CN106754942A - The preparation method of scorpion neurotoxin AaIT recombinations and its albumen and application - Google Patents
The preparation method of scorpion neurotoxin AaIT recombinations and its albumen and application Download PDFInfo
- Publication number
- CN106754942A CN106754942A CN201611180127.1A CN201611180127A CN106754942A CN 106754942 A CN106754942 A CN 106754942A CN 201611180127 A CN201611180127 A CN 201611180127A CN 106754942 A CN106754942 A CN 106754942A
- Authority
- CN
- China
- Prior art keywords
- albumen
- dna
- sequence
- aait
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43513—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae
- C07K14/43522—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae from scorpions
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Insects & Arthropods (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Tropical Medicine & Parasitology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
It is any one DNA molecular in following (1) (3) the present invention relates to the gene that the preparation method of a kind of scorpion neurotoxin AaIT recombinations and its albumen is provided with application, the present invention：(1) DNA molecular as shown in sequence in sequence table 1；(2) DNA molecular of the albumen of DNA sequence dna hybridization and coding with poisoning insect active for being limited with (1) under strict conditions；(3) with (1) limit DNA sequence dna at least have 90%, at least have 95%, at least have 96%, at least have 97%, at least have 98% or at least have 99% homology and coding have poisoning insect active albumen DNA molecular.Present invention optimizes the DNA sequence dna of AaIT, and there is provided it is a kind of can be with high efficient expression and the method for purifying AaIT recombinant proteins, for pest-resistant field, particularly cultivating zoophobous kind has important value, and the yield to improving crops has great importance.
Description
Technical field
The present invention relates to biological technical field, and in particular to the system of a kind of scorpion neurotoxin AaIT recombinations and its albumen
Preparation Method and application.
Background technology
Insect specific neurotoxin is that a class acts only on insect nerve system, there is the polypeptide neurotoxin of toxic action, main
Come from scorpion, secondly come from spider.The action site of this kind of toxin for having single-minded toxic action to insect is that various ions lead to
Road, the neurotoxin with efficient insect selectivity is mainly the long-chain neurotoxin for acting on sodium-ion channel, this kind of long-chain
Neurotoxin is typically made up of 60-70 amino acid, has 2-4 to intrachain disulfide bond.The neurotoxin in different genera source is in ammonia
There is no obvious conservative on the composition of base acid, and Derived Nerve toxin of the same race has conservative very high in primary structure.
AaIT be by Tal Arnon be separated to from the venom of scorpion Androctonus australis it is a kind of to insect have height
The α-type insect specific neurotoxin for acting on sodium-ion channel of selectivity is spent, the ripe neurotoxin is by 64 amino acid residue groups
Into, there is very strong toxic action to agricultural pests, natural toxin is paralysed to the half of Lepidoptera, Orthoptera and Diptera pest
Dosage (PD50) it is several sodium gram to tens sodium gram/g body weight, therefore the toxin has potential application in agricultural insect management
Value.Although insect specific neurotoxin has the important potential value of control agricultural pests, natural insects neurotoxin is in poison gland
In content it is low and extract difficult, and often can only obtain very small amount of sterling, this just further studies this to us
The characteristic of a little toxin brings very big difficulty.
In the prior art by insect specific neurotoxin construction of expression vector, being then transformed into E.coli BL21 (DE3) carries out table
Reach, but obtain is all inactive inclusion body, by being dissolved under the conditions of suitable in vitro, being denatured, renaturation and purifying,
It is only capable of obtaining micro soluble protein from every liter of culture medium, output is low；The expression vector that will be built be there is also in yeast
The method of middle expression, but its expression quantity is low and isolates and purifies difficulty.At present, also not over the transformation DNA sequence dna of AaIT and excellent
Change the mode that AaIT expression and purifications method efficiently to produce AaIT recombinant proteins, significantly impact AaIT determinations of activity, insecticidal spectrum
Analysis and applications of the AaIT in pest-resistant, thus need badly develop one kind can with reduces cost, realize that a large amount of productions have biology
Activity and the method for possessing the insect specific neurotoxin AaIT for poisoning insect selectivity.
The content of the invention
For defect of the prior art, present invention aim at provide a kind of scorpion neurotoxin AaIT recombinations and its
The preparation method of albumen and application.
The present invention provides gene, is the gene of coding scorpion neurotoxin AaIT albuminoids, is any one in following (1)-(3)
The DNA molecular planted：
(1) DNA molecular as shown in sequence in sequence table 1；
(2) albumen of DNA sequence dna hybridization and coding with poisoning insect active for being limited with (1) under strict conditions
DNA molecular；
(3) DNA sequence dna limited with (1) at least has 90%, at least has 95%, at least have 96%, at least have
97%th, at least have 98% or at least there is 99% homology and the DNA molecular of albumen of the coding with poisoning insect active.
