CN105063138A - Method for producing trametes versicolor immunomodulatory protein by virtue of pichia pastoris expression system - Google Patents

Abstract

The invention relates to a method for producing a trametes versicolor immunomodulatory protein by virtue of a pichia pastoris expression system. Problems about the preparation of trametes versicolor immunomodulatory proteins are effectively solved. The method comprises the following steps of synthesizing a nucleotide sequence SEQ ID NO.1 of a trametes versicolor immunomodulatory protein FIP-tvc according to a codon usage bias of pichia pastoris; constructing a recombinant expression plasmid X-FIP-tvc by virtue of the trametes versicolor immunomodulatory protein FIP-tvc synthesized by restriction enzyme digestion and an expression plasmid vector X, linearizing the recombinant expression plasmid X-FIP-tvc by virtue of a restriction enzyme, then transforming a competent cell of pichia pastoris GS115, screening a constitutive positive transformant or inducible positive transformant by virtue of an antibiotic-containing plate and PCR (Polymerase Chain Reaction) method, selecting an inducible high-level rFIP-tvc secretion expression pichia pastoris recombinant strain, performing fermental cultivation or induction expression for 3 to 7 days, precipitating fermentation supernatant with ammonium sulfate, performing dialysis on precipitates for 24 to 48 hours, performing affinity exchange chromatography with a chromatographic column, and performing drying to obtain solid powder of the trametes versicolor immunomodulatory protein FIP-tvc. The method is low in cost, short in cycle, easy to implement technically, suitable for industrial production and high in purity.

Description

A kind of method utilizing pichia yeast expression system production rainbow conk immune modulator

Technical field

The present invention relates to biological medicine, particularly a kind of method utilizing pichia yeast expression system production rainbow conk immune modulator.

Background technology

Fungal immunomodulatory protein (fungalimmunomodulatoryproteins, FIPs) is a kind of novel bioactive small protein found from edible and medicinal fungi thalline.The discovery of this albumen, has broken the viewpoint that it is believed that " fungus polysaccharide is edible and medicinal fungi main effect activeconstituents " traditionally, has excited the interest that people find novel active composition from edible and medicinal fungi.8 kinds of fungal immunomodulatory proteins are obtained at present: LZ-8, FIP-fve, FIP-vvo, FIP-gts, FIP-gmi, FIP-gja, FIP-gsi and FIP-tvc, respectively from glossy ganoderma from edible and medicinal fungi gandermalucidum, Ganoderma tsugae g.tsugae, sporule glossy ganoderma g.microsporum, Japanese glossy ganoderma g.japnoicum, purple sesame g.sinense, needle mushroom flammulinavelutipes, straw mushroom volvariellavolvaceaand rainbow conk trametesversicolor, they constitute a new protein families.There is between FIPs member similar amino acid sequence and structure, be made up of 110-114 amino acid, there is higher homology, reach 60-100%, there are 47 amino acid completely the same, and have 4 place's conservative regions, there is direct relation with functionating, show the conservative property of fungal immunomodulatory protein on molecular evolution.

Similar immunologic function is had between the fungal immunomodulatory protein of different sources, such as can aggegation red corpuscle, promote lymphopoiesis, suppress the multiple anaphylaxis of body, reduce antibody to produce, reduce the rejection of mouse insole oedema and transplanted tissue, and promote T lymphocytic emiocytosis cytokine profiles (interleukin-2, tumor necrosis factor-alpha and interferon-γ etc.).In addition, fungal immunomodulatory protein has anti-tumor activity, has Developing restraint or direct killing effect, and have no side effect to kinds of tumor cells such as lung cancer, liver cancer, cancer of the stomach.Therefore fungal immunomodulatory protein a kind ofly has the protein being developed to immunoregulation druge potentiality, may be used for the treatment of tumour and disease of immune system.

Rainbow conk immune modulator FIP-tvc be from Chinese traditional drugs fungi rainbow conk ( t.versicolor) a kind of fungal immunomodulatory protein of finding.FIP-tvc is made up of 111 amino-acid residues, and molecular weight is 12440Da, iso-electric point pi is 4.81, not containing Histidine, halfcystine and methionine(Met) (Lietal.2012, ProExpPurif, 82:339-344).FIP-tvc can aggegation red corpuscle; Be a kind of mitogen, there is the effect promoting mice spleen lymphocytes proliferation; The cytokines such as interleukin I L-2, Interferon, rabbit IFN-γ, tumor necrosis factor TNF-alpha can be secreted by induction of lymphocyte; There is the biological activity suppressing the growth of tumour cell such as lung cancer, liver cancer simultaneously.Therefore, FIP-tvc is a kind of medical protein of great exploitation potential for its.

The productive rate extracting natural immunity Function protein from manyzoned polypore sporophore is very low, be about 3mg/kg dry weight, therefore FIP-tvc gene is transferred in corresponding host to express and obtains a large amount of recombinant protein by using gene engineering, thus to develop and apply be very valuable and prospect.Li etc. (2012, ProExpPurif, 82:339-344) report recombinant expressed in e. coli bl21 (DE3) of FIP-tvc, but only have the soluble recombinant protein of 20%, and major part exists with the form of inclusion body.Although prokaryotic organism bacterial expression has simple and quick feature, owing to forming a large amount of inclusion bodys to target protein, and the senior modification imperfection of protein, biologic activity are unsuitable for large-scale industrial production lower than shortcomings such as native proteins.

