterium solutions after reaction, the above be through Bbl 3T-4 inject, below wild type Bbl 3 injection result；（B) it is the bombys batryticatus after dendrolimus punctatus is infected by bacterial strain Bbl 3T-4- l, the bombys batryticatus after being infected below for wild-type strain above；（C) left side is the bombys batryticatus after 5 age Monochamus alternatus are infected by Bb202T-7, and right side is Monochamus alternatus when not infected；（D) on the left of is the bombys batryticatus that greater wax moth is infected by Bb l 3T-4- l, and right side is the bombys batryticatus after being infected by wild type Bbl 3.Embodiment

The present inventor, first according to the gene preference of fungi, north African scorpion neurotoxin polypeptide A aIT is expressed by gene optimization means by in-depth study extensively in fungal cell.The neurotoxicity of fungal cell's infected insect and the ability colonized in insect bodies and north African scorpion neurotoxin polypeptide A alT is combined together by the present invention well, and substantially increase fungi kills insect efficiency.In order to improve the insecticide efficiency of fungi, it is considered as desirable by the inventor to convert the toxin gene of external source in fungal cell, insecticide efficiency is improved by expressing toxin.Contain insect-specific neurotoxin not of the same race in the venom or salivary gland of scorpion, spider and ant, typically can benumb or kill prey insect in micro level.Therefore, the present inventor have selected north African scorpion（^K roc io/Ms austral is) neurotoxic peptide AalT, according to the gene code preference of disinsection fungal, by AalT Gray codes into disinsection fungal gene order, and gene chemical synthesis is carried out in 5 '-end addition secretion signal peptide sequence, the conversion of disinsection fungal is carried out under the regulation of controllable initiating.By the continuous exploration and improvement to technological means, finally in disinsection fungal successful expression AalT and empirical tests its can improve the insecticide efficiency of fungi.Fungi

In the present invention, described fungi refers to that a class has infected insect ability and the disinsection fungal that can be colonized in insect bodies.It is preferred that, described fungi is selected from：Green muscardine fungus or muscardine.

Green muscardine fungus（Fe isr i'zi'MB i'so/^ise) category ascomycetes, it is a kind of insect pathogenic bacteria of wide spectrum, can 8 mesh of parasitic insect, 30 sections about more than 200 plant altogether, also can parasitic mite class, it can induce insect and produce green muscardine.The bacterium colony of green muscardine fungus is in villiform or flocculence, and initial white is in green when producing spore, therefore claim green muscardine fungus.

Green muscardine fungus is invaded in insect bodies with spore-germination, and breeds and formed toxin in vivo, causes insect death, but plant is not poisoned.Dead worm can infect other strong worms again, superinfection is formed in insect population, insect death can be caused within a certain period of time after the germ spore that body surface is formed sheds.Its host range plants insect more than more than 200, and more typical has scarab beetle, weevil, wireworm, lepidopteran insect larvae, stinkbug etc..But natural green muscardine fungus has the slow weakness of insecticidal effect.

Muscardine（Eay eria ssia/ja) belong to Ascomycotina, Beauveria（ eaw eria).Mycelia has tabula to have branch Fungi.Muscardine can invade the various insects of 6 Ge Mu, 15 sections 200, amount reproduction in the polypide of mite class, while producing white stiff plain (big ring grease toxoid）And calcium oxalate crystal, these materials can cause insect to be poisoned, and body fluid is found that function changes, and upset metabolism so that insect death, but have desinsection speed slower.North African scorpion neurotoxin polypeptide A alT

North African scorpion neurotoxin polypeptide A alT is a kind of insect-specific neurotoxin polypeptide for being isolated from north African scorpion, and it contains 70 amino acid（SEQ ID N0 :2) on the ion channel for, acting on insect nerve cell, in low concentration（Such as nanogram levels）It can benumb or directly kill insect, caused classical symptom is to cause insect body to receive Shrink, but harmless to mammal.In the past, those skilled in the art killed insect once using AaIT is expressed in insect baculovirus using that can express AalT baculoviral, it was demonstrated that be that a kind of can improve the feasible method of insect virus insecticide efficiency to a certain degree.However, carrying out desinsection using insect viruses has significant limitation, major defect is：Virus needs live body culture to breed, and production cost is high；Another aspect insect viruses are by infection of digestive canal, and the speed for killing insect is slow.This area so far also not in disinsection fungal successful expression AalT precedent.

In the present invention, the encoding gene of AalT polypeptides is transformed into the genome of disinsection fungal by the present inventor, after the mitogenetic spore of the fungi is contacted with insect, actively intruded into by insect body wall in insect bodies, AalT polypeptides are expressed in insect bodies, so as to greatly increase the insecticide efficiency of fungi.More particularly, the present inventor designs specific promoter sequence and signal coding sequence by 5 ' ends of the coding gene sequence in AalT polypeptides, so that AalT polypeptides by specificity overexpression and can be secreted into outside fungal cell in insect haemocoele.

Therefore, the invention provides a kind of polynucleotides, described polynucleotides codified north African scorpion neurotoxin polypeptide A alT, it contains SEQ ID NO:Nucleotide sequence in 1 shown in 163-375.Described polynucleotides are the gene code preferences according to fungi, are obtained after being transformed by gene optimization, so that it can well be expressed in fungi.Described polynucleotides and AalT native polynucleotide（GenBank accession number M27706, can not be expressed in fungi）The phase same sex be 71. 6%.

In polynucleotides of the present invention, in addition to encoding the polynucleotides of AalT polypeptides, it may also include additional encoded signal peptide sequence and/or ribosomes translate the polynucleotides of recognition sequence.

The invention further relates to the variant of above-mentioned polynucleotides, it can also encode north African scorpion neurotoxin polypeptide A alT, and it is being transformed into fungi（It is preferred that green muscardine fungus or muscardine）After can express AalT polypeptides, but the sequence of described variant is differed with natural AalT gene orders.Described nucleotide variants include substitution variants, Deletion variants and insert variation.As known in the art, allelic variant is the alternative forms of a polynucleotides, and it is probably the substitution of one or more nucleotides, but not from substantially change its coding polypeptide sequence and function.It is preferred that, variant and the SEQ ID NO of described polynucleotides:The phase same sex that 163-375 have 75% in 1；It is furthermore preferred that the variant of described polynucleotides and SEQ ID NO:The phase same sex that 163-375 have 80% in 1；Most preferably, the variant of described polynucleotides and SEQ ID NO:The phase same sex that 163-375 have 85% or 90% or higher in 1, such as both phase same sexes are 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

The polynucleotides full length sequence or its fragment of the present invention can generally be obtained with PCR TRAPs, recombination method or artificial synthesized method.For PCR TRAPs, can be according to relevant nucleotide sequence disclosed in this invention, especially open reading frame sequence obtains relevant sequence with commercially available cDNA storehouses or the cDNA storehouses as prepared by conventional method well known by persons skilled in the art to design primer as template, amplification.