Stringent condition can be as follows：50 DEG C, in 7% lauryl sodium sulfate (SDS), 0.5M NaPO4With 1mM EDTA's
Hybridize in mixed solution, at 50 DEG C, 2 × SSC is rinsed in 0.1%SDS；Can also be：50 DEG C, in 7%SDS, 0.5M NaPO4With
Hybridize in the mixed solution of 1mM EDTA, at 50 DEG C, 1 × SSC is rinsed in 0.1%SDS；Can also be：50 DEG C, 7%SDS,
0.5M NaPO4Hybridize with the mixed solution of 1mM EDTA, at 50 DEG C, 0.5 × SSC is rinsed in 0.1%SDS；Can also be：50
DEG C, in 7%SDS, 0.5M NaPO4Hybridize with the mixed solution of 1mM EDTA, at 50 DEG C, 0.1 × SSC floats in 0.1%SDS
Wash；Can also be：50 DEG C, in 7%SDS, 0.5M NaPO4Hybridize with the mixed solution of 1mM EDTA, at 65 DEG C, 0.1 × SSC,
Rinsed in 0.1%SDS；Or：In 6 × SSC, the solution of 0.5%SDS, hybridize at 65 DEG C, then with 2 × SSC,
0.1%SDS and 1 × SSC, 0.1%SDS respectively wash film once.
Wherein, the sequence 1 in sequence table is made up of 231 deoxynucleotides, this sequence include AaIT genes into soft-boiled eggs
The expression label and terminator codon of Bai Quanchang reading frames and 6 group ammonia composition, amino acid of the coding with sequence 2 in sequence table
The protein of residue sequence.
The albumen for obtaining is encoded by the sequence 1 in above-mentioned sequence table and belongs to protection scope of the present invention.
The present invention provides albumen, is following (1) or (2)：
(1) protein that the amino acid sequence shown in sequence in sequence table 2 is constituted；
(2) by the amino acid sequence shown in sequence in sequence table 2 by the substitution of one or several amino acid residues and/or
Lack and/or add and with the protein as derived from sequence 2 of poisoning insect active.
Wherein, the sequence 2 in sequence table is made up of 76 amino acid residues, and wherein 1-70 is maturation AaIT Argine Monohydrochlorides
Sequence, 71-76 is 6 expression labels of group ammonia composition, and the reading frame of its encoding gene (includes one comprising 231 nucleotides
Terminator codon).
The substitution of one or several amino acid residues and/or missing and/or addition refer to not more than ten amino acid residues
Substitution and/or missing and/or addition.
Recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing said gene fall within protection of the invention
Scope.
Recombinant vector is specially in said gene insertion expression vector, obtains expressing the recombinant vector of above-mentioned albumen.Weight
Group carrier is particularly preferred as, by between Xho I and Xba the I restriction enzyme sites of said gene insertion expression vector pPICZ α A, obtaining table
Up to the recombinant vector of above-mentioned albumen.
The primer pair of amplification gene total length or its any fragment falls within protection scope of the present invention.
The nucleotides sequence of a primer in above-mentioned primer pair is classified as the sequence 3 in sequence table
(GCCTCGAGAAAAGAAAAAAGAACGGTTACGCT), the nucleotides sequence of another primer in primer pair is classified as in sequence table
Sequence 4 (GCTCTAGATCAGTTGATGATAGTAGTGTCAC), using sequence 3 and sequence 4 primer expand target gene
The digestion and attended operation of correlation can equally be carried out.
Second object of the present invention is to provide a kind of method for preparing albumen, comprises the following steps：
S1：Gene and expression vector pPICZ α with Xho I and Xba I double digestions and are purified into recovery respectively, is then utilized
Ligase obtains recombinant vector pPICZ α A-AaIT in 16 DEG C of connections；
S2：Recombinant vector pPICZ α A-AaIT are linearized with Sac I single endonuclease digestions, and is transformed into lithium chloride conversion method complete
In red yeast host bacterium, then positive colony is obtained by Zeocin screenings；
S3：Positive colony is forwarded to the YPD flat boards containing 1500~2000 μ g/mL Zeocin (bleomycin hydrochloride),
Screening obtains the transformant of Zeocin resistances high, by resistance transformant BMGY medium cultures to OD600It is 10~15, from
The heart collects cell precipitation, with BMMY culture medium re-suspended cells, adds methyl alcohol and makes its mass fraction be 1.0%~1.5%, induction
72 hours, collect the supernatant of fermentation；Before induced expression, preferably by the transformant of Zeocin resistances high with BMMY in a small amount
Induced expression, screening obtains the transformant of high-level secretory expression target protein, then with BMGY medium culture induced expressions.
Preferably, step S3 induction 72 hours afterwards and collect fermentation supernatant before, also including further luring
Lead the following steps of expression：
S31：Continue Fiber differentiation 72 hours at 28 DEG C, adding methyl alcohol within every 24 hours makes its mass fraction be maintained at 1.0%
~1.5%.
Preferably, after step s 3, also following steps including purifying protein：
S4：Supernatant is adjusted into pH to 7.5~8.5 using Tris alkali, with the rotating speed centrifugation 10 more than or equal to 15000g
~20 minutes, the supernatant of acquisition is added in the nickel affinity chromatographic column after being balanced through pH 8Tris-HCl buffer solutions, with 2~
4 times of buffer solution rinsing nickel affinity chromatographic columns of Tris-HCl containing 10mM and 30mM~50mM imidazoles of the pH 8 of chromatography column volume；
S5：With Tris-HCl containing 10mM and the buffer solution elution nickel affinity chromatographic column of 100~400mM imidazoles, by what is obtained
Eluent, for the bag filter of 3kDa is dialysed in 10mM Tris-HCl buffer solutions, is then concentrated by ultrafiltration using molecular weight.
Preferably, after step s 5, also including the following steps of preservation albumen：
S6：The product for obtaining will be concentrated by ultrafiltration quick-frozen at -80 DEG C, then freeze-drying.
Protection scope of the present invention is fallen within according to the albumen that any of the above-described kind of method for preparing albumen is prepared.