Pichia yeast expression system is the most successful efficient expression system up to now, and its genetic background is relatively clear, the heredity of foreign gene Absorbable organic halogens, and express output high, cost is low, is particularly suitable for expressing small molecule active albumen.In addition, as eukaryotic expression system, pichia spp has the posttranslational modification function of other animal and plant cellss similar, as protein folding, glycosylation and phosphorylation etc.Because pichia yeast expression system has the advantage of protokaryon and eukaryotic expression system concurrently, increasingly extensive application is obtained in genetically engineered field, consider the feature of rainbow conk immune modulator FIP-tvc and the deficiency of other expression systems simultaneously, can as a kind of desirable selection and approach with this system expression rainbow conk immune modulator FIP-tvc.But yet there are no rainbow conk immune modulator FIP-tvc successful expression in pichia spp so far and carry out mass-produced report.

Summary of the invention

For above-mentioned situation, for overcoming the defect of prior art, the object of the present invention is just to provide a kind of method utilizing pichia yeast expression system production rainbow conk immune modulator, effectively can solve the preparation problem of rainbow conk immune modulator.

The technical scheme that the present invention solves comprises the following steps:

(1) according to the nucleotide sequence SEQIDNO.1 of pichia spp codon preference synthesis rainbow conk immune modulator FIP-tvc gene;

Described pichia spp is pichia spp mycetocyte GS115;

(2) utilize rainbow conk immune modulator FIP-tvc and the expression plasmid carrier X of synthesis in digestion with restriction enzyme step (1), build recombinant expression plasmid X-FIP-tvc, method is, by the gene order of synthesis fIP-tvcwith plasmid vector xutilize restriction enzyme to carry out enzyme to cut, reclaim object fragment, utilize T4DNA ligase enzyme to incite somebody to action fIP-tvcendonuclease bamhi and plasmid vector xendonuclease bamhi connects, and obtains recombinant expression plasmid x-FIP-tvc, be transformed in bacillus coli DH 5 alpha and increase;

Described expression plasmid carrier X is constitutive expression plasmid vector pGAPZ α A or inducible expression plasmid carrier pPICZ α A;

(3) transform Pichia pastoris GS115 competent cell after utilizing restriction enzyme to carry out linearizing to recombinant expression plasmid carrier X-FIP-tvc, application filters out composing type positive transformant or induction type positive transformant containing antibiotic flat board and PCR method;

(4) the fermentation screening of recombinant protein rFIP-tvc Pichi strain is expressed: ferment after the composing type positive transformant that filters out cultivates 3-5d YPD liquid nutrient medium from step (3), fermented supernatant fluid detects protein expression amount with SDS-PAGE, filters out the pichia spp recombinant bacterial strain of constitutive and secretive expression rFIP-tvc; Or BMSY substratum, cultivate 2-4d from the induction type positive transformant that step (3) filters out, bacterium liquid adds the abduction delivering that methyl alcohol carries out recombinant protein, induction 3-7d, fermented supernatant fluid detects protein expression amount with SDS-PAGE, filters out the pichia spp recombinant bacterial strain of induction type high-level secretory expression rFIP-tvc;

(5) separation and purification rainbow conk immune modulator FIP-tvc in pichia spp recombinant bacterial strain fermented supernatant fluid, the pichia spp recombinant bacterial strain of rFIP-tvc step (4) filtered out carries out fermentation culture or abduction delivering 3-7d, fermented supernatant fluid ammonium sulfate precipitates, precipitation level pad carries out dissolving and carries out dialysis 24-48h with level pad, Ni-NTA chromatography column after level pad dialysis on protein sample after dialysis is carried out affine displacement chromatography, obtain the recombinant protein rFIP-tvc of purifying, rainbow conk immune modulator FIP-tvc pressed powder is obtained with the method such as vacuum lyophilization or spraying dry.

Cost of the present invention is low, the cycle is short, technically easily, be suitable for suitability for industrialized production, purity is high.

Accompanying drawing explanation

Fig. 1 is the schematic diagram of the expression restructuring rainbow conk immune modulator rFIP-tvc composing type plasmid expression vector pGAPZ α A-FIP-tvc that the present invention builds.

Fig. 2 is the schematic diagram of the expression restructuring rainbow conk immune modulator rFIP-tvc inducible plasmid expression vector pPICZ α A-FIP-tvc that the present invention builds.

Embodiment

Below in conjunction with accompanying drawing and particular case, the specific embodiment of the present invention is elaborated.

The present invention, in concrete enforcement, comprises the following steps:

(1) open in " Lietal.2012, ProExpPurif, 82:339-344 " according to the nucleotide sequence SEQIDNO.1(of pichia spp codon preference synthesis rainbow conk immune modulator FIP-tvc gene);

Described pichia spp is pichia spp mycetocyte GS115(commercially available prod, the bacterial strain as ACCC Chinese agriculture Microbiological Culture Collection administrative center, ISF China Agriculture Academe Fertilizer Institute or the preservation of CGMCC General Microbiological Culture preservation administrative center);

(2) utilize rainbow conk immune modulator FIP-tvc and the expression plasmid carrier X of synthesis in digestion with restriction enzyme step (1), build recombinant expression plasmid X-FIP-tvc, method is, by the gene order of synthesis fIP-tvcwith plasmid vector xutilize restriction enzyme to carry out enzyme to cut, reclaim object fragment, utilize T4DNA ligase enzyme to incite somebody to action fIP-tvcendonuclease bamhi and plasmid vector xendonuclease bamhi connects, and obtains recombinant expression plasmid x-FIP-tvc, be transformed in bacillus coli DH 5 alpha and increase;

Described expression plasmid carrier X is constitutive expression plasmid vector pGAPZ α A or inducible expression plasmid carrier pPICZ α A;

(3) transform Pichia pastoris GS115 competent cell after utilizing restriction enzyme to carry out linearizing to recombinant expression plasmid carrier X-FIP-tvc, application filters out composing type positive transformant or induction type positive transformant containing antibiotic flat board and PCR method;

