CN106636118A - Scorpion neurotoxin AaIT and encoding gene and application thereof - Google Patents
Scorpion neurotoxin AaIT and encoding gene and application thereof Download PDFInfo
- Publication number
- CN106636118A CN106636118A CN201611180128.6A CN201611180128A CN106636118A CN 106636118 A CN106636118 A CN 106636118A CN 201611180128 A CN201611180128 A CN 201611180128A CN 106636118 A CN106636118 A CN 106636118A
- Authority
- CN
- China
- Prior art keywords
- aait
- albumen
- sequence
- protein
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43513—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae
- C07K14/43522—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae from scorpions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/14011—Baculoviridae
- C12N2710/14021—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/14011—Baculoviridae
- C12N2710/14111—Nucleopolyhedrovirus, e.g. autographa californica nucleopolyhedrovirus
- C12N2710/14121—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Insects & Arthropods (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Pest Control & Pesticides (AREA)
- Cell Biology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a scorpion neurotoxin AaIT and an encoding gene and application thereof. The gene provided by the invention is any DNA molecule in (1) to (3): (1) the DNA molecule shown in sequence 1 in a sequence table, (2) the DNA molecule which is hybridized with a DNA sequence limited in (1) in a strict condition and is used for encoding protein with insect killing activity, and (3) the DNA molecule which at least has homology of 90%, 95%, 96%, 97%, 98% or 99% with the DNA sequence limited in (1) and is capable of encoding the protein with insect killing activity. The DNA sequence of the AaIT is optimized, and a method capable of efficiently expressing and purifying recombinant protein of the AaIT is provided; and the scorpion neurotoxin AaIT and the encoding gene thereof have an important value in the field of insect resistance, especially in cultivation of anti-insect plant varieties and have great significance in the improvement of the yield of crops.
Description
Technical field
The present invention relates to the use of biological technical field, and in particular to a kind of scorpion neurotoxin AaIT and its encoding gene with should
With.
Background technology
Insect specific neurotoxin is that a class acts only on insect nerve system, there is the polypeptide neurotoxin of toxic action, main
Come from scorpion, secondly from Aranea.The action site of this kind of toxin for having single-minded toxic action to insecticide is that various ions lead to
Road, with the narrow spectrum neurotoxin of efficient insecticide the long-chain neurotoxin of sodium-ion channel, this kind of long-chain are mainly acted on
Neurotoxin is typically made up of 60-70 aminoacid, has 2-4 to intrachain disulfide bond.The neurotoxin in different genera source is in ammonia
Without obvious conservative on the composition of base acid, and Derived Nerve toxin of the same race has very high conservative on primary structure.
AaIT be by Tal Arnon be separated to from the venom of Scorpio Androctonus australis it is a kind of to insecticide have height
Degree selectively acts on the α-type insect specific neurotoxin of sodium-ion channel, and the ripe neurotoxin is by 64 amino acid residue groups
Into to agricultural pests with very strong toxic action, half paralysis dosage (PD of the natural toxin to locust50) it is 50ng/g bodies
Weight, therefore the toxin has important pest-resistant value.
By insect specific neurotoxin construction of expression vector in prior art, being then transformed into E.coli BL21 (DE3) carries out table
Reach, but obtain is all inactive inclusion body, by being dissolved under the conditions of suitable in vitro, degeneration, renaturation and purification,
It is only capable of obtaining micro soluble protein from every liter of culture medium, volume of production is low；The expression vector that will be built be there is also in yeast
The method of middle expression, but its expression is low and isolates and purifies difficulty.At present, it is also not over the DNA sequence for transforming AaIT and excellent
Change AaIT expression and purifications method efficiently to produce the mode of AaIT recombiant proteins, significantly impact applications of the AaIT in pest-resistant,
Therefore need to develop it is a kind of can with reduces cost, realize a large amount of productions and the side of insect specific neurotoxin AaIT with biological activity
Method.
The content of the invention
For defect of the prior art, present invention aim at providing a kind of scorpion neurotoxin AaIT and its coding base
Cause.
The present invention provides gene, is the gene for encoding scorpion neurotoxin AaIT albuminoids, is arbitrary one in following (1)-(3)
The DNA molecular planted：
(1) DNA molecular by shown in sequence in sequence table 1；
(2) albumen of DNA sequence hybridization and coding with poisoning insect active for limiting with (1) under strict conditions
DNA molecular；
(3) DNA sequence limited with (1) at least has 90%, at least has 95%, at least have 96%, at least have
97%th, at least have 98% or at least there is 99% homology and the DNA molecular of the albumen with poisoning insect active is encoded.