The yeast that the stabilization and energy high-level secretory expression scorpion insect specific neurotoxin AaIT for obtaining is screened by step S3 is turned
Beggar falls within the scope of protection of the invention.
Above-mentioned albumen, said gene or above-mentioned recombinant vector, expression cassette, transgenic cell line or recombinant bacterium are in pest-resistant field
In application be also the scope of protection of the invention.
Third object of the present invention is to provide a kind of method for cultivating genetically modified plants, is by the coding base of above-mentioned albumen
Because importeding into purpose plant, genetically modified plants are obtained, the insect resistace of genetically modified plants is higher than purpose plant.
Above-mentioned genetically modified plants are interpreted as not only comprising the first generation genetically modified plants for obtaining genetic transformation purpose plant,
Also its filial generation is included.For genetically modified plants, the gene can be bred in the species, it is also possible to which traditional breeding method is by the base
Because being transferred into other kinds, particularly including commercial variety of same species.By channel genes purpose plant, protein can be made
Synthesis in purpose plant, enters but the pest-resistant performance of purpose plant is improved.
The present invention also provides a kind of method for cultivating transgenic virus, is that the encoding gene of above-mentioned albumen is transferred into purpose
In virus, transgenic virus are obtained, the insect resistace of transgenic virus is viral higher than purpose, the viral preferably baculoviral of purpose,
One kind in nucleopolyhedrosis element and cytoplasmic polyhedrosis virus.
The technical scheme that the present invention is provided has advantages below：One is the expression secreting, expressing according to the technical program
The recombinant scorpion neurotoxin AaIT with bioactivity obtained with purifying can effectively prevent Host Strains to expression product
Degraded, mitigate the load and expression product of host cell metabolism to the toxic action of host；Two is using yeast vector pPICZ
The gene secretion expression of the secretion signal α-factor signal peptide guiding destination protein on α A-AaIT, destination protein can largely be secreted
To in nutrient solution, and accurate space structure can be formed, so as to keep the natural activity of scorpion insect specific neurotoxin AaIT；Three is logical
Cross that screening stablize and energy high-level secretory expression obtains the yeast transformant of scorpion insect specific neurotoxin AaIT；Four is to find out
The method of insect god's toxin AaIT is expressed with eucaryon host Pichia pastoris and scorpion insect specific neurotoxin AaIT is rapidly and efficiently purified
Method, with reduces cost and a large amount of productions can be realized；Five is the histidine-tagged recombinant protein of band of purifying to insect cell
It is toxic and the toxicity i.e. toxin is not detected by mammalian cell, that is, maintain the selectivity for poisoning insect.
Additional aspect of the invention and advantage will be set forth in part in the description, and will partly become from the following description
Obtain substantially, or recognized by practice of the invention.
Brief description of the drawings
Fig. 1 is that the carrier for expression of eukaryon pPICZ α A-AaIT in the embodiment of the present invention build schematic diagram；
Fig. 2 is the SDS- of the yeast transformant of the insect specific neurotoxin AaIT of difference Zeocin resistances in the embodiment of the present invention
PAGE testing result figures；
Fig. 3 is for the SDS-PAGE of different time points target protein expression is examined under methanol induction in the embodiment of the present invention
Survey result figure；
Fig. 4 is the SDS-PAGE detections of the eluting AaIT albumen for obtaining of imidazoles of various concentrations in the embodiment of the present invention
Result figure；
Fig. 5 is to purify the SDS-PAGE testing result figures of the AaIT albumen for obtaining in the embodiment of the present invention；
Fig. 6 is the BA result schematic diagram of the restructuring AaIT albumen after optimizing in the embodiment of the present invention.
Specific embodiment
Below in conjunction with the accompanying drawing in the embodiment of the present invention, the technical scheme in the embodiment of the present invention is carried out clear, complete
Site preparation is described, it is clear that described embodiment is only a part of embodiment of the invention, rather than whole embodiments.It is based on
Embodiment in the present invention, it is every other that those of ordinary skill in the art are obtained under the premise of creative work is not made
Embodiment, belongs to the scope of protection of the invention.
Experimental technique used in following embodiments is conventional method unless otherwise specified.
Material used, reagent etc. in following embodiments, unless otherwise specified, commercially obtain.
% in following embodiments, unless otherwise specified, is weight/mass percentage composition.Quantitative examination in following examples
Test, be respectively provided with three repetitions and test, data are the average value or mean+SD of three repetition experiments.
It is public that the present invention is purchased from U.S. Invritrogen from Pichi strain and conformability expression plasmid pPICZ α A
Department.
Primer particular sequence in the present invention as shown in sequence 3 and sequence 4 in sequence table, using sequence 3 and sequence 4
The target gene of primer amplification can equally carry out the digestion and attended operation of correlation.
Used medium formula is as follows：
1) yeast growth medium (BMGY)：
It is completely dissolved 10g yeast extracts, 20g peptones, constant volume to 800mL.121 DEG C of steam autoclaving 15-
20min, is cooled to room temperature, adds 100mL 1M potassium phosphate solutions, 100mI 500 × biotins of YNB, 2mL, 20mL 50% to go out
Bacterium glycerine；
2) yeast inducing culture (BMMY)
It is completely dissolved 10g yeast extracts, 20g peptones, constant volume to 800mL.121 DEG C of steam autoclaving 15-
20min, is cooled to room temperature, adds 100mL 1M potassium phosphate solutions, 100mL YNB, 2mL500 × biotin, 10mL methyl alcohol；
3) YPD culture mediums
Be completely dissolved 10g yeast extracts, 20g peptones, constant volume to 900mL, 121 DEG C of steam autoclaving 15-
20min, is cooled to 70 DEG C or so and adds 100mL20% sterile dextrose solution.The agar of addition 1.5-1.8% can wherein
YPD solid mediums are obtained.