(4) the fermentation screening of recombinant protein rFIP-tvc Pichi strain is expressed: ferment after the composing type positive transformant that filters out cultivates 3-5d YPD liquid nutrient medium from step (3), fermented supernatant fluid detects protein expression amount with SDS-PAGE, filters out the pichia spp recombinant bacterial strain of constitutive and secretive expression rFIP-tvc; Or BMSY substratum, cultivate 2-4d from the induction type positive transformant that step (3) filters out, bacterium liquid adds the abduction delivering that methyl alcohol carries out recombinant protein, induction 3-7d, fermented supernatant fluid detects protein expression amount with SDS-PAGE, filters out the pichia spp recombinant bacterial strain of induction type high-level secretory expression rFIP-tvc;

(5) separation and purification rainbow conk immune modulator FIP-tvc in pichia spp recombinant bacterial strain fermented supernatant fluid, the pichia spp recombinant bacterial strain of rFIP-tvc step (4) filtered out carries out fermentation culture or abduction delivering 3-7d, fermented supernatant fluid ammonium sulfate precipitates, precipitation level pad carries out dissolving and carries out dialysis 24-48h with level pad, Ni-NTA chromatography column after level pad dialysis on protein sample after dialysis is carried out affine displacement chromatography, obtain the recombinant protein rFIP-tvc of purifying, rainbow conk immune modulator FIP-tvc pressed powder is obtained with the method such as vacuum lyophilization or spraying dry.

Described in step (1) according to the nucleotide sequence of pichia spp codon preference synthesis rainbow conk immune modulator FIP-tvc gene be, on the basis not changing rainbow conk immune modulator FIP-tvc aminoacid sequence, according to pichia spp Preference codon FIP-tvc complete genome sequence be optimized and synthesize, existing simultaneously fIP-tvc5' end and 3 ' end introduce restriction enzyme site, and before the terminator codon of 3' end, add protein tag sequence facilitate follow-up protein purification, protein tag is the one of eGFP, His, Flag, gsh.

Structure recombinant expression plasmid carrier pGAPZ α A-FIP-tvc described in step (2) or pPICZ α A-FIP-tvc, method is, by the gene order of synthesis and plasmid vector xutilize restriction enzyme to carry out two enzyme enzyme to cut, reclaim object fragment, utilize T4DNA ligase enzyme to incite somebody to action fIP-tvcendonuclease bamhi and plasmid xendonuclease bamhi connects, and obtains recombinant expression plasmid x-FIP-tvc, be transformed in bacillus coli DH 5 alpha and increase;

It is utilize restriction enzyme E that described two enzyme enzymes are cut cor I and X bai by the rainbow conk immune adjustment protein gene of synthesis in step (1) fIP-tvccarry out two enzyme enzyme with constitutive expression plasmid vector pGAPZ α A or inducible expression plasmid carrier pPICZ α A to cut, gel electrophoresis reclaims target DNA fragments after being separated, then utilize T4DNA ligase enzyme to carry out 16 DEG C of connections to DNA fragmentation to spend the night, 42 DEG C of thermal shock transformation of E. coli DH5 α competent cells, coating is containing the LB culture medium flat plate of 25 μ g/mLZeocin, overnight incubation at being placed in 37 DEG C, random picking mono-clonal, extracting recombinant expression plasmid pGAPZ α A-FIP-tvc or pPICZ α A-FIP-tvc, qualification positive colony is cut by two enzyme enzyme, LB substratum is by 5g yeast extract, 10g peptone, 5g sodium-chlor, adjust ph is to 7.2-7.4, add water to 1000mL to make.

Conversion Pichia pastoris GS115 competent cell described in step (3), method is, adopts electroporated or chemical conversion, and electroporated is utilize restriction enzyme to the recombinant plasmid built x-FIP-tvccarry out linearization for enzyme restriction, the electroporated Pichi strain competent cell of electricity consumption conversion instrument; Chemical conversion utilizes plate screening positive transformant, obtaining positive transformant or obtain auxotroph or genotype transformant by MM flat board, MD plate screening containing corresponding antibiotic YPD plate screening;

Described YPD flat board be by: 10g yeast powder, 20g peptone, 20gD-glucose, agar 15g, add water to 1000mL and make;

Described MM flat board be by: 13.4g, without amino acid yeast nitrogen (YNB), 4 × 10-4g vitamin H, 5mL methyl alcohol, agar 15.0g, adds water to 1000mL and makes;

Described MD flat board be by: 13.4g, without amino acid yeast nitrogen (YNB), 4 × 10-4g vitamin H, 20gD-glucose, agar 15g, adds water to 1000mL and makes.

Described in step (3) to carry out linearizing to recombinant expression plasmid carrier X-FIP-tvc be utilize restriction enzyme A vriI enzyme cuts composing type recombinant expression plasmid pGAPZ α A-FIP-tvc, or restriction enzyme S aci enzyme is cut induction type recombinant expression plasmid pPICZ α A-FIP-tvc and is carried out linearizing, get 5-20 μ g plasmid respectively and carry out electroporated Pichia pastoris GS115 competent cell, the parameter of GenePulseXcell electricity conversion instrument (Bio-RadlaboratoriesInc.) used is: voltage 1.8kV, electric capacity 25 μ F, resistance 200 Ω, discharge time 4.8-5.2ms, the 1.0M sorbyl alcohol that 1.0mL is ice-cold is added immediately after electric shock, after 30 DEG C of shaking culture 1-2h, coating is dull and stereotyped containing the YPD of 100 μ g/mLZeocin, transformant is grown after being placed in 28-30 DEG C of cultivation 2-4d, transformant to be inoculated at being placed in 28-30 DEG C in the YPD liquid nutrient medium containing 100 μ g/mLZeocin after 200rpm shaking culture 3d, the centrifugal 5min of 8000rpm, collect thalline, extract the genomic dna of transformant, with the genomic dna obtained for template carries out pcr amplification, the primer presses the sequences Design of yeast expression vector, upstream universal primer α-factor is 5 '-TACTATTGCCAGCATTGCTGC-3 ', and downstream universal primer 3 '-AOX1 is 5 '-GCAAATGGCATTCTGACATCC-3 ', PCR reaction system adopts 25 μ L:10 × PCRbuffer2.5 μ L, dNTP2.0 μ L, each 1.0 μ L of upstream and downstream primer, template DNA 2.0 μ L, rTaq enzyme 0.3 μ L, supplements ddH ₂o to 25.0 μ L.Pcr amplification condition is 94 DEG C of denaturation 5min, then enters circulation 94 DEG C of 40s, 54 DEG C of 30s, 72 DEG C of 60s, carry out 30 circulations, and last 72 DEG C finally extend 10min, amplified production 1.2% agarose electrophoresis observations, what occur target stripe is positive transformant.