Once obtain the polynucleotide sequence of the present invention, it is possible to obtain the sequence in large quantity with recombination method.This is typically to be cloned into carrier, then is transferred to cell, then by conventional method from the host cell after propagation the isolated sequence. In addition, can also synthesize the polynucleotide sequence of the present invention with artificial synthesized method, it is described it is artificial synthesized can be single synthesis（Suitable for the shorter situation of fragment length）Or multi-stage synthesis（Multiple small fragments are first synthesized, are then attached again）.At present, it is already possible to obtain encoding north African scorpion neurotoxin polypeptide A alT DNA sequence dna by artificial synthesized completely.Then the DNA sequence dna can be introduced to appropriate DNA molecular（Such as carrier）In cell.

Using round pcr DNA amplification/RNA method（Saiki etc., Science 1985； 230：1350-1354) it is optimized for obtaining the gene of the present invention.Primer for PCR can be properly selected according to the sequence information of invention disclosed herein, and available conventional method synthesis.Can be with conventional method as expanded DNA/RNA fragments are separated and purified by gel electrophoresis.Insect haemocoele specific expression promoter and its gene expression of guidance

As used herein, described " promoter " or " promoter region（Domain）" refer to a kind of nucleotide sequence, it is typically found in the upstream of coded sequence（5 '), nucleotide sequence can be guided to be transcribed into mRNA.Usually, the recognition site of other factors necessary to promoter or promoter region provide RNA polymerase and correct starting transcription.Herein, described promoter or promoter region include the variant of promoter, and the variant can be the variant that the allelic variant or non-natural naturally occurred occurs.The variant includes substitution variants, Deletion variants and insert variation.

As used herein, " tissue-specific promoter " is also known as " organ specific promoters ", under this kind of promoter regulation, and gene is often only expressed at some specific organ or tissue positions.

As used herein, described " being operably connected " refers to functional space arrangement of two or more nucleic acid regions or nucleotide sequence.For example：Promoter region is placed in the ad-hoc location relative to target gene nucleotide sequence so that the transcription of nucleotide sequence is guided by the promoter region, so that, on promoter region " being operably connected " to the nucleotide sequence.

Generally, if certain tissue or organ in mRNA with than it is other tissue or organ in it is high at least 10 times, preferably at least high 100 times, more preferably at least high 1000 times of levels are expressed, then the promoter is considered as tissue or organ specificity.

The present invention provides a kind of promoter, and described promoter is selected from the group：

(1) there is SEQ ID NO:The polynucleotides of nucleotide sequence shown in 3；

(2) under strict conditions can be with（1) polynucleotide sequence limited hybridizes and with the polynucleotides for instructing target gene specific expressed function in insect haemocoele；Or

(3) with SEQ ID NO:Nucleotide sequence shown in 3 has more than 80% homology and with the polynucleotides for instructing target gene specific expressed function in insect haemocoele.

The hybridization of polynucleotides is technology well known to those skilled in the art, and the hybrid trait of specific a pair of nucleic acid indicates their similitude or homogeneity.Therefore, the invention further relates to SEQ ID NO:Have at least 50% between nucleotide sequence hybridization and two sequences shown in 3, preferably at least 70%, the polynucleotides of more preferably at least 80% (such as 85%, 90%, 95%, 96%, 97%, 98% or 99%) phase same sex.The present invention is more particularly directed under strict conditions with the interfertile polynucleotides of polynucleotides of the present invention.

In the present invention, " stringent condition " refers to：（1) hybridization and elution under compared with low ionic strength and higher temperature, such as 0. 2

X SSC O. 1%SDS, 60 °C;Or（2) added with denaturant when hybridizing, such as 50% (v/v) formamide, the l%Ficoll of 0. 1% calf serum/0.,

42 °C etc.；Or（3) the phase same sex only between two sequences just hybridizes at least more than 90% when more preferably more than 95%.Also, interfertile polynucleotides, which also have, instructs target gene function specific expressed in insect haemocoele.

The promoter of the present invention is tissue or organ specificity, and more particularly, it is that insect haemocoele is specific.In the example of the present invention, the inventors discovered that, under the guidance of the promoter of the present invention, AalT genes or GFP gene specifics can be made in insect Express, and do not expressed in other tissues, organ or other condition of culture in haemocoele.

The promoter of the present invention can be operatively connected on target gene, and the target gene can be that external source is (heterologous relative to promoter）'s.Described target gene generally can be any nucleotide sequence（Preferred structure nucleotide sequence）, described target gene optimized encoding has the albumen of specific function, such as some for the virose albumen of insect.

The promoter of the present invention can also be operably connected in the objective gene sequence being modified, and the target gene is that external source is (heterologous relative to promoter）'s.Described target gene can be modified to produce various desired characteristics.For example, target gene can be modified to increase expression quantity, toxicity is improved, changes the modification after translation（Such as phosphorylation site）, the stability of albumen, insertion or deletion cell signal etc. will be improved outside translation product transporte to cells.

In addition, promoter and target gene can be designed to lower specific gene.This realizes that the sequence is reversely directed with antisense generally by promoter is connected in objective gene sequence.One of ordinary skill in the art is familiar with this antisense technology.Any nucleotide sequence can be conditioned by this way.

Any foregoing promoter and objective gene sequence can be comprised in recombinant vector.

Described recombinant vector is generally comprised（From 5 ' to 3 ' directions）：Guide the promoter of target gene transcription, and target gene.If desired, described recombinant vector can also include 3 ' transcription terminators, 3 ' polymerized nucleosides acidifying signal, other untranslated nucleotide sequences, transhipment and targeting nucleotide sequence, resistance selective marker, enhancer or operator.

Method for Prepare restructuring carrier is well known in the art.Term " recombinant expression carrier " refers to bacterial plasmid well known in the art, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus or other carriers.In a word, as long as can be replicated in host and stably, any plasmid and carrier can be used.

Method well-known to those having ordinary skill in the art can be used to build the expression vector containing promoter of the present invention and/or objective gene sequence.These methods include recombinant DNA technology in vi, DNA synthetic technologys, In vivo recombination technology etc..Expression vector also includes the ribosome bind site and transcription terminator of translation initiation.

In addition, expression vector preferably includes one or more selected markers, to provide the phenotypic character for the host cell for being used to select conversion, such as dihyrofolate reductase, neomycin resistance, hygromycin resistance and green fluorescent protein（GFP) etc..

Except the promoter containing the present invention in recombinant vector, it can also contain one or more other promoters.Described other promoters are, for example,：Tissue specificity, composing type or induction type.

Carrier comprising above-mentioned appropriate promoter and target gene, can be used for converting appropriate host cell, allows it to marking protein.

Host cell can be prokaryotic, such as fungal cell, bacterial cell；Or low eukaryotic, such as yeast cells；Or higher eucaryotic cells, such as plant cell.

When the polynucleotides of the present invention are expressed in higher eucaryotic cells, if will be strengthened transcription when inserting enhancer sequence in the carrier.Enhancer is DNA cis-acting factors, generally about there is 10 to 300 base-pairs, acts on promoter to strengthen the transcription of gene.