4) YPG culture mediums
It is completely dissolved 10g yeast extracts, 20g peptones, 20g glycerine, constant volume to 1000mL, go out by 121 DEG C of steam high pressures
Bacterium 15-20min.
Embodiment one
Present embodiments provide a kind of AaIT gene of the artificial synthesized C- ends with 6 × His labels of optimization, specific sequence
As shown in the sequence 1 in sequence table, the protein sequence corresponding to the gene is as shown in the sequence 2 in sequence table for row.This implementation
Sequence before the optimization of example is the DNA sequence dna provided according to ncbi database, is the n DNA for synthesizing AaIT neurotoxins, so
Afterwards according to toxin gene and Pichia pastoris codon expression characteristic, optimize and the DNA after synthesis optimizing.DNA sequence dna after optimization
Native polynucleotide (GenBank accession number M27706) with AaIT is compared through NCBI, does not have obvious similitude.
Artificial synthesized C- ends after the n DNA of the AaIT neurotoxins before optimization and optimization are carried into 6 × His labels
DNA be respectively connecting on Pichia pastoris secreted expression carrier pPICZ α A, obtain recombinant vector, then utilize
Recombinant vector is transformed into Pichia pastoris Host Strains X- by the lithium chloride conversion method that Invitrogen companies operation manual is provided respectively
In 33, screened with the YPD flat boards containing 100 μ g/mL Zeocin antibiotic respectively after conversion, transformant is entered using PCR
Row checking, the Pichia pastoris transformant line after PCR is verified is seeded to the Zeocin antibiotic containing various concentrations respectively
YPD flat boards, respectively screening obtain containing optimization before AaIT neurotoxins n DNA resistance Pichia pastoris transformant and
The resistance Pichia pastoris transformant of DNA of the artificial synthesized C- ends with 6 × His labels after containing optimization, then distinguishes
With BMMY a small amount of induced expressions, then carry out SDS-PAGE analyses.The day of the AaIT neurotoxins before analysis result display optimization
Right DNA builds the Pichia pastoris transformant for obtaining and will not express target protein, and carries 6 with the artificial synthesized C- ends after optimization
The DNA of × His labels builds the Pichia pastoris transformant for obtaining and can express and secrete target protein.
Embodiment two
The present embodiment provides a kind of method for preparing albumen, specifically includes following steps：
S1：Construction of expression vector and conversion：Marked with 6 × His at artificial synthesized C- ends after by the optimization of embodiment one
The DNA of label is connected to Pichia pastoris secreted expression carrier pPICZ α A, obtains recombinant vector pPICZ α A-AaIT, vector construction
As shown in figure 1, Fig. 1 is the carrier for expression of eukaryon pPICZ α A-AaIT structure schematic diagrames in the embodiment of the present invention.Main carrier
Construction step is preferably as follows：
(1) with the plasmid of AaIT gene of the Xho I and Xba I double digestions containing synthesis, purpose segment is obtained, reaction system is such as
Under (restriction endonuclease used and buffer solution are purchased from Dalian TAKARA companies)：
(2) Xho I and Xba I double digestion pPICZ α A are used, carrier segment is obtained, reaction system it is following (restriction endonuclease used and
Buffer solution is purchased from Dalian TAKARA companies)：
(3) the purpose segment and carrier segment DNA gel for obtaining step (1) and (2) withdraw kit and reclaim, the examination
Agent box is purchased from Dalian TAKARA companies, and concrete operations are carried out by kit specification.
(4) step (3) is reclaimed the purpose segment and carrier T4DNA ligases for obtaining (purchased from Dalian TAKARA companies)
Reaction is attached, genes of interest is properly inserted in the excretion vector reading frame containing secretion signal α-factor, reactant
System is as follows：
S2：The conversion of recombinant plasmid：Recombinant vector pPICZ α A-AaIT are linearized with Sac I single endonuclease digestions, according to
The lithium chloride conversion method that Invitrogen companies operation manual is provided, recombinant vector is transformed into Pichia pastoris Host Strains, this
That embodiment is selected is X-33.Screened with the YPD flat boards containing 100 μ g/mL Zeocin antibiotic after conversion, using PCR
Transformant is verified.
S3：The screening of high-level secretory expression yeast transformant and the expression of albumen：Pichia pastoris after PCR is verified turns
Beggar's streak inoculation screens the conversion for obtaining Zeocin resistances high to the YPD flat boards of the Zeocin antibiotic containing various concentrations
Son, by resistance transformant BMMY a small amount of induced expressions, screening obtains the transformant of high-level secretory expression target protein,
The yeast transformant single bacterium colony of high-level secretory expression is chosen, the 250mL triangles equipped with 50mL YPD fluid nutrient mediums are seeded to
In bottle, at 28 DEG C, cultivated under 300rpm condition of culture to thalline OD600=6.0, above-mentioned bacterium solution is taken, it is seeded to BMGY containing 500mL
, Mei ping inoculations 5mL in the 2000mL shaking flasks of culture medium, in 28 DEG C, 250rpm is cultivated to OD600=12；2500g centrifugations at room temperature
5min, collects thalline, with the resuspended thalline of BMMY of 1/7 former volume of culture, to adding 100% methyl alcohol to final concentration in culture medium
(mass fraction) is 1.3%, and in 28 DEG C of Fiber differentiations, adding methyl alcohol within every 24 hours makes its mass fraction be maintained at 1.3%, and receives
Collect the supernatant of fermentation.