The pichia spp recombinant bacterial strain of constitutive and secretive expression rFIP-tvc that screening described in step (4) obtains or the pichia spp recombinant bacterial strain of induction type secreting, expressing rFIP-tvc, wherein the pichia spp recombinant bacterial strain YPD substratum of constitutive and secretive expression rFIP-tvc is cultivated; The pichia spp recombinant bacterial strain of described induction type secreting, expressing rFIP-tvc is inoculated in substratum at dull and stereotyped picking transformant, by shake flask fermentation abduction delivering, obtains the Pichi strain that hypersecretion expresses FIP-tvc.Wherein: described substratum comprises BMGY/BMMY, BMG/BMM, YPG; Wherein preferred BMGY/BMMY and YPG substratum;

Described BMGY substratum is: 10g yeast powder, 20g peptone, 100mM phosphoric acid buffer (pH6.0), 13.4g are without amino acid yeast nitrogen (YNB), 4 × 10 ^-4g vitamin H, 10mL glycerine, add water to 1000mL and make:

Described BMMY substratum is: 10g yeast powder, 20g peptone, 100mM phosphoric acid buffer (pH6.0), 13.4g are without amino acid yeast nitrogen (YNB), 4 × 10 ^-4g vitamin H, 5mL methyl alcohol, add water to 1000mL and make:

Described BMG substratum is: 100mM phosphoric acid buffer (pH6.0), 13.4g are without amino acid yeast nitrogen (YNB), 4 × 10 ^-4g vitamin H, 10mL glycerine, add water to 1000mL and make:

Described BMM substratum is: 100mM phosphoric acid buffer (pH6.0), 13.4g are without amino acid yeast nitrogen (YNB), 4 × 10 ^-4g vitamin H, 5mL methyl alcohol, add water to 1000mL and make:

Described YPG substratum is: 10g yeast powder, 20g peptone, 10mL glycerine, add water to 1000mL and make.

The restructuring of separation and purification from fermentation culture rainbow conk immune modulator rFIP-tvc described in step (5) is: after the Pichi strain fermentation culture of the high level expression recombinant protein of acquisition, fermentation liquor is centrifugal obtains supernatant liquor, use ammonium sulfate precipitated protein matter, protein precipitation is obtained after centrifugal, dialysis 24-48h is carried out with identical damping fluid after sediment fraction level pad dissolves again, change dialyzate therebetween more than 3 times, the Ni-NTA chromatography column with His label is selected according to the recombinant protein of expressing, first protein crude extract is gone up Ni-NTA chromatography column, the albumen that not can be incorporated on post is washed away with level pad, then wash-out is carried out with different pH value or the level pad containing different salt ionic concentration respectively, collect elutriant, the purification effect of using polypropylene acrylamide gel electrophoresis (SDS-PAGE) electrophoresis detection albumen, adopt the method for dialysis or the mode desalination with desalting column wash-out, vacuum lyophilization or spraying dry, obtain the solid rFIP-tvc powder after purifying.

The pichia spp recombinant bacterial strain with hypersecretion expression rFIP-tvc is carried out fermentation culture or abduction delivering 3-7d, at 8000rpm, 4 DEG C to the centrifugal 5min of fermented liquid, collect supernatant liquor, precipitates overnight is carried out with 80% ammonium sulfate, then to abandon supernatant liquor after 20000rpm, 4 DEG C of centrifugal 30min, precipitation level pad dissolves, and with level pad, the dialysis membrane of molecular weight cut-off 3.5kD carries out dialysis equilibrium 24-48h;

Described level pad is: 300mM sodium-chlor, 50mM SODIUM PHOSPHATE, MONOBASIC, 10mM imidazoles, 10mMTris-HCl, pH8.0;

With equilibration buffer Ni-NTA chromatography column 10 column volumes, by the protein sample upper prop after above-mentioned dialysis equilibrium, carry out affine displacement chromatography, after sample upper prop, continue with Equilibration buffer wash 20 column volumes, then gradient stepwise elution is carried out with the level pad containing 100,200,400 and 1000mM imidazole concentration respectively, collect elutriant, namely the recombinant protein rFIP-tvc after purifying is obtained, with dialysis or the mode desalination with desalting column wash-out, vacuum lyophilization or spraying dry, obtain the rFIP-tvc powder of solid.

As can be seen from above-mentioned, the present invention includes two portions: the structure of rainbow conk immune modulator FIP-tvc expression system and the separation and purification of restructuring rainbow conk immune modulator rFIP-tvc, specifically:

1, the structure of rainbow conk immune modulator FIP-tvc expression system

(1) according to the rainbow conk immune modulator FIP-tvc gene order that pichia spp Preference codon synthetic is optimized

According to pichia spp Preference codon, laggard row synthetic is optimized to rainbow conk immune modulator FIP-tvc complete genome sequence, and introduce E at 5 ' end of FIP-tvc gene cor I restriction enzyme site, introduces 6 Histidine (His) encoding genes before 3 ' end terminator codon, introduces X simultaneously after terminator codon bai restriction enzyme site.FIP-tvc gene order after optimization (synthetic gene sequence is completed by Beijing DingGuo ChangSheng Biology Technology Co., Ltd) as shown in SEQIDNo.1.