Persons skilled in the art are aware that how to select appropriate carrier, promoter, enhancer and host cell.

It can be carried out with recombinant DNA conversion host cell with routine techniques well known to those skilled in the art, such as CaCl₂Method, MgCl₂Method.If desired, conversion can also be carried out with the method for electroporation.When host is eucaryote, following DNA transfection methods are can select：Calcium phosphate precipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging etc.. Construction and carrier

The present invention also provides a kind of construction, and described construction contains elements below successively from 5 ' to 3 '：The insect haemocoele specific expressing promoter of the present invention, target gene.Generally, described target gene is located at the downstream of the insect haemocoele specific expressing promoter, and is less than 2000bp (preferably, less than lOOObp with the interval of the promoter;It is furthermore preferred that less than 500bp;Most preferably, less than 300bp).

As the preferred embodiment of the present invention, between promoter and target gene, also include：Ribosomes translates recognition component, and/or signal peptide encoder element.Target gene is secreted into extracellular by whether the adding of signal peptide encoder element depending on the species and whether needing of the target gene of required expression.

As the preferred embodiment of the present invention there is provided a kind of construction that can be used for expressing insect toxins polypeptide, described construction has elements below from 5' to 3' successively：

The promoter of the present invention；

Ribosomes translates recognition component；

Signal peptide encoder element；With

The encoder element of insect toxins polypeptide.

As the preferred embodiment of the present invention, described insect toxins polypeptide is north African scorpion neurotoxin polypeptide A alT, and described north African scorpion neurotoxin polypeptide A alT has SEQ ID NO:Amino acid sequence in 2 shown in 20-89.It is furthermore preferred that described north African scorpion neurotoxin polypeptide A alT encoder element has SEQ ID NO:Nucleotide sequence in 1 shown in 163-375, the nucleotide sequence have passed through codon optimization, so as to be suitable for expressing in fungal cell.

The promoter of the present invention may be such that AalT encoder element is specifically expressed in insect haemocoele, and do not express or express under other circumstances and be extremely low, the harm to environment or other animals and plants caused beyond insect is expressed in so as to avoid AalT polypeptides, security and environment friendly is improved.

As the preferred embodiment of the present invention, described ribosomes translation recognition component has SEQ ID NO:The nucleotide sequence of 9-105 in 1.

As the preferred embodiment of the present invention, described signal peptide has SEQ ID NO:More particularly, the coded sequence of described MCL1 protein signal peptides has SEQ ID NO to the bad ^ of amino acid sequence in 2 shown in 1-19:Nucleotide sequence in 1 shown in 106-162.Described MCL1 protein signal peptides may be such that AalT is secreted into fungal cell（Or spore）Outside, so that AalT is contacted with the body cavity of insect, toxicity is played.Fungal vector and fungal cell

The present invention also relates to the carrier of the AalT polynucleotides comprising the present invention.In the present invention, encode AalT polynucleotide sequence or the construction containing the polynucleotide sequence can be plugged into recombinant expression carrier.Applicable " recombinant expression carrier " includes but is not limited in the present invention：The carrier expressed in fungi.As long as can be replicated in fungi and stably, any plasmid and carrier can be used.One key character of expression vector is to usually contain replication orgin, promoter, marker gene and translation control element.

Method well-known to those having ordinary skill in the art can be used to build coded sequence containing AalT and the expression vector of suitable transcription/translation control signal.These methods include recombinant DNA technology in vi, DNA synthetic technologys, In vivo recombination technology etc.（Sambroook etc.,

Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).Described DNA sequence dna can be effectively connected in the appropriate promoter in expression vector, to instruct mRNA to synthesize. It is used as the preferred embodiment of the present invention, the promoter of the present invention is cloned into expression vector by the present inventor, then the sequence that recognition component, signal peptide encoder element and north African scorpion neurotoxin polypeptide A alT encoder element will be translated containing ribosomes is connected to the 3' ends of promoter, constitutes the expression vector of restructuring.

The carrier of above-mentioned appropriate DNA sequence dna and appropriate promoter or control sequence is included, can be used for converting host cell, allow it to marking protein.

In order to prepare the recombinant fungus cell that can express AalT polypeptides, described construction or carrier are converted into fungal cell.The present invention has no particular limits to the method for conversion.The method of fungal protoplasts is appropriate in the present invention, methods described can be found in Wang, C. A col lagenous protect ive coat enables Me tarhizium anisopliae to evade insect immune response s. Proc Na tl Acad Sci USA. 103 of S. standing grain mouthful St Leger, R. J. 2006.：Described in 6647-6652.The method for screening transformant is well-known to those skilled in the art.

Obtaining fungal cell's recon of inheritance stability（Recombinant fungus bacterial strain）Afterwards, can be by the recombinant fungus inoculation to appropriate culture medium, so that fungal bacterial strain breeding and/or producing spore.Recombinant fungus spore can be made into preventing and treating the preparation of insect, so that for killing insect.The insect that can be killed includes（But it is not limited to）：Lepidopterous insects, dipteral insect, coleopteron.Prevent and treat the preparation of insect

Present invention also offers a kind of preparation for preventing and treating insect（Such as agricultural chemicals), described preparation contains：The described recombinant fungus of effective dose or its conidium.It is furthermore preferred that described preparation is also containing acceptable carrier in Pesticide Science.

The preparation of the preventing and treating insect of the present invention can be made into any suitable formulation.For example, the form of described preparation includes (but being not limited to；)：Pulvis, granule, finish, emulsion, can wet-milling, microcapsule formulations, non-woven fabrics microbial inoculum.

In preparation of preparation, suitable solid diluent includes (but being not limited to；)：Diatomite, shuck, tricalcium phosphate, cork powder, clay or the water-soluble polymer such as kaolin, bentonite or Attagel.

Solid pharmaceutical preparation can also can also play diluent in solid-state containing one or more compatibility wetting agents, dispersant, emulsifying agent or pigment, these compositions.

The form of liquid preparation can be solution, suspension or emulsion, can also be wrapped in natural or synthetic polymer, it is possible to include wetting agent, dispersant or emulsifying agent.Such emulsion, suspension or solution can prepare water-soluble polymer (and mixture of above-mentioned diluent) with aqueous, organic or water-organic diluent.In addition, ionic for example described above or non-ionic wetting agent, dispersant or emulsifying agent or their mixture can be contained in the diluent.

Described preparation can be to be dense Shrink forms or dilute form.As the preferred embodiment of the present invention, described preparation contains 1 X 10²-1 X 10¹²Individual/ml (liquid）Or 1 X 10²-1 X 10¹²Individual/g (solids）The spore of the recombinant fungus bacterial strain；It is furthermore preferred that described preparation contains Ι Χ Ι Ο Χ Ι Ο¹" individual/ml (liquid）Or Ι Χ Ι Ο Χ Ι Ο¹" individual/g (solids）The spore of the recombinant fungus bacterial strain；It is further preferred that described preparation contains 1 X 10⁴- 1 X 10⁸Individual/ml (liquid）Or 1 X 10⁴- 1 X 10⁸The spore of individual/g (solid) recombinant fungus bacterial strains.Preparation miospore content can suitably be increased or decreased according to formulation actual conditions.