It should be noted that by the transformant of Zeocin resistances high BMMY a small amount of induced expressions, analyzed through SDS-PAGE,
Screening obtains one plant of stabilization and height from ten plant height resistances (resistance level is more than or equal to 1500 μ g/mL Zeocin) transformant
The yeast transformant of level secretion expression insect god's toxin AaIT, and it is less than 1500 μ g/mL Zeocin from 50 plants of resistance levels
The transformant of YPD flat boards does not screen the transformant of high-level secretory expression target protein, the SDS- of Partial Conversion screening
PAGE results are as shown in Fig. 2 the yeast that Fig. 2 is the insect specific neurotoxin AaIT of difference Zeocin resistances in the embodiment of the present invention turns
The SDS-PAGE testing result figures of beggar.
Different time target protein expression is analyzed under detecting methanol induction with SDS-PAGE, electrophoresis result such as Fig. 3 institutes
Show, Fig. 3 is for the SDS-PAGE detections of different time points target protein expression are tied under methanol induction in the embodiment of the present invention
Fruit is schemed.Through induction 1~4 day, there is obvious destination protein to express in 10kDa or so, and by continuing to add methyl alcohol, induction is obtained
Destination protein content it is higher, the total amount result that specific purposes albumen accounts for Supernatant protein is as shown in table 1 below.
The destination protein that the different induction times of table 1 are obtained accounts for the degree result of Supernatant protein
| Induction time | 1 day | 2 days | 3 days | 4 days |
| Degree (%) | 9 | 26 | 39 | 35 |
Embodiment three
The present embodiment provides a kind of method for preparing albumen, specifically includes following steps：
S1：DNA of the artificial synthesized C- ends with 6 × His labels after by the optimization of embodiment one is connected to complete red ferment
Female secreted expression carrier pPICZ α A, obtain recombinant vector pPICZ α A-AaIT, and vector construction is as shown in Figure 1.Main carrier
Construction step is preferably as follows：
(1) with the plasmid of AaIT gene of the Xho I and Xba I double digestions containing synthesis, purpose segment is obtained, reaction system is such as
Under (restriction endonuclease used and buffer solution are purchased from Dalian TAKARA companies)：
(2) Xho I and Xba I double digestion pPICZ α A are used, carrier segment is obtained, reaction system it is following (restriction endonuclease used and
Buffer solution is purchased from Dalian TAKARA companies)：
(3) the purpose segment and carrier segment DNA gel for obtaining step (1) and (2) withdraw kit and reclaim, the examination
Agent box is purchased from Dalian TAKARA companies, and concrete operations are carried out by kit specification.
(4) step (3) is reclaimed the purpose segment and carrier T4DNA ligases for obtaining (purchased from Dalian TAKARA companies)
Reaction is attached, genes of interest is properly inserted in the excretion vector reading frame containing secretion signal α-factor, reactant
System is as follows：
S2：Recombinant vector pPICZ α A-AaIT are linearized with Sac I single endonuclease digestions, according to Invitrogen companies manipulator
The lithium chloride conversion method that volume is provided, recombinant vector is transformed into Pichia pastoris Host Strains, and that the present embodiment is selected is X-33.Turn
Screened with the YPD flat boards containing 100 μ g/mL Zeocin antibiotic after change, transformant is verified using PCR.
S3：Pichia pastoris transformant streak inoculation after PCR is verified is to the Zeocin antibiotic containing various concentrations
YPD flat boards, screening obtains the transformant of Zeocin resistances high, by resistance transformant BMMY a small amount of induced expressions, screening
The transformant of high-level secretory expression target protein is obtained, the yeast transformant single bacterium colony of high-level secretory expression, inoculation is chosen
Into the 250mL triangular flasks equipped with 50mL YPD fluid nutrient mediums, at 28 DEG C, cultivated under 300rpm condition of culture to thalline OD600
=6.0, above-mentioned bacterium solution is taken, , Mei ping inoculation 5mL in the 2000mL shaking flasks of the culture mediums of BMGY containing 500mL are seeded to, in 28 DEG C,
250rpm is cultivated to OD600=12；2500g is centrifuged 5min, collects thalline, with the resuspended bacterium of BMMY of 1/7 former volume of culture at room temperature
Body, is 1.3% to 100% methyl alcohol to final concentration (mass fraction) is added in culture medium, is induced 72 hours, adds first within every 24 hours
Alcohol makes its mass fraction be maintained at 1.3%, collects the supernatant of fermentation.
S4：The supernatant that will be obtained collects the supernatant after centrifugation in 4 DEG C of centrifugations, and pH is adjusted to 8.0 using Tris alkali,
It is centrifuged 15 minutes with the rotating speed of 15000g, the supernatant of acquisition is added to the nickel parent after being balanced through pH 8Tris-HCl buffer solutions
Close in chromatographic column, nickel affinity is rinsed with the buffer solution of 3 times of Tris-HCl containing 10mM and 40mM imidazoles of the pH 8 of chromatography column volume
Chromatographic column.
S5：With the buffer solution elution nickel affinity chromatographic column of Tris-HCl containing 10mM and 100,200 and 400mM imidazoles and receive
Collection eluent, is concentrated by ultrafiltration after eluent is dialysed using the bag filter of molecular weight 3kDa in 10mM Tris-HCl buffer solutions.