(2) composing type recombinant expression plasmid pGAPZ α A-FIP-tvc and induction type recombinant expression plasmid pPICZ α A-FIP-tvc is built

Utilize restriction enzyme E cor I and X bai by the rainbow conk immune adjustment protein gene of synthesis in step (1) fIP-tvccarry out two enzyme enzyme with constitutive expression plasmid vector pGAPZ α A or inducible expression plasmid carrier pPICZ α A to cut, gel electrophoresis reclaims target DNA fragments after being separated, then utilize T4DNA ligase enzyme to carry out 16 DEG C of connections to DNA fragmentation to spend the night, 42 DEG C of thermal shock transformation of E. coli DH5 α competent cells, coating LB culture medium flat plate (containing 25 μ g/mLZeocin), overnight incubation at being placed in 37 DEG C.Random picking mono-clonal, extracting recombinant expression plasmid pGAPZ α A-FIP-tvc or pPICZ α A-FIP-tvc, cuts qualification positive colony by two enzyme enzyme.Figure 1 shows that the restructuring rainbow conk immune modulator FIP-tvc constitutive expression plasmid vector pGAPZ α A-FIP-tvc schematic diagram of structure, Figure 2 shows that the restructuring rainbow conk immune modulator FIP-tvc inducible expression plasmid carrier pPICZ α A-FIP-tvc schematic diagram of structure;

The formula of above-mentioned LB substratum is: 5g yeast extract, 10g peptone, 5g sodium-chlor, adjust ph is to 7.2-7.4, and make up water is to 1000mL.

(3) Pichi strain transforms and screening

Utilize restriction enzyme A vriI enzyme cuts composing type recombinant expression plasmid pGAPZ α A-FIP-tvc, or restriction enzyme S aci enzyme is cut induction type recombinant expression plasmid pPICZ α A-FIP-tvc and is carried out linearizing, gets 5-20 μ g plasmid respectively and carries out electroporated Pichia pastoris GS115 competent cell.The parameter of GenePulseXcell used electricity conversion instrument (Bio-RadlaboratoriesInc.) is: voltage 1.8kV, electric capacity 25 μ F, resistance 200 Ω, discharge time 4.8-5.2ms.Add the 1.0M sorbyl alcohol that 1.0mL is ice-cold after electric shock immediately, after 30 DEG C of shaking culture 1-2h, be coated with YPD flat board (containing 100 μ g/mLZeocin), after being placed in 28-30 DEG C of cultivation 2-4d, grow transformant.Transformant to be inoculated at being placed in 28-30 DEG C in YPD liquid nutrient medium (containing 100 μ g/mLZeocin) after 200rpm shaking culture 3d, the centrifugal 5min of 8000rpm, collect thalline, extract the genomic dna of transformant, with the genomic dna obtained for template carries out pcr amplification, the primer presses the sequences Design of yeast expression vector, upstream universal primer α-factor is 5 '-TACTATTGCCAGCATTGCTGC-3 ', and downstream universal primer 3 '-AOX1 is 5 '-GCAAATGGCATTCTGACATCC-3 '.PCR reaction system adopts 25 μ L:10 × PCRbuffer2.5 μ L, dNTP2.0 μ L, each 1.0 μ L of upstream and downstream primer, template DNA 2.0 μ L, rTaq enzyme 0.3 μ L, supplements ddH ₂o to 25.0 μ L.Pcr amplification condition is 94 DEG C of denaturation 5min, then enters circulation 94 DEG C of 40s, 54 DEG C of 30s, 72 DEG C of 60s, carries out 30 circulations, and last 72 DEG C finally extend 10min.Amplified production 1.2% agarose electrophoresis observations, what occur target stripe is positive transformant;

The formula of described YPD substratum is: 10g yeast extract, 20g peptone, 20gD-glucose, make up water are to 1000mL.

(4) screening of high-level secretory expression rFIP-tvc pichia spp recombinant bacterial strain

The screening method of composing type pichia spp recombinant bacterial strain: from positive transformant streak culture 2-3d on YPD flat board of the composing type plasmid that step (3) filters out, random picking mono-clonal is inoculated in YPD liquid nutrient medium, 28 DEG C, 200rpm cultivates 3-5d, the centrifugal 5min of 8000rpm, get supernatant liquor and detect protein expression amount with SDS-PAGE, each sample parallel two parts detects, and final screening obtains the pichia spp recombinant bacterial strain of high-level secretory expression rFIP-tvc.

Screened by above-mentioned shake flask fermentation, obtain and there is the Pichi strain pGAPZ α A-FIP-tvc/GS115 that hypersecretion expresses FIP-tvc.Through inspection, the rFIP-tvc of expression has native biological activity, and shake flask fermentation expression amount is not less than 200mg/L, tentatively reaches industrialization scale up test level, for the further expanding production of rFIP-tvc and Application and Development are laid a good foundation.

The screening method of evoked pichia pastoris recombinant bacterial strain: from positive transformant streak culture 2-3d on YPD flat board of the inducible plasmid that step (3) filters out, picking list colony inoculation is in the 5ml centrifuge tube containing 1mlBMSY, and 30 DEG C of 240rpm cultivate 2-4d.In bacterium liquid, every 24h adds methyl alcohol and makes final concentration be 0.5%, and cultivates at 30 DEG C of 240rpm.The centrifugal 5min of 8000rpm after induction 3-7d, collects supernatant liquor.Detect protein expression amount with SDS-PAGE, each sample parallel two parts detects, and final screening obtains the pichia spp recombinant bacterial strain of high-level secretory expression rFIP-tvc.