It is adapted to have no particular limits using the object or place of the preparation protection of the present invention, can be (but be not limited to；)：Cereal crops (such as corn, wheat, paddy rice, sorghum；)；Field, woodland, plantation institute, greenhouse, orchard and ornamental crops, plantation institute crop and forest in vineyard, for example：Cotton, tobacco, vegetables (such as beans, rape, cucurbit, lettuce, onion, tomato, pepper), field crops (such as potato, beet, peanut, soybean, rape；), sugarcane, meadow and forest (such as corn, sorghum, alfalfa；), plantation institute crop (tealeaves, coffee, cocoa, banana, oil palm, coconut, rubber, spices；), orchard and hurst (such as drupe, Citrus, Kiwi berry, avocado, mango, olive, English walnut；), vineyard, the ornamental crops in greenhouse, garden or park, flowers and shrub, forest (including fallen leaves forest, evergreen forest in the woods, plantation institute and flower nursery；).The method for preventing and treating insect

The present invention also provides a kind of method for preventing and treating insect, and methods described includes：Give the described spore for the object effective dose for needing to prevent and treat insect.

The appropriate method for the plant being applied to using described spore preparation in growth is included：Solid is sowed, foliage spray, liquid irrigation etc..It is preferred that method of application be to foliar spray use.

The administration that those skilled in the art can be seen that the preparation must change with the external condition such as temperature, humidity, pending area and pending plant.Therefore, using than that be able to should change in a wider scope.The frequency of use of invention formulation can be selected by peasant, disease control professional person or other skilled in the art according to Expected Results.Main advantages of the present invention are：

(1) neurotoxicity of fungal cell's infected insect and the ability colonized in insect bodies and north African scorpion neurotoxin polypeptide A alT is combined together by the present invention well first, so that substantially increase fungi kills insect efficiency.

(2) codon transformation has been carried out to AalT encoding gene in the present invention, so as to utilize green muscardine fungus high efficient expression AalT polypeptides, has overcome AalT genes naturally isolated in the prior art and be difficult to the technical barrier expressed in green muscardine fungus.

(3) coded sequence of the signal peptides of MCL 1 is added by 5 ' ends of the encoding gene in AalT, and carry out the expression of controlling gene with insect haemocoele specific expression promoter, so that conversion has AalT recombinant fungus bacterial strain can specificity high expression in insect haemocoele.

(4) preparation of preventing and treating insect can be prepared into using described recombinant fungus spore（Agricultural chemicals), the preparation applies convenient, and the killing-efficiency to harmful insect is high, and other animals and plants beyond environment and insect are safe from harm, and belongs to a kind of environment-friendly preparation.

(5) it can be used for instructing the foreign protein promoter that specific efficient is expressed in insect haemocoele the invention firstly discloses a kind of.With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are only illustrative of the invention and is not intended to limit the scope of the invention.The experimental method of unreceipted actual conditions in the following example, generally according to normal condition such as Sambrook et al., molecular cloning：Lab guide（New York :Cold Spring Harbor Laboratory Press, 1989) described in condition, or according to the condition proposed by manufacturer.Unless otherwise indicated, otherwise percentage and number are calculated by weight.Unless otherwise defined, all specialties used in text are identical with meaning known to one skilled in the art with scientific words.In addition, any method similar or impartial to described content and material all can be applied in the present invention.Preferable implementation described in text only presents a demonstration with material to be used.The gene chemical synthesis of embodiment 1 and vector construction

1. the structure of gene

The design of gene is as follows, by north African scorpion for insect specific neurotoxic peptide AalT amino acid sequence Gray code into disinsection fungal preference gene, and the gene 5'- ends add Metarhizium anisopliae gene M CU (referring to GenBank accession number：DQ238488 or DQ238489;Or the A col lagenous protect ive of Wang, C. S. standing grain Jie St Leger, R. J. 2006. coat enables Me tarhizium anisopliae to evade insect immune responses. Proc Na tl Acad Sci USA. 103 :Signal peptide MCL1 SP 6647-6652), amino acid sequence is MRELSSVLAL SGLLALASA) coded sequence and mRNA 5'- non-translational regions.Also, separately designed at sequence two ends Restriction enzyme site is in order to cutting and connect.

By conventional artificial synthesized gene of method, the sequence of synthesis is as shown in figure 1, and pass through It is cloned into plasmid pUC57 (Genescript companies by restriction enzyme site）.

2. the structure of carrier

In order to reach the purpose for making gene specifically expressing in insect haemocoele, the present inventor uses the promoter of the special cance high-expression gene of green muscardine fungus insect haemocoele（Pro) as the promoter for instructing the gene expression, the promoter is cloned into expression vector, specific method is as follows：

Using following primer：

PcU (SEQ ID NO : 4)：

CGGGATCCAATCATGCAGCGCTATGAGA, (underscore is fefflA restriction enzyme sites）；Standing grain mouthful

PcL (SEQ ID NO : 5)：

CTTGGATCCCGGGATGGTCTAGGGAACGGAAA, (underscore be respectively BamHI and Smal Difficult it is straight,）.

With green muscardine fungus genomic DNA, (prepared by conventional method）For template, Gene A TG translation initiation sites upstream 2769bp sequences are obtained by PCR amplifications.

Pcr amplification product is cloned into plasmid pGPS3Bar through digestion, after purification (referring to Wang, C. S. and St Leger, the A col lagenous protect ive coat enables Me tarhizium anisopliae to evade insect immune re sponse s. Proc Na tl Acad Sci USA. 103 of R. J. 2006.:In corresponding site 6647-6652), plasmid pBarPc is obtained.

In order to verify the regulation and control specificity of promoter, the present inventor utilizes following primer：

TCCCTAGACCATCCCGTACCGGTCGCCACCATG (SEQ ID NO : 6)；Standing grain mouthful

CTGTCGACGGATCCCTTACTTGTACAGCTCGTCCA (SEQ ID NO : 7)。

With plasmid pEGFP (Clontech) for template, gene order is obtained by PCR amplifications.Then, using In-Fusion Dry-down PCR kits（Clontech) the 5 a/ restriction enzyme sites that C gene orders are cloned into pBarPc obtain plasmid pPcGFPo and utilize following primer：

ToxF (SEQ ID NO : 8)： CACCAGACCAGCCCCTCATGGAACATCACACTCG;Standing grain mouthful

ToxR (SEQ ID NO : 9)： GTCGACGGATCCCCCTTAGTTGATGATGGTGGTAT.