S6：Concentrated product quick-frozen rear freeze-drying in -80 DEG C of refrigerators, the restructuring AaIT albumen for obtaining final product high-purity is freezed
Powder.
It should be noted that the purifying protein that step S5 is eluted carries out SDS-PAGE analyses, as a result such as Fig. 4 institutes
Show, Fig. 4 is the SDS-PAGE testing results of the eluting AaIT albumen for obtaining of imidazoles of various concentrations in the embodiment of the present invention
Figure.From the results, it was seen that a large amount of foreign proteins can be removed first with the rinsing liquid of 40mM imidazoles, recycling 100mM,
The target protein of high-purity can be afforded during the buffer solution elution chromatographic column of 200mM and 400mM imidazoles.Eluent is utilized
The bag filter of molecular weight 3kDa utilizes the 15mL super filter tubes of molecular cut off 3kDa after being dialysed in 10mM Tris-HCl buffer solutions
By 20 times of sample concentration.The purifying protein of 20 micrograms, SDS-PAGE testing results are taken as shown in figure 5, only having albumen in target position
Band, illustrates to have obtained the AaIT recombinant proteins of High Purity.
Comparative example
It is artificial synthesized and optimize scorpion neurotoxin AaIT n DNAs, in 5 '-end addition Metarhizium anisopliae base of the gene
Because of MCL1, and it is cloned into the Sma I restriction enzyme sites of pBarPc and obtains plasmid pMcl 1prAaIT, after SwaI digestions, linearisation
Metarhizium anisopliae strains A RSEF 549 is carried out using the method for fungal protoplasts to convert, screening obtains turning for inheritance stability
Beggar AaIT-549, transformant AaIT-549 are expressed in insect blood cultured in vitro, and purifying obtains AaIT albumen.
The expression quantity of the technical scheme destination protein AaIT that the present embodiment is provided is significantly improved, and the supernatant of fermentation is collected from S3
Liquid, purifies, the nearly 50mg of AaIT albumen that can be with purity more than 95% from the induction broth of 1L by step S4 and S5, and
In comparative example, the albumen 2.4mg that purity is 50% can be only obtained from the nutrient solution of 1L, and comparative example needs to utilize insect
Blood cultured in vitro, production cost is high.
Comparative example purifying is obtained into AaIT albumen (A groups), embodiment two is obtained AaIT albumen (B groups) before purification and real
Apply example three carries out analysis of biological activity by the AaIT albumen (C groups) after purification that purification step S4 and S5 are obtained, specific point
Analysis method and result are as follows.
Experimental technique：Insect cell SF9 is cultivated to 90% growth in insect cell medium in 10cm culture dishes
Density, pancreatin digests and adjusts to 5 × 10 cell concentration5Cell/mL, 100 μ l are added to every hole in 96 porocyte culture plates
Insect SF9 cell suspensions, after overnight incubation, the AaIT albumen of A, B or C group of different final concentrations is separately added into each culture hole
(0,1,5,10,20ng/ml), 3 parallel holes of each concentration, by above-mentioned cell under standard conditions cultivate 48 hours, microscope
The lower cell that determines grows into condition,.
It is same that HF NIH/3T3 cells are cultivated to 90% with the DMEM culture mediums containing 10% calf serum
Stand density, pancreatin digests and adjusts to 5 × 10 cell concentration5Cell/mL, adds in 96 porocyte culture plates per hole
The NIH/3T3 cell suspensions of 100 μ l, after overnight incubation, each culture hole is separately added into the AaIT eggs of different final concentration A, B or C groups
In vain (0,1,5,10,20ng/ml), 3 parallel holes of each concentration, by above-mentioned cell under standard conditions cultivate 48 hours, it is micro-
Cell is determined under mirror grows into condition.
Experimental result：Fig. 6 illustrates for the BA result of the restructuring AaIT albumen after optimizing in the embodiment of the present invention
Figure.As shown in fig. 6, the restructuring AaIT albumen of 1ng/ml can just suppress the growth of insect cell SF9, when concentration reaches 20ng/ml
When cell mortality, and in test scope, toxin does not show toxicity to NIH/3T3 cells, and concrete outcome is as follows
Shown in table 2.Cell-proliferation activity measurement result shows that AaIT recombinant proteins prepared by the method applied in the present invention have very high
BA, and keep poisoning the selectivity of insect, and the AaIT protein actives prepared in comparative example are relatively low.
The AaIT biological activity of albumen analysis results of table 2A, B and C group
In the description of this specification, reference term " one embodiment ", " some embodiments ", " example ", " specifically show
The description of example " or " some examples " etc. means to combine specific features, structure, material or spy that the embodiment or example are described
Point is contained at least one embodiment of the invention or example.In this manual, to the schematic representation of above-mentioned term not
Identical embodiment or example must be directed to.And, the specific features of description, structure, material or feature can be with office
Combined in an appropriate manner in one or more embodiments or example.Additionally, in the case of not conflicting, the skill of this area
Art personnel can be tied the feature of the different embodiments or example described in this specification and different embodiments or example
Close and combine.
Although embodiments of the invention have been shown and described above, it is to be understood that above-described embodiment is example
Property, it is impossible to limitation of the present invention is interpreted as, one of ordinary skill in the art within the scope of the invention can be to above-mentioned
Embodiment is changed, changes, replacing and modification, and the essence of appropriate technical solution is departed from various embodiments of the present invention skill
The scope of art scheme, it all should cover in the middle of the scope of claim of the invention and specification.