Stringent condition can be as follows：50 DEG C, in 7% sodium lauryl sulphate (SDS), 0.5M NaPO4With 1mM EDTA's
Hybridize in mixed solution, at 50 DEG C, 2 × SSC is rinsed in 0.1%SDS；Can also be：50 DEG C, in 7%SDS, 0.5M NaPO4With
Hybridize in the mixed solution of 1mM EDTA, at 50 DEG C, 1 × SSC is rinsed in 0.1%SDS；Can also be：50 DEG C, 7%SDS,
0.5M NaPO4Hybridize with the mixed solution of 1mM EDTA, at 50 DEG C, 0.5 × SSC is rinsed in 0.1%SDS；Can also be：50
DEG C, in 7%SDS, 0.5M NaPO4Hybridize with the mixed solution of 1mM EDTA, at 50 DEG C, 0.1 × SSC floats in 0.1%SDS
Wash；Can also be：50 DEG C, in 7%SDS, 0.5M NaPO4Hybridize with the mixed solution of 1mM EDTA, at 65 DEG C, 0.1 × SSC,
Rinse in 0.1%SDS；Alternatively：In 6 × SSC, the solution of 0.5%SDS, hybridize at 65 DEG C, then with 2 × SSC,
0.1%SDS and 1 × SSC, 0.1%SDS respectively wash film once.
Wherein, the sequence 1 in sequence table is made up of 210 Deoxydization nucleotides, and this sequence is the total length of ripe AaIT albumen
The reading frame of cDNA, protein of the coding with the amino acid residue sequence of sequence 2 in sequence table.
The albumen obtained by the coding of sequence 1 in above-mentioned sequence table belongs to protection scope of the present invention.
The present invention provides albumen, is following (1) or (2)：
(1) protein that the aminoacid sequence shown in sequence in sequence table 2 is constituted；
(2) by the aminoacid sequence shown in sequence in sequence table 2 through the replacement of one or several amino acid residues and/or
Lack and/or add and with the protein by derived from sequence 2 of poisoning insect active.
Wherein, the sequence 2 in sequence table is made up of 70 amino acid residues, and the reading frame of its encoding gene includes 210
Nucleotide.
The replacement of one or several amino acid residues and/or disappearance and/or addition refer to not more than ten amino acid residues
Replacement and/or disappearance and/or add.
Recombinant vector containing said gene, expression cassette, transgenic cell line or recombinant bacterium fall within the protection of the present invention
Scope.
Recombinant vector is specially and said gene is inserted in expression vector, obtains expressing the recombinant vector of above-mentioned albumen.Weight
Group carrier is particularly preferred as said gene being inserted between the BamH I and Hind III digestions site of expression vector pET32, obtains
Express the recombinant vector of above-mentioned albumen.
The primer pair of amplification gene total length or its any fragment falls within protection scope of the present invention.
The nucleotides sequence of a primer in above-mentioned primer pair is classified as the sequence 3 in sequence table
(GCGGATCCAAGAAGAACGGTTACGCTG), the nucleotides sequence of another primer in primer pair is classified as the sequence in sequence table
Row 4 (GCAAGCTTTTAGTTGATGATAGTGGTGTC), the target gene expanded using the primer of sequence 3 and sequence 4 equally may be used
To carry out enzyme action and the attended operation of correlation.
Second object of the present invention is to provide a kind of method for preparing albumen, including step：By the recombinant expressed of gene
Vector introduction host cell, host cell is preferably escherichia coli, and the initial carrier for building recombinant expression carrier is preferably
PET32 carriers.
The step of also including purifying protein：The fusion protein that expression is obtained is cut with enterokinase, is then 6.0 in pH value
Dialyse under conditions of～6.2, the CM cation seperation columns of the material after dialysis are adsorbed, then rinsed and eluting with NaCl solution.
Protection scope of the present invention is fallen within according to the albumen after purification that the above-mentioned method for preparing albumen is prepared.
The method for optimizing for preparing albumen is specifically included：
S1：Optimized gene, structure prokaryotic expression carrier and conversion：The optimized ripe scorpion insect specific neurotoxin of synthetic
AaIT genes, and be connected in expression vector pET32, recombinant expression carrier pET32/AaIT is obtained, by recombinant vector pET32/
AaIT is transformed in escherichia coli TOP10 bacterial strains, then recombinant vector pET32/AaIT is extracted from TOP10；Will weight with heat shock method
Group carrier pET32/AaIT is transferred in host cell E. coli expression strain, is obtained with the LB plate screenings containing Amp resistances
To the E. coli expression strains transformant for including recombinant vector pET32/AaIT；
S2：The expression of soluble T rx-AaIT fusion protein and extraction：Recombinant vector will be included obtained by step S1
The E. coli expression strains transformant of pET32/AaIT is cultivated to OD in 37 DEG C of LB fluid mediums600For 0.5～0.6
When, the IPTG that concentration is 0.1～0.5mM is added, induce 6～10 hours in 16 DEG C～25 DEG C, then ultrasonication, in centrifuging and taking
Clear liquid, obtains the soluble fusion protein Trx-AaIT for recombinating；
S3：The purification of Trx-AaIT fusion protein：Purification is carried out to Trx-AaIT fusion protein using nickel affinity chromatographic column,
First with the rinsing affinity chromatographic column of the pH 8.0Tris-HCl solution containing 50mM～100mM imidazoles, then with containing 100mM～200mM
The pH 8.0Tris-HCl solution of imidazoles elutes fusion protein, you can obtain Trx-AaIT fusion of the purity more than 90%
Albumen；
S4：The cutting of Trx labels and the purification of restructuring AaIT albumen：Trx-AaIT fusion protein is cut with enterokinase,
Then dialyse under conditions of pH value is for 6.0～6.2, foreign protein rinsed with 20mM NaCl solutions Jing after the absorption of CM cation seperation columns,
100mM NaCl solution eluting is used again, and AaIT recombiant protein of the purity more than 95% is just obtained.