PUC57 plasmids using the carrying AalT coded sequences, signal coding sequence and mRNA 5'_ non-translational regions of foregoing structure is templates, PCR amplifications obtain amplified production, 5 a/restriction enzyme site that amplified production is cloned into pBarPc is obtained into plasmid pMc l lprAalT using In-Fusion Dry-down PCR kits, the structure of the plasmid is shown in Fig. 2A.The fungi of embodiment 2（Green muscardine fungus）Conversion and expression checking

Expression vector pPcGFP and the pMcl lprAalT of foregoing structure are after Sr^ digestions, linearisation using the method for fungal protoplasts (referring to Wang, C. A col lagenous protect i ve coat enable s Me tarhizium anisopliae to evade insect immune response s. Proc Na tl Acad Sci USA. 103 of S. standing grain Jie St Leger, R. J. 2006.：6647-6652) carry out Metarhizium anisopliae strains A RSEF 549 and (be purchased from entomogenous fungi DSMZ of United States Department of Agriculture http：// arsef fpsnl. Cornel l. edu/mycology/ARSEF-Culture-Col lect ion, html ^Catalog) Conversion, screening obtains the transformant GFP-549 and AaIT-549 of inheritance stability.

1. tested using green muscardine fungus GFP-549 transformants induced expression

In potato agar (PDA, D ifco companies）On culture medium, GFP-549 spores are inoculated with, after 25 times are cultivated 20 days, conidium is collected, Sa Shi dextrose broths is inoculated in respectively（SDB, Difco company）, minimal medium（10 g/l of glucose, NaN0₃6 g/l, 0.52 g/l of KC1, MgS0₄.7H₂0 0.52 g/l, KH₂P0₄0.25 g/l）And in vitro insect blood（The instar larvae of maduca sexta 5 is isolated from, 65 heat 5 minutes, are centrifuged 5 minutes under 13000rpm, take supernatant to obtain）Culture 72 hours.

As a result find, green fluorescent protein GFP signal is just expressed only when GFP-549 transformants are cultivated in insect hemolymph.The present inventor also infects the instar larvae of maduca sexta 5 with GFP-549 spore suspensions, thalline is separated and collected after 3 days, in detecting green florescent signal under fluorescence microscope.

The result infected with GFP-549 spore suspensions after the instar larvae of maduca sexta 5 is shown in Fig. 3 A, and green fluorescent protein GFP signal is just expressed only when fungal infection to insect haemocoele.Fig. 3 B are Fig. 3 A optical microscope picture.

2. the growth and expression of green muscardine fungus AaIT-549 transformants

a. RT-PCR

Transformant AaIT-549 is inoculated in saprophytic culture medium Sa Shi dextrose broths respectively（SDB, purchased from Di fco companies）And insect hemolymph（Hemolymph, is isolated from the instar larvae of maduca sexta 5, and 65 °C are heated 5 minutes, are centrifuged 5 minutes under 13000rpm, are taken supernatant to obtain）In, cultivated at 25 temperature, 180rpm rotating speeds.Wherein WT compares for the wild type Metarhizium anisopliae strains A RSEF 549 of synchronization process.

After culture 24 hours, mycelia is collected using Buchner funnel, the filter paper filtration methods of Whatman NO 1 respectively, 0. 1 grams are taken, with RNeasy mini kit (Qiagen companies）Kit extracted total RNA, then takes 1 microgram total serum IgE, uses oligo-dT primer kits（Purchased from ABgene companies）Prepare single-stranded cDNA.

With ToxU (GCGTGAACTTTCTTCGGTTC (SEQ ID NO:10)) standing grain mouthful ToxL (TAGCCCTTATC GGCGTAGTG (SEQ ID NO:11)) it is primer, the cDNA that method described above is obtained is the conventional RT-PCR of template progress.Amplified production is separated, electrophoresis detection is carried out.

As a result see Fig. 3 C, show that toxin gene is not expressed when transformant AaIT-549 grows in saprophytic culture medium Sa Shi dextrose broths, only in insect hemolymph（Including in vitro）Just expressed during growth.

B. time series RT-PCR

By Metarhizium anisopliae bacterial strain wild-type strain ARSEF 549 and toxin gene transformant AaIT-549 spore inoculatings in Sa Shi dextrose broths（SDB, Difco company）, 25 temperature are cultivated 36 hours under 180rpm rotating speeds, and mycelia is collected by filtration in such as above-mentioned method, then is transferred in insect hemolymph（Preparation method is with described in a）Cultivate different time（As shown in the figure）, mycelia is in kind collected, total Should is extracted and carries out single-stranded cDNA being prepared and used as pcr template.

As a result Fig. 3 D are seen, time series RT-PCR analysis shows can be expressed quickly when fungi grows in insect hemolymph.C Western cross experiments

Transformant AaIT-549 is inoculated in saprophytic culture medium Sa Shi dextrose broths, minimal medium respectively（10 g/l of glucose, NaN0₃6 g/l, 0.52 g/l of KC1, MgS0₄.7H₂0 0.52 g/l, KH₂P0₄0.25 g/l）And in vitro insect blood（Prepare with described in a）In, culture 72 hours is carried out using same method as described in a, 5000rpm is centrifuged 5 minutes, collects supernatant. Maduca sexta larva is infected with transformant AaIT-549（ fe/K«_C<3Sexta), collect under just dead larval haemolymph, 13000rpm and centrifuge 5 minutes, take supernatant.

Homogenate is made in above-mentioned different supernatant samples with SDS sample-loading buffers, through 16.5%Tns-Tncme SDS-PAGE glue (Bio-Rad companies）After separation, with anti-north African scorpion venom humoral antibody（Purchased from MicroPharm companies, Britain）Hybridized, dye after by ECL exposure images.Positive control is used as using 18S ribosome rRNA genes.

As a result as shown in FIGURE 3 E, show：Transformant AaIT-549 can express AalT polypeptides in insect blood cultured in vitro（Swimming lane 3)；AalT polypeptides can be expressed in vivo after the just dead maduca sexta larva of AaIT-549 transformants infection（Swimming lane 4-8)；When AaIT-549 transformants grow in minimal medium or Sa Shi glucose culture solutions, toxin polypeptide will not be expressed（Swimming lane 1,2).

3. insect test injection

Transformant AaIT-549 is placed in isolated growth in insect hemolymph, after 72 hours, 5000rpm is centrifuged 5 minutes, collecting supernatant is used to inject calliphorid（^rcopMga m/toto) and maduca sexta larva, injection volume is respectively 20 and 100 microlitres, observes the change of two kinds of insects.Control is used as using isolated cultures of the wild type Metarhizium anisopliae strains A RSEF 549 in insect hemolymph.

As a result see Fig. 3 F and Fig. 3 G, it is seen that transformant AaIT-549 culture supernatant can cause on typical polypide Shou Shrink phenomenons, wherein Fig. 3 F and Fig. 3 G it is left be situation after calliphorid and the injection of maduca sexta larva respectively；Under Fig. 3 F or Fig. 3 G it is right be that the culture supernatant of wild-type strain 549 is injected to the situation after calliphorid and maduca sexta larva respectively.The preparation of the pesticidal preparations of embodiment 3

In potato agar（PDA, purchased from Difco companies）On culture medium, AaIT-549 spores are inoculated with, after 25 times cultures 20 days, conidium are collected, with 0.05% Tween-20 (Sigma companies）Prepare each bacterial strain spore suspension.