Claims (10)
1. a kind of gene, is any one DNA molecular in following (1)-(3)：
(1) DNA molecular as shown in sequence in sequence table 1；
(2) DNA points of the albumen of DNA sequence dna hybridization and coding with poisoning insect active for being limited with (1) under strict conditions
Son；
(3) with (1) limit DNA sequence dna at least have 90%, at least have 95%, at least have 96%, at least have 97%,
At least have 98% or at least there is 99% homology and the DNA molecular of albumen of the coding with poisoning insect active.
2. the albumen that DNA molecular coding according to claim 1 is obtained.
3. albumen according to claim 2, it is characterised in that：It is following (1) or (2)：
(1) protein that the amino acid sequence shown in sequence in sequence table 2 is constituted；
(2) substitution by the amino acid sequence shown in sequence in sequence table 2 by one or several amino acid residues and/or missing
And/or addition and with poisoning insect active the protein as derived from sequence 2.
4. recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing gene described in claim 1；
The recombinant vector be specially by described in claim 1 gene insertion expression vector in, obtain expression claim 2 or
The recombinant vector of albumen described in 3, the recombinant vector is particularly preferred as the Xho of said gene insertion expression vector pPICZ α A
Between I and Xba I restriction enzyme sites, obtain expressing the recombinant vector of above-mentioned albumen.
5. the method that the gene described in a kind of utilization claim 1 prepares albumen, comprises the following steps：
S1：Gene described in claim 1 and expression vector pPICZ α with Xho I and Xba I double digestions and are purified back respectively
Receive, then obtain recombinant vector pPICZ α A-AaIT in 16 DEG C of connections using ligase；
S2：The recombinant vector pPICZ α A-AaIT are linearized with Sac I single endonuclease digestions, and is transformed into lithium chloride conversion method complete
In red yeast host bacterium, then positive colony is obtained by Zeocin screenings；
S3：The positive colony is forwarded to the YPD flat boards containing 1500~2000 μ g/mL Zeocin, screening obtains height
The transformant of Zeocin resistances, by the resistance transformant BMGY medium cultures to OD600It is 10~15, is collected by centrifugation
Cell precipitation, with BMMY culture medium re-suspended cells, adds methyl alcohol and makes its mass fraction be 1.0%~1.5%, induces 72 hours
Collect the supernatant of fermentation.
6. the method for preparing albumen according to claim 5, it is characterised in that：Step S3 induction 24 hours afterwards and
Before collecting the supernatant of fermentation, also comprise the following steps：
S31：Continue Fiber differentiation 72 hours at 28 DEG C, add within every 24 hours methyl alcohol make its mass fraction be maintained at 1.0%~
1.5%.
7. the method for preparing albumen according to claim 5 or 6, it is characterised in that：After step s 3, also including as follows
Step：
S4：The supernatant is adjusted into pH to 7.5~8.5 using Tris alkali, with the rotating speed centrifugation 10 more than or equal to 15000g
~20 minutes, the supernatant of acquisition is added in the nickel affinity chromatographic column after being balanced through pH 8Tris-HCl buffer solutions, with 2~
The buffer solution of 4 times of Tris-HCl containing 10mM and 30mM~50mM imidazoles of the pH 8 of chromatography column volume rinses the nickel affinity layer
Analysis post；
S5：With nickel affinity chromatographic column described in the buffer solution elution of Tris-HCl containing 10mM and 100mM~400mM imidazoles, will obtain
Eluent using molecular weight for the bag filter of 3kDa is dialysed in 10mM Tris-HCl buffer solutions, be then concentrated by ultrafiltration.
8. the method for preparing albumen according to claim 7, it is characterised in that：After step s 5, also including following step
Suddenly：
S6：The product that the ultrafiltration concentration is obtained is quick-frozen at -80 DEG C, then freeze-drying.
9. the albumen that the method for preparing albumen according to claim any one of 5-8 is prepared.