Above-mentioned albumen, said gene or above-mentioned recombinant vector, expression cassette, transgenic cell line or recombinant bacterium are in pest-resistant field
In application be also the scope of protection of the invention.
Third object of the present invention is to provide a kind of method of cultivation transgenic plant, is by the coding base of above-mentioned albumen
Because importing in purpose plant, transgenic plant is obtained, the insect resistace of transgenic plant is higher than purpose plant.
Above-mentioned transgenic plant is interpreted as not only comprising the first generation transgenic plant for obtaining gene transformation purpose plant,
Also its filial generation is included.For transgenic plant, the gene can be bred in the species, it is also possible to which traditional breeding method is by the base
Because in other kinds, particularly including commercial variety for transitioning into same species.By channel genes purpose plant, protein can be made
Synthesis in purpose plant, enters but the pest-resistant performance of purpose plant is improved.
The present invention also provides a kind of method of cultivation transgenic virus, is that the encoding gene of above-mentioned albumen is transferred to into purpose
In virus, transgenic virus are obtained, the insect resistace of transgenic virus is viral higher than purpose, the viral preferably baculoviruss of purpose,
One kind in nucleopolyhedrosises element and cytoplasmic polyhedrosis viruies.
The technical scheme that the present invention is provided has advantages below：One is to utilize pET32 carriers and E. coli expression strains,
Realize expression product to merge with solubilization factor Trx, obtain the Trx-AaIT fusion protein of a large amount of soluble forms；Two is at this
In bright expression system, Trx-AaIT fusion protein can be folded in any suitable manner, and keep native conformation；Three is to find out one
The effective purification reconstituted protein Trx-AaIT of bar, fly-cutting Trx and being further purified obtains the restructuring eggs of the AaIT without any label
It is white to obtain method；Four is that the biological activity of the AaIT albumen obtained by escherichia coli expression has obtained significant raising.
The additional aspect and advantage of the present invention will be set forth in part in the description, and partly will become from the following description
Obtain substantially, or recognized by the practice of the present invention.
Description of the drawings
Fig. 1 is the pET32/AaIT vector construction schematic diagrams in the embodiment of the present invention.
Fig. 2 is containing the mesh of pET28, pET30 and pET32 recombinant vector expression of AaIT before optimization in the embodiment of the present invention
The SDS-PAGE testing result figures of mark albumen.
Fig. 3 is pET28, the pET30 and pET32 recombinant vector expression containing AaIT after optimization in the embodiment of the present invention
The SDS-PAGE testing result figures of target protein.
Fig. 4 is that the escherichia coli expression comprising the pET32/AaIT carriers of gene after optimization in the embodiment of the present invention is obtained
Soluble T rx-AaIT fusion protein SDS-PAGE testing result figures.
Fig. 5 is the fusion protein of Trx-AaIT before purification in the embodiment of the present invention and delaying with the imidazoles including variable concentrations
Rush the SDS-PAGE testing result figures of the Trx-AaIT fusion protein that liquid C purification is obtained.
Fig. 6 is the albumen that the Trx-AaIT fusion protein in the embodiment of the present invention is obtained in different enzyme action time enzyme action
SDS-PAGE testing result figures.
Fig. 7 is the SDS-PAGE testing result figures of the rAaIT recombiant proteins in the embodiment of the present invention.
Fig. 8 is being injected for each 2 silkworms of the injection rAaIT recombiant proteins group in the embodiment of the present invention and PBS control group
The symptom characteristic figure showed after 10 minutes.
Specific embodiment
Below in conjunction with the accompanying drawing in the embodiment of the present invention, the technical scheme in the embodiment of the present invention is carried out clear, complete
Site preparation is described, it is clear that described embodiment is only a part of embodiment of the invention, rather than the embodiment of whole.It is based on
Embodiment in the present invention, it is every other that those of ordinary skill in the art are obtained under the premise of creative work is not made
Embodiment, belongs to the scope of protection of the invention.
Experimental technique used in following embodiments if no special instructions, is conventional method.
Material used, reagent etc. in following embodiments, if no special instructions, commercially obtain.