The formula of described BMSY liquid nutrient medium is: 10g yeast extract, 20g peptone, 10g sorbyl alcohol, 100mM potassium phosphate buffer (pH6.0), 13.4gYNB, 4 × 10 ^-4g vitamin H (after first three kind composition sterilizing, cool to room temperature adds rear three kinds of compositions again).

Screened by above-mentioned fermentation, obtain and there is the Pichi strain pPICZ α A-FIP-tvc/GS115 that hypersecretion expresses rFIP-tvc.Through inspection, the rFIP-tvc of expression has native biological activity, and shake flask fermentation expression of recombinant proteins amount reaches more than 200mg/L, tentatively reaches industrialization scale up test level, for the further production of rFIP-tvc and Application and Development are laid a good foundation.

, the separation and purification of restructuring rainbow conk immune modulator and purity check

(5) separation and purification rFIP-tvc from the fermented liquid of pichia spp high level recombinant strains

The pichia spp recombinant bacterial strain with hypersecretion expression rFIP-tvc step (4) screening obtained carries out fermentation culture or abduction delivering 3-7d, 8000rpm, 4 DEG C of centrifugal 5min are carried out to fermented liquid, collect supernatant liquor, carry out precipitates overnight, then with 20000 with 80% ammonium sulfate g×, abandon supernatant liquor after 4 DEG C of centrifugal 30min, precipitation level pad dissolves, and with level pad, the dialysis membrane of molecular weight cut-off 3.5kD carries out dialysis equilibrium 24-48h, for subsequent use;

The formula of described level pad is: 300mM sodium-chlor, 50mM SODIUM PHOSPHATE, MONOBASIC, 10mM imidazoles, 10mMTris-HCl, pH8.0;

With equilibration buffer Ni-NTA chromatography column 10 column volumes, by the protein sample upper prop after above-mentioned dialysis equilibrium, carry out affine displacement chromatography.After sample upper prop, continue with Equilibration buffer wash 20 column volumes, then gradient stepwise elution is carried out with the level pad containing 100mM, 200mM, 400mM and 1000mM imidazole concentration respectively, collect elutriant, namely obtain the recombinant protein rFIP-tvc after purifying, detect the effect of protein purification with SDS-PAGE;

RFIP-tvc solution after purifying can adopt dialysis or the mode desalination with desalting column wash-out, carries out vacuum lyophilization or spraying dry in conventional manner, the rFIP-tvc powder of obtained solid.

(6) purity check of restructuring rainbow conk immune modulator rFIP-tvc

The purity of the rainbow conk immune modulator rFIP-tvc prepared by inspection above-mentioned steps (5), adopt different methods to carry out the test experience of a step respectively, process is as follows:

(1) SDS-PAGE electrophoretic analysis: the pressed powder 1mg getting rFIP-tvc is dissolved in 1mL water, 10 μ L loadings are got after abundant dissolving, carry out SDS-PAGE electrophoresis, gel adopts coomassie brilliant blue R_250 dyeing, after scanning, identify that recombinant protein purity is more than 98%.

(2) HPLC methods analyst: the pressed powder 1mg getting rFIP-tvc is fully dissolved in 1mL water and carries out HPLC detection.Chromatographic instrument is Agilent, chromatographic column is Zorbax300SB-CN, with A phase (trifluoroacetic acid-aqueous solution: get 0.5mL trifluoroacetic acid and add water to 1000mL, abundant mixing), B phase (trifluoroacetic acid-acetonitrile solution: get 0.5mL trifluoroacetic acid and add acetonitrile to 1000mL, abundant mixing) be moving phase, carry out gradient elution (10-90%B phase) at ambient temperature, with 50 μ L samplers and hand sampling valve, sample introduction 20 μ L, analytic sample, utilizes retention time qualitative, by the quantitative target protein purity of peak area percent, as calculated, purity reaches more than 95%.

As can be seen from above-mentioned, the present invention has following significant advantage:

(1) to gene order fIP-tvcbe optimized according to pichia spp codon preference, make it be more suitable for expressing in pichia spp;

(2) rFIP-tvc shake flask fermentation expression amount can reach 200mg/L, reaches scale up test requirement, and is had the potentiality improved further by high density fermentation expression amount;

(3) recombinant protein of expressing, with special tag, is easy to the separation and purification carrying out recombinant protein;

(4) method utilizing pichia spp to produce rFIP-tvc has the advantages that cost is low, the cycle is short, technically easily realize, and is suitable for suitability for industrialized production;

(5) the rFIP-tvc purity high (being greater than more than 95%) in supernatant liquor after separation and purification is expressed by pichia spp recombinant bacterial strain, the preparation of protein formulation can be directly used in, be effective to suitability for industrialized production, meet the actual needs of rainbow conk immune modulator, economic and social benefit is huge.

sequence table

SEQUENCELISTING

<110> Henan Academy of Sciences Biological Research Institute Co., Ltd.

<120> mono-kind utilizes the method for pichia yeast expression system production rainbow conk immune modulator

<160>1

<210>1

<211>372

<212>DNA

<213> rainbow conk ( trametesversicolor)

<400>1

aagaattcatgtctgatactgctttgatcttcactttggcttggaacgttaagagattgg60

cttttgattacactccaaactggggtagaggtagaccatcttctttcattgatactgtta120

cttttcctgttgttttgactgataaggcttacacttacagagttgttgtttctggtaagg180

atttgggtgttagaccatcttacgctgttgaatctgatggttctcaaaagattaacttct240

tggaatacaactctggttacggtattgctgatactaacactattcaagtttacgttattg300

atccagatactggtaacaacttcattatcgctcaatggaaccatcatcatcatcatcatt360

agtctctagatt372

Claims (8)

1. utilize a method for pichia yeast expression system production rainbow conk immune modulator, it is characterized in that, comprise the following steps:

(1) according to the nucleotide sequence SEQIDNO.1 of pichia spp codon preference synthesis rainbow conk immune modulator FIP-tvc gene;

Described pichia spp is pichia spp mycetocyte GS115;

(2) utilize rainbow conk immune modulator FIP-tvc and the expression plasmid carrier X of synthesis in digestion with restriction enzyme step (1), build recombinant expression plasmid X-FIP-tvc, method is, by the gene order of synthesis fIP-tvcwith plasmid vector xutilize restriction enzyme to carry out enzyme to cut, reclaim object fragment, utilize T4DNA ligase enzyme to incite somebody to action fIP-tvcendonuclease bamhi and plasmid vector xendonuclease bamhi connects, and obtains recombinant expression plasmid x-FIP-tvc, be transformed in bacillus coli DH 5 alpha and increase;

Described expression plasmid carrier X is constitutive expression plasmid vector pGAPZ α A or inducible expression plasmid carrier pPICZ α A;

(3) transform Pichia pastoris GS115 competent cell after utilizing restriction enzyme to carry out linearizing to recombinant expression plasmid carrier X-FIP-tvc, application filters out composing type positive transformant or induction type positive transformant containing antibiotic flat board and PCR method;

(4) the fermentation screening of recombinant protein rFIP-tvc Pichi strain is expressed: ferment after the composing type positive transformant that filters out cultivates 3-5d YPD liquid nutrient medium from step (3), fermented supernatant fluid detects protein expression amount with SDS-PAGE, filters out the pichia spp recombinant bacterial strain of constitutive and secretive expression rFIP-tvc; Or BMSY substratum, cultivate 2-4d from the induction type positive transformant that step (3) filters out, bacterium liquid adds the abduction delivering that methyl alcohol carries out recombinant protein, induction 3-7d, fermented supernatant fluid detects protein expression amount with SDS-PAGE, filters out the pichia spp recombinant bacterial strain of induction type high-level secretory expression rFIP-tvc;

(5) separation and purification rainbow conk immune modulator FIP-tvc in pichia spp recombinant bacterial strain fermented supernatant fluid, the pichia spp recombinant bacterial strain of rFIP-tvc step (4) filtered out carries out fermentation culture or abduction delivering 3-7d, fermented supernatant fluid ammonium sulfate precipitates, precipitation level pad carries out dissolving and carries out dialysis 24-48h with level pad, Ni-NTA chromatography column after level pad dialysis on protein sample after dialysis is carried out affine displacement chromatography, obtain the recombinant protein rFIP-tvc of purifying, rainbow conk immune modulator FIP-tvc pressed powder is obtained with the method such as vacuum lyophilization or spraying dry.

2. the method utilizing pichia yeast expression system production rainbow conk immune modulator according to claim 1, it is characterized in that, described in step (1) according to the nucleotide sequence of pichia spp codon preference synthesis rainbow conk immune modulator FIP-tvc gene be, on the basis not changing rainbow conk immune modulator FIP-tvc aminoacid sequence, according to pichia spp Preference codon FIP-tvc complete genome sequence be optimized and synthesize, existing simultaneously fIP-tvc5' end and 3 ' end introduce restriction enzyme site, and before the terminator codon of 3' end, add protein tag sequence facilitate follow-up protein purification, protein tag is the one of eGFP, His, Flag, gsh.

3. the method utilizing pichia yeast expression system production rainbow conk immune modulator according to claim 1, it is characterized in that, structure recombinant expression plasmid carrier pGAPZ α A-FIP-tvc described in step (2) or pPICZ α A-FIP-tvc, method is, by the gene order of synthesis and plasmid vector xutilize restriction enzyme to carry out two enzyme enzyme to cut, reclaim object fragment, utilize T4DNA ligase enzyme to incite somebody to action fIP-tvcendonuclease bamhi and plasmid xendonuclease bamhi connects, and obtains recombinant expression plasmid x-FIP-tvc, be transformed in bacillus coli DH 5 alpha and increase;

It is utilize restriction enzyme E that described two enzyme enzymes are cut cor I and X bai by the rainbow conk immune adjustment protein gene of synthesis in step (1) fIP-tvccarry out two enzyme enzyme with constitutive expression plasmid vector pGAPZ α A or inducible expression plasmid carrier pPICZ α A to cut, gel electrophoresis reclaims target DNA fragments after being separated, then utilize T4DNA ligase enzyme to carry out 16 DEG C of connections to DNA fragmentation to spend the night, 42 DEG C of thermal shock transformation of E. coli DH5 α competent cells, coating is containing the LB culture medium flat plate of 25 μ g/mLZeocin, overnight incubation at being placed in 37 DEG C, random picking mono-clonal, extracting recombinant expression plasmid pGAPZ α A-FIP-tvc or pPICZ α A-FIP-tvc, qualification positive colony is cut by two enzyme enzyme, LB substratum is by 5g yeast extract, 10g peptone, 5g sodium-chlor, adjust ph is to 7.2-7.4, add water to 1000mL to make.

4. the method utilizing pichia yeast expression system production rainbow conk immune modulator according to claim 1, it is characterized in that, conversion Pichia pastoris GS115 competent cell described in step (3), method is, adopt electroporated or chemical conversion, electroporated is utilize restriction enzyme to the recombinant plasmid built x-FIP-tvccarry out linearization for enzyme restriction, the electroporated Pichi strain competent cell of electricity consumption conversion instrument; Chemical conversion utilizes plate screening positive transformant, obtaining positive transformant or obtain auxotroph or genotype transformant by MM flat board, MD plate screening containing corresponding antibiotic YPD plate screening;

Described YPD flat board be by: 10g yeast powder, 20g peptone, 20gD-glucose, agar 15g, add water to 1000mL and make;

Described MM flat board be by: 13.4g, without amino acid yeast nitrogen, 4 × 10-4g vitamin H, 5mL methyl alcohol, agar 15.0g, adds water to 1000mL and makes;

Described MD flat board be by: 13.4g, without amino acid yeast nitrogen, 4 × 10-4g vitamin H, 20gD-glucose, agar 15g, adds water to 1000mL and makes.