10. albumen, gene described in claim 1 described in claim 2,3 or 9 or recombinant vector, expression described in claim 4
The application of box, transgenic cell line or recombinant bacterium in pest-resistant field.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611180127.1A CN106754942A (en) | 2016-12-19 | 2016-12-19 | The preparation method of scorpion neurotoxin AaIT recombinations and its albumen and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611180127.1A CN106754942A (en) | 2016-12-19 | 2016-12-19 | The preparation method of scorpion neurotoxin AaIT recombinations and its albumen and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106754942A true CN106754942A (en) | 2017-05-31 |
Family
ID=58890767
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611180127.1A Pending CN106754942A (en) | 2016-12-19 | 2016-12-19 | The preparation method of scorpion neurotoxin AaIT recombinations and its albumen and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106754942A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108192904A (en) * | 2018-01-29 | 2018-06-22 | 怀化学院 | One kind wears film fluorescin and its encoding gene and application |
| CN108264543A (en) * | 2018-01-29 | 2018-07-10 | 怀化学院 | A kind of ribosomal toxin and its encoding gene and application |
| CN110592120A (en) * | 2019-10-22 | 2019-12-20 | 怀化学院 | Cellulose exonuclease artificial synthetic gene and its protein and recombinant vector |
| CN110643620A (en) * | 2019-10-22 | 2020-01-03 | 怀化学院 | High-activity poria cocos cellulose endonuclease gene and protein and recombinant vector thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1597951A (en) * | 2004-09-22 | 2005-03-23 | 山西大学 | Artificial synthesised scorpion chloride ion neurotoxin gene-rBmK CTa |
| CN101307313A (en) * | 2007-05-18 | 2008-11-19 | 中国科学院上海生命科学研究院 | Disinsection fungal engineering strain inverted from scorpion toxin gene and applications |
| CN104004100A (en) * | 2014-06-13 | 2014-08-27 | 山西农业大学 | Pig antimicrobial peptide NK-lysin fusion protein and encoding gene and application thereof |
-
2016
- 2016-12-19 CN CN201611180127.1A patent/CN106754942A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1597951A (en) * | 2004-09-22 | 2005-03-23 | 山西大学 | Artificial synthesised scorpion chloride ion neurotoxin gene-rBmK CTa |
| CN101307313A (en) * | 2007-05-18 | 2008-11-19 | 中国科学院上海生命科学研究院 | Disinsection fungal engineering strain inverted from scorpion toxin gene and applications |
| CN104004100A (en) * | 2014-06-13 | 2014-08-27 | 山西农业大学 | Pig antimicrobial peptide NK-lysin fusion protein and encoding gene and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| (英)哈伍德（HARWOOD,A.J.）: "《DNA及RNA基本实验技术》", 30 June 2002, 科学出版社 * |
| 李洪波: "昆虫神经毒素的表达、抗体制备、活性分析及应用研究", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
| 王二文等: "蝎神经毒素AaIT的表达及功能分析", 《武汉大学学报（理学版）》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108192904A (en) * | 2018-01-29 | 2018-06-22 | 怀化学院 | One kind wears film fluorescin and its encoding gene and application |
| CN108264543A (en) * | 2018-01-29 | 2018-07-10 | 怀化学院 | A kind of ribosomal toxin and its encoding gene and application |
| CN108264543B (en) * | 2018-01-29 | 2019-10-08 | 怀化学院 | A kind of ribosomal toxin and its encoding gene and application |
| CN108192904B (en) * | 2018-01-29 | 2019-10-08 | 怀化学院 | One kind wearing film fluorescin and its encoding gene and application |
| CN110592120A (en) * | 2019-10-22 | 2019-12-20 | 怀化学院 | Cellulose exonuclease artificial synthetic gene and its protein and recombinant vector |
| CN110643620A (en) * | 2019-10-22 | 2020-01-03 | 怀化学院 | High-activity poria cocos cellulose endonuclease gene and protein and recombinant vector thereof |
| CN110592120B (en) * | 2019-10-22 | 2021-07-30 | 怀化学院 | Cellulose exonuclease artificial synthetic gene and its protein and recombinant vector |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106754942A (en) | The preparation method of scorpion neurotoxin AaIT recombinations and its albumen and application | |
| CN107299105B (en) | Pathogenic FonACL 3 gene of watermelon wilt pathogen, deletion DNA fragment and deletion mutant thereof and application thereof | |
| CN116768990B (en) | Artificial intelligence auxiliary generated insecticidal protein | |
| CN101255438A (en) | Construction method of transgenic chlamydomonas reinhardtii for expressing human tissue kallikrein | |
| FANG et al. | Research advances in Fusarium root rot of alfalfa (Medicago sativa) | |
| CN107236755A (en) | Method of cecropin AD and preparation method thereof is expressed using bacillus subtilis | |
| CA1077870A (en) | Process for the production of insulin by genetically transformed fungal cells | |
| CN103898153A (en) | Multi-copy metallothionein recombinant expression vector and method thereof for high-efficiency expression of metallothionein | |
| CN106701774B (en) | Preparation method of recombinant scorpion neurotoxin LqhIT2 protein | |
| Souza et al. | First report on the natural occurrence of entomopathogenic fungi in populations of the leafhopper Dalbulus maidis (Hemiptera: Cicadellidae): Pathogen identifications and their incidence in maize crops | |
| CN105063138A (en) | Method for producing trametes versicolor immunomodulatory protein by virtue of pichia pastoris expression system | |
| CN108192904B (en) | One kind wearing film fluorescin and its encoding gene and application | |
| CN115197305A (en) | Bt protein Cry53A and gene and application thereof | |
| CN109392702A (en) | A kind of method of the normal wild rice stem of artificially breeding | |
| CN106591317A (en) | Preparation method of scorpion neurotoxin Bj alpha IT gene and recombinant protein thereof | |
| CN106754943A (en) | A kind of preparation method of spider neurotoxins TX4 (6 1) recombinant protein | |
| CN107400671A (en) | Pear fruit saccharide transporter gene PbTMT4 and its application | |
| CN104744575B (en) | Bt protein with insecticidal activity on oriental armyworms and application thereof | |
| CN116555320A (en) | Recombinant human-derived III-type triple helix collagen engineering bacterium, and construction method and application thereof | |
| CN101033465A (en) | Pea albumin subunit PA1b recombination albumen and its preparing method and application | |
| CN108218966B (en) | A kind of artificial reconstructed HtA albumen and its encoding gene and application | |
| CN108264543B (en) | A kind of ribosomal toxin and its encoding gene and application | |
| CN109593769A (en) | Wild rice brand spores form related gene Itd1 and its application | |
| CN109370922A (en) | A pair of wild rice smut for successfully realizing the normal hay artificially breeding of wild rice stem and its application | |
| CN102010867A (en) | Yeast expression method for recombining major protein AccMRJP1 of apis cerana royal jelly and product application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170531 |