% in following embodiments, if no special instructions, is weight/mass percentage composition.Quantitative examination in following examples
Test, be respectively provided with three repetitions and test, data are the meansigma methodss or mean+SD of three repetition experiments.
The present invention is purchased from the U.S. from escherichia coli expression bacterium, vector amplification bacterial strain TOP10 and expression vector pET32
Invritrogen companies.
Primer particular sequence in the present invention is as shown in sequence 3 and sequence 4 in sequence table.
Used medium formula is as follows：
1) LB fluid mediums：NaCl 10g, peptone 10g, yeast extract 5g, distilled water 1L, autoclaving, room temperature
Preserve；
2) LB/Amp flat boards：NaCl 10g, peptone 10g, yeast extract 5g, distilled water 1L, agar powder 15g, high pressure
After sterilizing, less than 70 DEG C are cooled to, the ampicillin (Ampicillin) for adding 1mL concentration to be 100mg/ml is fully mixed
A kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices afterwards, 4 DEG C keep in dark place；
3) LB/Amp culture medium：NaCl 10g, peptone 10g, yeast extract 5g, distilled water 1L are cold after autoclaving
But to less than 70 DEG C, 1mL Ampicillin (100mg/ml) are added, is fully mixed, 4 DEG C of preservations；LB fluid mediums：NaCl
10g, peptone 10g, yeast extract 5g, distilled water 1L, autoclaving, room temperature preservation.
4) 50 × TAE agarose gel electrophoresiies buffer：Tris alkali 121g, glacial acetic acid 28.6mL, 0.5mol/L EDTA
(pH 8.0) 50mL, plus distilled water is settled to 500mL, room temperature preservation；
5) 50mg/mL ampicillin preserves liquid：Ampicillin 0.5g, plus distill water dissolution and be settled to 10mL, point
Dress is after -20 DEG C of preservations；
6) 5 × SDS-PAGE sample-loading buffers：1M Tris-HCl (pH 6.8) 1.25mL, SDS 0.5g, BPB 25mg,
Glycerol 2.5mL, plus 5mL is settled to after deionized water dissolving, subpackage (about 500 per part of μ L) is added after room temperature preservation using per part
Enter the mixing of 25 μ L beta -mercaptoethanols；
7) 5 × SDS-PAGE electrophoretic buffers：Tris 15.1g, glycine 94g, SDS 5.0g, add about 800mL go from
Sub- water, is sufficiently stirred for being settled to 1L, room temperature preservation after dissolving；
8) coomassie brilliant blue R_250 dyeing liquor：Coomassie brilliant blue R_250 0.25g, adds 225mL methanol, the ice of 46mL
Acetic acid, 225mL deionized waters simultaneously stir, and filter paper is removed after particulate matter, room temperature preservation；
9) Coomassie brilliant blue destaining solution：Glacial acetic acid 50mL, methanol 150mL, deionized water 300mL, after being sufficiently mixed, room temperature
Preserve.
Embodiment one
Present embodiments provide a kind of AaIT genes of the synthetic of optimization, the sequence 1 in particular sequence such as sequence table
Shown, the protein sequence corresponding to the gene is as shown in the sequence 2 in sequence table.Sequence before the optimization of the present embodiment is root
It is the n DNA for synthesizing AaIT neurotoxins according to the DNA sequence that ncbi database is provided, according to the characteristics of escherichia coli expression,
DNA after optimization and synthesis optimizing.Native polynucleotide (the GenBank accession number of DNA sequence and AaIT after optimization
M27706) compare almost without homology.
Gene before and after above-mentioned optimization is connected in coli expression carrier pET28, pET30 and pET32 and is obtained
Recombinant vector, the recombinant vector of the above Jing sequence verification heat-shock transformed competent cell to E. coli expression strains respectively,
Corresponding resistance LB flat board is coated with, is cultivated 12 hours in 37 DEG C of constant incubators, screen transformant, wherein pET32/AaIT carriers
Build as shown in figure 1, Fig. 1 is the pET32/AaIT vector construction schematic diagrams in the embodiment of the present invention.
Carried for expression using pET28, the pET30 and pET32 recombinant vector containing not optimized natural A aIT gene order
Body, the IPTG of its corresponding expression bacterium transformant Jing 0.5mM is induced at 16 DEG C, 25 DEG C and 37 DEG C and be not detected by target protein
Expression, its bacterial protein SDS-PAGE results are as shown in Fig. 2 Fig. 2 is containing AaIT before optimization in the embodiment of the present invention
The SDS-PAGE testing result figures of the target protein of pET28, pET30 and pET32 recombinant vector expression.After containing optimization
PET28, pET30 and pET32 recombinant vector of AaIT gene orders is expression vector, its corresponding expression bacterium transformant Jing
The IPTG of 0.5mM is induced at 16 DEG C, 25 DEG C and 37 DEG C, wherein the transformant with pET28 and pET30 as recombinant expression carrier is not
The expression of target protein is detected, the expression of target protein is detected as expression vector with pET32, its bacterial protein SDS-
PAGE results are as shown in figure 3, Fig. 3 is pET28, the pET30 and pET32 restructuring containing AaIT after optimization in the embodiment of the present invention
The SDS-PAGE testing result figures of the target protein of vector expression, AaIT molecular weight of albumen is 8kDa, and pET32 carriers are in target
The Trx fragments that a size is 17kDa or so have been merged at the N- ends of albumen, and Trx-AaIT sizes are 25kDa or so, expression
Target protein is as shown by arrows.