Described pesticidal preparations formula such as table 1:

It is prepared by the AaIT-549 spore suspensions of table 1 The AalT toxin gene transformants of embodiment 4（Green muscardine fungus）Insect biologicall test

In order to compare wild-type strain ARSEF 549 and differences of the AalT toxin gene transformants AaIT-549 on insecticidal toxicity, each bacterial strain spore suspension is prepared with 0.05% Tween-20, gradient spore concentration is respectively from 2xl0⁷ - lxlO⁵Conidium/milliliter.Just cast off a skin 5 age maduca sexta larvas and Aedes aegypti (Ae les aegypt female insects are selected respectively for examination insect（3 days after emergence）Carry out biologicall test, method is referring to Wang, C. A collagenous protective coat enables Metarhizium anisopliae to evade insect immune responses. Proc Natl Acad Sci USA. 103 of S. standing grain Jie St Leger, R. J. 2006.: 6647-6652.

As a result show, for maduca sexta and Aedes aegypti, the bacterial strain spore concentration needed for AaIT-549 causes 50% death rate than wild type ARSEF 549 reduces by 22 times and 9 times respectively；For maduca sexta and Aedes aegypti, apply AaIT-549 than wild type ARSEF 549 50% time-to-live Fen Bie the short about 30% and 40% (tables 2 of Shrink;Fig. 4).By determining frass dry weight, maduca sexta food ingestion when toxin conversion bacterial strain AaIT-549 infects than wild type declines about 50% (Fig. 5). The ARSEF 549 (WT) and AaIT-549 of table 2 compares the virulence of maduca sexta and Aedes aegypti

* the use of the spore concentration of detection is 2 X 10⁷Conidium/milliliter；The use of the spore concentration of detection is 1 X 10⁵Conidium/milliliter；Numerical value is 95% confidential interval in bracket； LD₅., the lethal dose of 50； ST₅., 50% survival rate.The promoter variants of embodiment 5

Using conventional method for synthesizing gene synthesis SEQ ID NO:The variant form I of the promoter of sequence shown in 3, the variant form is by SEQ ID NO:G → the C of the 63rd of 3 sequences;

Using conventional method for synthesizing gene synthesis SEQ ID NO:The variant form II of the promoter of sequence shown in 3, the variant form is by SEQ ID NO:The 5' ends of 3 sequences are plus 2 nucleotides GT.

Using method similar to Example 2, the expression in insect haemocoele instructed by the promoter of variant form is detected, is as a result found, GFP signal is just expressed only when transformant is cultivated in insect hemolymph.Therefore illustrate, the promoter of above-mentioned variant form is expressed in which can also instruct gene specific in insect haemocoele.The fungi of embodiment 6（Muscardine）Conversion and expression

In the present embodiment, AalT is converted into white boundary bacterium.The starting strain of transgenosis is beauveria bassiana（Beauveria bassiana) Bb202, Bbl3, save microbial control key lab obtained from Agricultural University Of Anhui.Bb202 RCEF numberings are RCEF0383, host's name Monochamus alternatus（ fo/2oc affl"s alternatus Hope)；Bbl3 RCEF numberings are RCEF0013, host name dendrolimus punctatus (e/jcroJifflws puncta tus Walker).

1. the structure of the pGPETl plasmids of the gene containing AalT

Use bow I things T1U: CGGGATCCTGTTCATGGAACATCACACTCGC(SEQ ID NO:12) standing grain mouthful TIL:

CGGGATCCTTAGTTGATGATGGTGGTATCGC (SEQ ID NO:13) (underscore is restriction enzyme site）, with plasmid pMcllprAalT (Wang and St. Leger (2007)； A scorpion neurotoxin increases the potency of a fungal insecticide. Nature Biotechnology, 25 (12) :1455-1456) expanded for template, purified product is inserted into the pBarGPEl carriers in same site after BamHI digestions（Fig. 2 B) in, obtain being used for beauveria bassiana conversion after pGPETl plasmid Scs/ linearization for enzyme restriction.So toxin gene carries out constitutive expression under constitutive promoter and irp the terminators control of aspergillus nidulans.

2. convert beauveria bassiana Bbl3

(1) preparation and conversion of blastopore

Preparation method Primary Reference Sheng-Hua Ying etc., Novel blastospore- based transformation system for integration of phosphinothr icin resistance and green fluorescence protein genes into Beauveria bassiana. Appl Microbiol Biotechnol, 2006,72: 206〜210.Main method：1. Bbl3 is inoculated into 10- 50ml SDB (Becton Dickinson), 120rmp, 25 °C cultivate 2 days；2. the above-mentioned bacterium solutions of 5ml are taken into 50ml GM, 120rmp, 25 °C cultivate 1 day;3. the bacterium solution of gained is filtered, filtrate 6000rpm, 4 °C of centrifugation 5min;4. dd 0 is washed 2 times by centrifugation；5. re-suspension liquid goes to EP pipes, 6000rpm, 4 °C of centrifugation 5min;6. precipitate be resuspended to again 0.5ml, In 0. lM LiAc；Tooth life spore is obtained, such as needs preservation often to manage plus the sterile glycerols of 100 μ 1, mixes.

By the 50%PEG4000 of 240 μ 1, the salmon sperm DNA of 36 11 Μ LiAc, 25 μ 1 4g/l denaturation, the pGPETl shape material grains of 10 μ 1（0.1 μ g/ μ 1), 35 11 Μ Dithiothreitol are fully mixed；30min is stood on ice;42 °C of heat shock 20min;4720 g, 4 °C of centrifugation 5min;Precipitation is resuspended to 0.5mlddH₂0;100 μ 1 are taken to apply the resistant panel of basal medium.

Picking converts bacterial strain, extracts after genomic DNA and sequence verification, the correct conversion AalT such as acquisition Bbl3T-4, Bbl3T_10 bacterial strain.