Embodiment two
The present embodiment provides a kind of method for preparing albumen, specifically includes following steps：
S1：Optimized gene, structure prokaryotic expression carrier and conversion：The optimized ripe scorpion insect specific neurotoxin of synthetic
AaIT genes, and be connected in expression vector pET32, obtain recombinant expression carrier pET32/AaIT, vector construction such as Fig. 1 institutes
Show.Main vector construction step is as follows：
(1) with BamH I and Hind III double digestion recombinant vector PCP/pUC, purpose segment PCP is obtained, reaction system is such as
Under (restriction endonuclease used and buffer are purchased from Dalian TAKARA companies)：
(2) with BamH I and Hind III double digestion pET32, carrier segment, the following (restriction endonuclease used of reaction system are obtained
And buffer is purchased from Dalian TAKARA companies)：
(3) the purpose segment for obtaining step (1) and (2) and carrier segment DNA gel withdraw test kit and reclaim, the examination
Agent box is purchased from Dalian TAKARA companies, and concrete operations are carried out by kit specification.
(4) step (3) is reclaimed the purpose segment and carrier T4DNA ligases for obtaining (purchased from Dalian TAKARA companies)
Reaction is attached, genes of interest is properly inserted expression vector reading code inframe, and reaction system is as follows：
Recombinant vector pET32/AaIT is transformed in escherichia coli TOP10 bacterial strains, then recombinant vector is extracted from TOP10
pET32/AaIT；Recombinant vector pET32/AaIT is transferred in host cell E. coli expression strain with heat shock method, with containing
The LB plate screenings for having Amp resistances obtain including the E. coli expression strains transformant of recombinant vector pET32/AaIT.
S2：The expression of soluble T rx-AaIT fusion protein and extraction：PET32/AaIT comprising gene after optimization is carried
Escherichia coli recombinant conversion of body is cultivated to OD in 37 DEG C of LB liquid medium600For 0.6, concentration is then respectively adding
For the IPTG of 0,0.1mM, 0.5mM and 1.0mM, induce 6 hours at 16 DEG C, 25 DEG C and 37 DEG C respectively, the thalline collected after induction
Ultrasonication, crushes power 300W, crushes 5s, gap 9s, and after circulating 90 times, centrifuging and taking supernatant obtains the solubility recombinated
Fusion protein Trx-AaIT.
S3：The purification of Trx-AaIT fusion protein：Jing amplification culture and at 16 DEG C with 0.1mM IPTG induce 8 hours,
The thalline of the expression bacterium after collecting Jing after IPTG abduction deliverings, by thalline the buffer A (Tris- containing 50mM of 50ml is resuspended in
HCl, 300mM NaCl, 20mM imidazoles and 1mM protease inhibitor PMSF, pH 8.0) in, then broken with Ultrasonic Cell Disruptor
It is broken, power 300W is crushed, 5s, gap 9s are crushed, circulate 90 times；At 4 DEG C, 30000g is centrifuged 15min to bacterium solution after crushing；
Supernatant obtained by centrifugation is added in the nickel affinity chromatographic column of buffered liquid A pre-equilibrations；(contained with 100ml buffer Bs
50mM Tris-HCl, 300mM NaCl, 20mM imidazoles and 0.5-1.0%Triton X-114, pH 8.0, it is pre- prior on ice bath
Be cooled to 0 DEG C -4 DEG C) rinsing protein purification pillar after, be separately added into including concentration be 50mM, 100mM, 200mM, 300mM and
The buffer C (Tris-HCl containing 50mM, 300mM NaCl, pH 8.0) of 400mM imidazoles, albumen wash-out is got off, you can obtained pure
Trx-AaIT fusion protein of the degree more than 90%.
S4：The cutting of Trx labels and the purification of restructuring AaIT albumen：1mg Trx-AaIT fusion protein is taken, adds 1U's
Recombinate little Enterokinase Enteropeptidase EK E.C. 3.4.21.9, enzyme action is carried out at 25 DEG C, sampled per 2 hours, to enzyme action 12 hours.After the completion of enzyme action, by protein
Sample is dialysed under the 30mM Tris-HCl of pH6.0, and foreign protein is rinsed with 20mM NaCl Jing after the absorption of CM cation seperation columns,
The NaCl eluting of 100mM is just obtained rAaIT albumen of the purity more than 95%.