(2) protoplasm body conversion Bb202

The preparation of protoplast and conversion Primary Reference Wang CS, St. Leger RJ. A collagenous protective coat enables Metarhizium anisopliae to evade insect immune responses. Proc Natl Acad Sci, 2006,103:6647 6652, main method is as follows:(1) Bb202 is inoculated into L- borth and shakes bacterium（25°C 180rpm) 18- 24h;(2) bacterial culture fluid goes to 50ml centrifuge tubes, and 12000rpm centrifugation 5min remove supernatant, washing is once；（3) 0.01 Μ beta -mercaptoethanols are handled, 30 °C, 20min, are washed 3 times；（4) go after supernatant plus about 2 times of volumes lysis buffer, 37 °C, 120rpm gently shakes；（5) after 1.5h with 5ml syringes and glass silk flosssilk wadding filtering protoplast, after with STC rinse glass silk flosssilk wadding, filtrate 3000g, 5min;(6) after STC is washed twice, then it is resuspended to 2 X 10 with STC⁷Individual/ml；(7) take 100 μ 1 STC protoplast, plus the μ g of 5- 10 pGPETl linear plasmids, 25w g salmon sperm DNA, place 30min on ice;(8) add 25 μ 1 60% PEG, lOmin is placed on ice;(9) 500 μ 160% of power mouthful PEG4000,25.C、 lOmin;(10) 5ml RB culture mediums are gone to（Glucose 10g, NaN0₃6g, KC1 0.52g, MgS0₄.7H₂0 0.52g, KH₂P0₄0.25g, 1.2M D-sorbite, pH6.5, plus leavened water is steamed to 1000ml) be diluted, return again to 42 °C of 50ml RA culture mediums（Glucose 10g, NaN0₃6g, KC10.52g, MgS0₄.7H₂00.52g, KH₂P0₄0.25g, 1.2M D-sorbite, pH6.5,1.2% low melting-point agarose, plus leavened water is steamed to 1000ml), mix；（11) finally 10ml is taken to be inoculated into culture dish, 27 °C of culture 12-15h;(12) after 12-15h, 10ml 0.7% agar is taken（Amp containing 200 g/ml ga and 100 μ g/ml) covering is thereon；（13) after 2-3 days, the resistant panel that single bacterium falls on basal medium is chosen.

Picking converts bacterial strain, extracts after genomic DNA and sequence verification, obtains the correct conversion AalT such as Bb202T-7 bacterial strain.Gene level and protein level（Western blot）Checking show, obtain the transformant of multiple stable conversions and expression.

3. the squamous subculture of fungi transformants

After the transformant of picking is verified through PCR, it is the genetic stability of further proof transformant, transformant carries out single spore separation after being verified to PCR, then the generation of squamous subculture 5, further enters performing PCR checking after 5 generations to it.As a result its genetic stability is still kept after finding the subcultures such as transformant Bb202T-7, Bbl3T-4 and Bbl3T-10.

4. the preliminary toxicity test of fungi transformants

Pick out at random 10 Bbl3 positive transformants, after culture 2 days, take zymotic fluid to inject after 5 age silkworms, as can be seen from Figure 6 silkworm polypide has before obvious Shou Shrink reacting phenomenons, relative injection, nearly 1/3rd polypide length of some silkworm Shou Shrink.Comparatively speaking, two plants of transformant Bbl3T-4 and Bbl3T-10 virulence are relatively more preferable.The AalT toxin gene transformants of embodiment 7（Muscardine）Insect biologicall test

In the present embodiment, 5 plants of bacterial strains used in biologicall test include：Wild-type strain Bbl3 and Bb202;Fungi transformants

Bbl3T-4-l (Bbl3T-4 first single spore separation strains）, Bbl3T-10-3 (Bbl3T-10 the 3rd single spore separation strains）And Bb202T-7 On the spore suspension coating PDA plate of 5 plants of strains testeds 8d will be cultivated in the insulating box of 25 scholar 1, conidia powder is scraped after it fully produces spore, go in appropriate 0. 01% Tween-20, by the abundant vibrating dispersion of conidia powder, be configured to final concentration of 2 X 10⁵、 1 X 10⁶、 5 X 10⁶、 2. 5 X 10⁷、 1. 25 X 10\ 1 X 10⁷Spore/ml spore suspension.

It is Monochamus alternatus, dendrolimus punctatus and greater wax moth for examination insect（fe eris mellonella).

Each concentration of every plant of bacterial strain handles 10 cephalonts, is repeated 3 times.Blank control is made with 0. 01% Tween-20 solution processing insect.It is inoculated with using infusion process, each processing test worm is put in the spore suspension of each concentration in advance, soaks and is inoculated with suspension for 20 30 seconds, 0. 01% Tween-20 solution is contaminated in control.Test worm after processing, which is put in, to be attached to suitable and has been placed with the larvarium ware that fresh word supports thing, and vessel are put with being cultivated in 25 scholar, 1 °C of insulating box again.After processing in 48h humid control more than 90%.Frass is cleared up every 12h and change fresh blade or word material later.Start within 2nd day, regularly observe, record the death condition of each processing daily；And remove dead worm on the slide being put in the culture dish for filling wet water absorbent paper, 25 or so moisturizing cultures, the equal microscopy numeration of insect of falling ill, continuous observation 15 days.

Data calculate the death rate of larva, infection rate after inoculation spore suspension according to the observation, and are corrected with Abbott formula, i.e.,：Handle the death rate-control death rate

Corrected mortality=X 100

1- compares the death rate

Toxicity regression is sought with machine value analytic approach, median lethal time is calculated（LT₅.）.Handled, analyzed using SSPS (13. 0) software.

1. the biologicall test of median lethal time

Using Monochamus alternatus as Bb202 virulence life test worm, from figure 7 it can be seen that the survival rate of the insect after being handled with transgenic strain Bb202T-7 will significantly be less than wild-type strain Bb202.And as known from Table 3, in wild-type strain Bb202 semilethal the time be 4. 5 ± 0. 3 days, Bb202T-7 for 4 ± 0. 4 days.LT of the wild-type strain than transgenic strain₅.The insecticide efficiency of fungi after length 0. 5 days, namely conversion AalT improves 11. 11%.Also, after Monochamus alternatus infects through transgenic strain, production spore is still fine.

The median lethal time of the Monochamus alternatus of table 3（LT₅.）Bacterial strain LT₅.（H) the standard deviation lower limit upper limit

Bb202 4. 5 0. 3333333 3. 84666667 5. 153333333

Bb202T-7 4 0. 4,531,913 3. 11,174,504 4. 888254964 has carried out virulence bioassay with greater wax moth to Bbl3 (WT) and transgenic strain, as can be seen from Table 4, transgenic strain significantly reduces the survival rate of greater wax moth, and especially bacterial strain Bbl3T-10-3 is most notable.The time reduces 0. 8-1. 3 days in the semilethal of transgenic strain versus wild type bacterial strain, and insecticide efficiency improves 17. 6-29. 4%.It can be seen that the virulence and insecticide efficiency versus wild type bacterial strain of transgenic strain are improved a lot.Bacterial strain Bbl3T-4-l with neurotoxin gene is infected after greater wax moth, can significantly observe that greater wax moth has polypide Shou Shrink phenomenons.

The median lethal time of the greater wax moth of table 4（LT₅.）Bacterial strain LT₅.（H) the standard deviation lower limit upper limit

WT 4. 25 0. 102 4. 051 4. 449

Bbl3T- 4- 1 3. 5 0. 087 3. 33 3. 67

Bbl3T-10-3 3 0. 091 2. 822

Equally, the virulence of wild-type strain will be also significantly larger than to the virulence of dendrolimus punctatus by turning virulence gene bacterial strain.The analytical table of table 5

Claims

Bright, the time is 4. 5 days in the median lethal of transgenic strain, and 40 % have been respectively increased in its insecticide efficiency versus wild type bacterial strain, it is seen that transgenic strain extremely significantly improves the insecticide efficiency of beauveria bassiana.In addition, in the polypide and bombys batryticatus that transgenic strain infects, it was observed that the pine moth after substantial amounts of versus wild type bacterial strain infects has polypide Shou Shrink phenomenons.

The median lethal time of the dendrolimus punctatus of table 5（LT₅。)

95% puts " interval

Bacterial strain LT₅.（H) the standard deviation lower limit upper limit

WT 7. 5 0. 209 7. 09 7. 91

Bbl3T- 4- 1 5 0. 169 4. 668 5. 332

Bbl3T-10-3 4 0. 164 3. 679 4. 321

2. the biologicall test of the lethal concentration of 50

With the toxicity test of the wild-type strain Bbl3 of 5 gradient concentrations, transgenic strain Bbl3T-10-3 to dendrolimus punctatus, as a result show that the virulence of transgenic strain greatly improves virulence and reduces spore consumption, be shown in Table 6.It was found from statistical result, the lethal concentration of 50 of wild-type strain（LC₅.）For 1. 06 X 10⁶Spore/ml, the LC of the transgenic strain for turning AalT genes₅.For 7. 03 X 10⁴Spore/ml.Therefore, transgenic strain versus wild type bacterial strain reduces 15 times of spore consumption, and the cost of biological control thus greatly reduces.

The lethal concentration of 50 of the dendrolimus punctatus of table 6（LC₅。)

Bacterial strain slope (slope) LC₅.（Spore/ml) 95% confidence ' interval

Bbl3 0. 92 1. 06 X 10⁶ 5. 79 X 10⁵- 1. , 77 X 10⁶

Bbl3T- 10- 3 0. 63 7. 03 X 10⁴ 3. 99 X 10³- 1. , 94 X 10⁵Difference life, which tests worm and infects result, sees Fig. 8.（A) 5 age silkworms inject 50 μ bacterium solutions after reaction, the above is injected through Bbl3T_4, below wild type Bbl3 injection result.（B) it is the bombys batryticatus after dendrolimus punctatus is infected by bacterial strain Bbl3T-4-l, the bombys batryticatus after being infected below for wild-type strain above.（C) left side is the bombys batryticatus after 5 age Monochamus alternatus are infected by Bb202T-7, and right side is Monochamus alternatus when not infected.（D) on the left of is the bombys batryticatus that greater wax moth is infected by Bbl3T-4-l, and right side is the bombys batryticatus after being infected by wild type Bbl 3.All documents referred in the present invention are all incorporated as reference in this application, are individually recited just as each document as with reference to such.In addition, it is to be understood that after the above-mentioned instruction content of the present invention has been read, those skilled in the art can make various changes or modifications to the present invention, and these equivalent form of values equally fall within the application appended claims limited range.

Claim

1. a kind of coding north African scorpion neurotoxin polypeptide A alT polynucleotides, it is characterised in that the sequence of described polynucleotides is selected from the group：

(a) there is SEQ ID N0:Nucleotide sequence in 1 shown in 163-375；

(b) there is SEQ ID N0:Nucleotide sequence in 1 shown in 106-375；

(c) there is SEQ ID N0:Nucleotide sequence in 1 shown in 1-375；

(d) with SEQ ID NO:163-375 have at least 75% phase same sex, and coding SEQ ID NO in 1:The nucleotide sequence of amino acid sequence shown in 20-89 in 2, and described polynucleotide sequence can express in fungi；Or

(e) under strict conditions can be with（A) polynucleotides limited hybridize, and described polynucleotide sequence can be expressed in fungi.

2. the purposes of the polynucleotides described in claim 1, it is characterised in that the preparation for preparing preventing and treating insect.

3. a kind of insect haemocoele specific expression promoter, it is characterised in that described promoter is selected from the group：

(1) there is SEQ ID NO:The polynucleotides of nucleotide sequence shown in 3；

(2) under strict conditions can be with（1) polynucleotide sequence limited hybridizes and with the polynucleotides for instructing target gene specific expressed function in insect haemocoele；Or

(3) with SEQ ID NO:Nucleotide sequence shown in 3 has more than 80% homology and with the polynucleotides for instructing target gene specific expressed function in insect haemocoele.

4. the purposes of the promoter described in claim 3, it is characterised in that described promoter is used to instruct target gene specific expressed in insect haemocoele.

5. a kind of construction, it is characterised in that described construction contains elements below successively from 5 ' to 3 '：

Promoter described in claim 3；With

Target gene.

6. construction as claimed in claim 5, it is characterised in that between promoter and target gene, is also included：Ribosomes translates recognition component, and/or signal peptide encoder element.

7. the construction as described in claim 5 or 6, it is characterised in that

Described target gene is the encoder element of insect toxins polypeptide；

Described ribosomes translation recognition component has SEQ ID NO:The nucleotide sequence of 9-105 in 1；

Described signal peptide has SEQ ID NO:Amino acid sequence in 2 shown in 1-19.

8. construction as claimed in claim 7, it is characterised in that the encoder element of described insect toxins polypeptide is north African scorpion neurotoxin polypeptide A alT encoder element.

9. construction as claimed in claim 8, it is characterised in that described north African scorpion neurotoxin polypeptide A alT encoder element is selected from the group：

(a) there is SEQ ID NO:Nucleotide sequence in 1 shown in 163-375；

(b) there is SEQ ID N0:Nucleotide sequence in 1 shown in 106-375； (c) there is SEQ ID N0:Nucleotide sequence in 1 shown in 1-375；

(d) with SEQ ID NO:163-375 have at least 75% phase same sex, and coding SEQ ID NO in 1:The nucleotide sequence of amino acid sequence shown in 20-89 in 2, and described polynucleotide sequence can express in fungi；Or

(e) under strict conditions can be with（A) polynucleotides limited hybridize, and described polynucleotide sequence can be expressed in fungi.

10. a kind of carrier, it is characterised in that described carrier contains the construction described in polynucleotides or claim 5 described in claim 1.

11. a kind of cell, it is characterised in that described cell：

Contain the carrier described in claim 10；Or

The construction described in polynucleotides or the claim 5 described in the claim 1 of external source is integrated with its genome.

12. cell as claimed in claim 11, it is characterised in that described cell is recombinant fungus cell.

13. a kind of spore, it is characterised in that described spore is produced as the fungal cell described in claim 12.

14. a kind of preparation for preventing and treating insect, it is characterised in that described preparation contains（A) spore described in the cell and/or claim 13 described in claim 12；And（B) acceptable carrier in Pesticide Science.

15. a kind of method for preventing and treating insect, it is characterised in that methods described includes：The object for needing to prevent and treat insect or place are given using the spore described in claim 13.

16. a kind of carrier, it is characterised in that described carrier contains the insect haemocoele specific expression promoter described in claim 3, is used as promoter element.