It should be noted that SDS-PAGE sample buffers are added in the supernatant that step S2 is obtained, to its solvable egg
It is analyzed in vain.When the concentration of IPTG at a temperature of 16 DEG C, 25 DEG C and 37 DEG C is 0.1mM, 0.5mM and 1.0mM, can obtain
Soluble T rx-AaIT fusion protein, concrete outcome is as shown in figure 4, Fig. 4 is comprising gene after optimization in the embodiment of the present invention
PET32/AaIT carriers the SDS-PAGE testing results of soluble T rx-AaIT fusion protein that obtain of escherichia coli expression
Figure.Wherein, at 16 DEG C, in for examination concentration range, soluble T rx-AaIT can high level expression；At 25 DEG C,
The concentration of IPTG has high-caliber soluble T rx-AaIT to express when being 0.1mM-0.5mM.For cost-effective, shortening production week
Phase, we preferably adopt 16 DEG C -25 DEG C of inducing temperature, the IPTG of 0.1mM～0.5mM to carry out abduction delivering.
For step S3, as a result to show and can obtain purity using the imidazole buffer C eluting for including 100mM～200mM
Up to 90% recombiant protein, the molecular weight of fusion protein is about 25kDa, the purge process of expression product soluble T rx-AaIT
Optimization as shown in figure 5, Fig. 5 be the embodiment of the present invention in the fusion protein of Trx-AaIT before purification and with include variable concentrations miaow
The SDS-PAGE testing result figures of the Trx-AaIT fusion protein that the buffer C purification of azoles is obtained.
For step S4, enzyme action effect is analyzed with SDS-PAGE, as a result as shown in fig. 6, Fig. 6 is in the embodiment of the present invention
The SDS-PAGE testing result figures of the albumen that Trx-AaIT fusion protein is obtained in different enzyme action time enzyme action, target protein such as arrow
Shown in head.2 hours enzyme action of Jing can obtain a large amount of cleaved rAaIT albumen, it is contemplated that production cost, excellent in actual production
First selection is cut 6 hours to 10 hours with enterokinase.The SDS-PAGE testing results of rAaIT recombiant proteins are as shown in fig. 7, target
Albumen is as shown by arrows.
Comparative example
Synthetic simultaneously optimizes scorpion neurotoxin AaIT n DNAs, in 5 '-end addition Metarhizium anisopliae base of the gene
Because of MCL1, and it is cloned into the Sma I restriction enzyme sites of pBarPc and obtains plasmid pMcl 1prAaIT, Jing after SwaI enzyme action, linearisation
Metarhizium anisopliae strains A RSEF 549 is carried out using the method for fungal protoplasts to convert, screening obtains turning for inheritance stability
Beggar AaIT-549, transformant AaIT-549 is expressed in insect blood isolated culture, and purification obtains AaIT albumen.
The expression of destination protein AaIT prepared by the technical scheme provided by the present embodiment is significantly improved, for step
Trx-AaIT fusion protein of the S3 Jing after 20mM Tris-HCl dialysis, the bacterium solution of 1L abduction deliverings can purification obtain 50mg's
Trx-AaIT fusion protein, purity is more than 90%；For step S4 is through the cutting of Trx labels and the pure of AaIT albumen of recombinating
Change, every liter of E. coli broth can purification obtain rAaIT recombiant protein of the purity of 5mg more than 95%.And in comparative example,
Albumen 2.4mg of the purity 50% can be only obtained from the culture fluid of 1L, and comparative example needs to utilize insect blood in vitro
Culture, production cost is high.
Comparative example purification is obtained into AaIT albumen (A groups), the Trx-AaIT fusion protein after purification that above-mentioned steps S3 are obtained
The recombiant protein rAaIT (C groups) after purification that (B groups) and above-mentioned steps S4 are obtained carries out analysis of biological activity, concrete analysis
Method and result are as follows.
Experimental technique：Comparative example purification is obtained the Trx-AaIT fusion protein of AaIT albumen (A groups), purification using PBS
The rAaIT albumen (C groups) of (B groups) and purification is diluted to respectively 2mg/ml, each 20 by 10 μ g/g body weight, 5 age silkworms of injection, together
When to inject the silkworm of same volume PBS (D groups) as control, observe the symptom of being poisoned to death of silkworm.
Experimental result：As a result find, injection comparative example purification obtains the silkworm (A groups) of AaIT albumen and shows nervous system
Poisoning symptom, and it is 70% dead in 24 hours, and the silkworm for injecting the Trx-AaIT fusion protein of purification does not show nerveous system
System poisoning symptom, and inject same volume PBS matched group silkworm also none there is poisoning symptom；Injection rAaIT (C groups)
Silkworm shows strong nervous system poisoning symptom, and 100% dead in 24 hours.Wherein inject rAaIT and PBS control
Each 2 silkworms in the symptom characteristic that showed for 10 minutes of injection as shown in figure 8, the injection during Fig. 8 is the embodiment of the present invention
The symptom characteristic figure that each 2 silkworms of rAaIT recombiant proteins group and PBS control group show after injecting 10 minutes.Biology lives
Property testing result show, the rAaIT albumen that technical solution of the present invention is prepared have very strong biological activity.Concrete outcome is such as
Shown in table 1 below：
Table 1 A, B, C and D group analysis of biological activity result (n=3)
In the description of this specification, reference term " one embodiment ", " some embodiments ", " example ", " specifically show
The description of example " or " some examples " etc. means to combine specific features, structure, material or spy that the embodiment or example are described
Point is contained at least one embodiment of the present invention or example.In this manual, to the schematic representation of above-mentioned term not
Identical embodiment or example must be directed to.And, the specific features of description, structure, material or feature can be with office
Combine in an appropriate manner in one or more embodiments or example.Additionally, in the case of not conflicting, the skill of this area
Art personnel can be tied the feature of the different embodiments or example described in this specification and different embodiments or example
Close and combine.
Although embodiments of the invention have been shown and described above, it is to be understood that above-described embodiment is example
Property, it is impossible to limitation of the present invention is interpreted as, one of ordinary skill in the art within the scope of the invention can be to above-mentioned
Embodiment is changed, changes, replacing and modification, and does not make the essence of appropriate technical solution depart from various embodiments of the present invention skill
The scope of art scheme, it all should cover in the middle of the claim of the present invention and the scope of description.
Claims (10)
1. a kind of gene, is any one DNA molecular in following (1)-(3)：
(1) DNA molecular by shown in sequence in sequence table 1；
(2) DNA point of the albumen of DNA sequence hybridization and coding with poisoning insect active for limiting with (1) under strict conditions
Son；
(3) with (1) limit DNA sequence at least have 90%, at least have 95%, at least have 96%, at least have 97%,
At least have 98% or at least there is 99% homology and the DNA molecular of the albumen with poisoning insect active is encoded.
2. the albumen that DNA molecular coding according to claim 1 is obtained.
3. albumen according to claim 2, it is characterised in that：It is following (1) or (2)：
(1) protein that the aminoacid sequence shown in sequence in sequence table 2 is constituted；
(2) replacement by the aminoacid sequence shown in sequence in sequence table 2 through one or several amino acid residues and/or disappearance
And/or add and with the protein by derived from sequence 2 of poisoning insect active.
4. the recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing gene described in claim 1；
The recombinant vector be specially by described in claim 1 gene insertion expression vector in, obtain express claim 2 or
The recombinant vector of albumen described in 3.
5. a kind of method of the albumen prepared described in Claims 2 or 3, including step：By containing the gene described in claim 1
Recombinant expression carrier import host cell, the host cell is preferably escherichia coli, for building the recombinant expressed load
The initial carrier of body is preferably pET32 carriers.
6. the method for preparing albumen according to claim 5, it is characterised in that：The step of method also includes purifying protein：
The fusion protein that expression is obtained is cut with enterokinase, is then dialysed under conditions of pH value is for 6.0～6.2, Jing CM cationes
With the rinsing of 20mM NaCl solutions after post absorption, then with 100mM NaCl eluting.
7. the albumen after purification that the method for preparing albumen according to claim 6 is prepared.
8. albumen, gene described in claim 1 described in claim 2,3 or 7 or recombinant vector described in claim 4, expression cassette,
The application of transgenic cell line or recombinant bacterium in pest-resistant field.
9. a kind of method for cultivating transgenic plant, is that the protein coding gene described in claim 1 is imported to into purpose plant
In, transgenic plant is obtained, the insect resistace of the transgenic plant is higher than the purpose plant.
10. a kind of method for cultivating transgenic virus, is that the protein coding gene described in claim 1 is transferred to into purpose virus
In, transgenic virus are obtained, higher than purpose virus, the purpose virus is preferably bar to the insect resistace of the transgenic virus
One kind in shape virus, nucleopolyhedrosises element and cytoplasmic polyhedrosis viruies.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611180128.6A CN106636118A (en) | 2016-12-19 | 2016-12-19 | Scorpion neurotoxin AaIT and encoding gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611180128.6A CN106636118A (en) | 2016-12-19 | 2016-12-19 | Scorpion neurotoxin AaIT and encoding gene and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106636118A true CN106636118A (en) | 2017-05-10 |
Family
ID=58833882
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611180128.6A Pending CN106636118A (en) | 2016-12-19 | 2016-12-19 | Scorpion neurotoxin AaIT and encoding gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636118A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108117599A (en) * | 2018-01-03 | 2018-06-05 | 海门迈克艾伦生物医药有限公司 | The recombination expression and purification process of Ssm6a and its fusion protein used |
| CN108218966A (en) * | 2018-04-06 | 2018-06-29 | 怀化学院 | A kind of artificial reconstructed HtA albumen and its encoding gene and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1597938A (en) * | 2004-09-22 | 2005-03-23 | 山西大学 | Recombined rhabdovirus containing double valence insect resisting gene |
| CN1597951A (en) * | 2004-09-22 | 2005-03-23 | 山西大学 | Artificial synthesised scorpion chloride ion neurotoxin gene-rBmK CTa |
| CN101307313A (en) * | 2007-05-18 | 2008-11-19 | 中国科学院上海生命科学研究院 | Disinsection fungal engineering strain inverted from scorpion toxin gene and applications |
-
2016
- 2016-12-19 CN CN201611180128.6A patent/CN106636118A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1597938A (en) * | 2004-09-22 | 2005-03-23 | 山西大学 | Recombined rhabdovirus containing double valence insect resisting gene |
| CN1597951A (en) * | 2004-09-22 | 2005-03-23 | 山西大学 | Artificial synthesised scorpion chloride ion neurotoxin gene-rBmK CTa |
| CN101307313A (en) * | 2007-05-18 | 2008-11-19 | 中国科学院上海生命科学研究院 | Disinsection fungal engineering strain inverted from scorpion toxin gene and applications |
Non-Patent Citations (2)
| Title |
|---|
| RIKU MATSUMOTO: "Potency of insect-specific scorpion toxins on mosquito control using Bacillus thuringiensis Cry4Aa", 《JOURNAL OF BIOSCIENCE AND BIOENGINEERING》 * |
| 卢雪梅: "重组融合蛋白Trx-IFN-CSP 的肠激酶酶切及纯化", 《生物技术》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108117599A (en) * | 2018-01-03 | 2018-06-05 | 海门迈克艾伦生物医药有限公司 | The recombination expression and purification process of Ssm6a and its fusion protein used |
| CN108218966A (en) * | 2018-04-06 | 2018-06-29 | 怀化学院 | A kind of artificial reconstructed HtA albumen and its encoding gene and application |
| CN108218966B (en) * | 2018-04-06 | 2019-10-08 | 怀化学院 | A kind of artificial reconstructed HtA albumen and its encoding gene and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2319927A1 (en) | Secretion expression of antibiotic peptide cad in bacillus subtilis and expression system of recombination bacillus subtilis | |
| CN104450746A (en) | Method for fixed-point introduction of non-natural amino acid to protein | |
| CN110194790A (en) | The plant immune activator protein FoPII1 of Fusarium oxysporum secretion and its application | |
| CN102586286B (en) | Expression system of bacillus thur ingiens (Bt) insecticidal protein Cry1Ac-a | |
| CN106636118A (en) | Scorpion neurotoxin AaIT and encoding gene and application thereof | |
| CN106754942A (en) | The preparation method of scorpion neurotoxin AaIT recombinations and its albumen and application | |
| Dušková et al. | Chitinolytic enzymes from bacterium inhabiting human gastrointestinal tract-critical parameters of protein isolation from anaerobic culture | |
| CN104711265B (en) | A kind of green plant bug vitellogenin, its specific peptide chain, carrier, bacterial strain and application | |
| CN106939315A (en) | A kind of preparation method and application of oxalate decarboxylase | |
| Kuddus et al. | Enhanced expression of cysteine‐rich antimicrobial peptide snakin‐1 in Escherichia coli using an aggregation‐prone protein coexpression system | |
| CN105039370A (en) | Fusion gene for biosynthesis of resveratrol, expression vector thereof and resveratrol preparation method | |
| CN104311648A (en) | Insecticidal protein as well as coded gene and application of insecticidal protein | |
| CN105367634A (en) | Bt protein Cry1Ie5 and coding gene and application thereof | |
| CN104862331B (en) | A kind of method of solubility expression Rhodococcus equi Disease-causing gene VapA albumen | |
| CN106754944A (en) | A kind of high-efficiency method for producing of the neurotoxin Bj α IT without label activated protein | |
| CN102250938B (en) | Preparation method of cardiactide | |
| CN106591317A (en) | Preparation method of scorpion neurotoxin Bj alpha IT gene and recombinant protein thereof | |
| CN101665788B (en) | Artificially synthesized pig growth hormone gene and expression and purification method thereof | |
| CN106754945B (en) | Production method of toxin Tx4(6-1) tag-free recombinant protein | |
| CN103484487B (en) | A kind of small cabbage moth N,O-Diacetylmuramidase II and preparation method thereof and application | |
| CN103525836B (en) | A kind of Bt Cry71Aa1 operon gene and proteins encoded thereof and application | |
| Chai et al. | Molecular cloning and characterization of a mannose-binding lectin gene from Crinum asiaticum | |
| CN115197305A (en) | Bt protein Cry53A and gene and application thereof | |
| CN102154260A (en) | Novel method for efficiently cloning antibacterial peptide encoding gene | |
| CN107629129A (en) | Production and the method for purified polypeptide |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170510 |