5. the method utilizing pichia yeast expression system production rainbow conk immune modulator according to claim 1, is characterized in that, described in step (3) to carry out linearizing to recombinant expression plasmid carrier X-FIP-tvc be utilize restriction enzyme A vriI enzyme cuts composing type recombinant expression plasmid pGAPZ α A-FIP-tvc, or restriction enzyme S aci enzyme is cut induction type recombinant expression plasmid pPICZ α A-FIP-tvc and is carried out linearizing, get 5-20 μ g plasmid respectively and carry out electroporated Pichia pastoris GS115 competent cell, the parameter of GenePulseXcell electricity conversion instrument used is: voltage 1.8kV, electric capacity 25 μ F, resistance 200 Ω, discharge time 4.8-5.2ms, the 1.0M sorbyl alcohol that 1.0mL is ice-cold is added immediately after electric shock, after 30 DEG C of shaking culture 1-2h, coating is dull and stereotyped containing the YPD of 100 μ g/mLZeocin, transformant is grown after being placed in 28-30 DEG C of cultivation 2-4d, transformant to be inoculated at being placed in 28-30 DEG C in the YPD liquid nutrient medium containing 100 μ g/mLZeocin after 200rpm shaking culture 3d, the centrifugal 5min of 8000rpm, collect thalline, extract the genomic dna of transformant, with the genomic dna obtained for template carries out pcr amplification, the primer presses the sequences Design of yeast expression vector, upstream universal primer α-factor is 5 '-TACTATTGCCAGCATTGCTGC-3 ', and downstream universal primer 3 '-AOX1 is 5 '-GCAAATGGCATTCTGACATCC-3 ', PCR reaction system adopts 25 μ L:10 × PCRbuffer2.5 μ L, dNTP2.0 μ L, each 1.0 μ L of upstream and downstream primer, template DNA 2.0 μ L, rTaq enzyme 0.3 μ L, supplements ddH ₂o to 25.0 μ L,

Pcr amplification condition is 94 DEG C of denaturation 5min, then enters circulation 94 DEG C of 40s, 54 DEG C of 30s, 72 DEG C of 60s, carry out 30 circulations, and last 72 DEG C finally extend 10min, amplified production 1.2% agarose electrophoresis observations, what occur target stripe is positive transformant.

6. the method utilizing pichia yeast expression system production rainbow conk immune modulator according to claim 1, it is characterized in that, the pichia spp recombinant bacterial strain of constitutive and secretive expression rFIP-tvc that screening described in step (4) obtains or the pichia spp recombinant bacterial strain of induction type secreting, expressing rFIP-tvc, wherein the pichia spp recombinant bacterial strain YPD substratum of constitutive and secretive expression rFIP-tvc is cultivated; The pichia spp recombinant bacterial strain of described induction type secreting, expressing rFIP-tvc is inoculated in substratum at dull and stereotyped picking transformant, by shake flask fermentation abduction delivering, obtains the Pichi strain that hypersecretion expresses FIP-tvc;

Wherein: described substratum comprises BMGY/BMMY, BMG/BMM, YPG; Wherein preferred BMGY/BMMY and YPG substratum;

Described BMGY substratum is: the 100mM phosphoric acid buffer of 10g yeast powder, 20g peptone, pH6.0,13.4g are without amino acid yeast nitrogen, 4 × 10 ^-4g vitamin H, 10mL glycerine, add water to 1000mL and make:

Described BMMY substratum is: the 100mM phosphoric acid buffer of 10g yeast powder, 20g peptone, pH6.0,13.4g are without amino acid yeast nitrogen, 4 × 10 ^-4g vitamin H, 5mL methyl alcohol, add water to 1000mL and make:

Described BMG substratum is: the 100mM phosphoric acid buffer of pH6.0,13.4g are without amino acid yeast nitrogen, 4 × 10 ^-4g vitamin H, 10mL glycerine, add water to 1000mL and make:

Described BMM substratum is: the 100mM phosphoric acid buffer of pH6.0,13.4g are without amino acid yeast nitrogen, 4 × 10 ^-4g vitamin H, 5mL methyl alcohol, add water to 1000mL and make:

Described YPG substratum is: 10g yeast powder, 20g peptone, 10mL glycerine, add water to 1000mL and make.

7. the method utilizing pichia yeast expression system production rainbow conk immune modulator according to claim 1, it is characterized in that, the restructuring of separation and purification from fermentation culture rainbow conk immune modulator rFIP-tvc described in step (5) is: after the Pichi strain fermentation culture of the high level expression recombinant protein of acquisition, fermentation liquor is centrifugal obtains supernatant liquor, use ammonium sulfate precipitated protein matter, protein precipitation is obtained after centrifugal, dialysis 24-48h is carried out with identical damping fluid after sediment fraction level pad dissolves again, change dialyzate therebetween more than 3 times, the Ni-NTA chromatography column with His label is selected according to the recombinant protein of expressing, first protein crude extract is gone up Ni-NTA chromatography column, the albumen that not can be incorporated on post is washed away with level pad, then wash-out is carried out with different pH value or the level pad containing different salt ionic concentration respectively, collect elutriant, the purification effect of using polypropylene acrylamide gel electrophoresis electrophoresis detection albumen, adopt the method for dialysis or the mode desalination with desalting column wash-out, vacuum lyophilization or spraying dry, obtain the solid rFIP-tvc powder after purifying.

8. the method utilizing pichia yeast expression system production rainbow conk immune modulator according to claim 7, it is characterized in that, the pichia spp recombinant bacterial strain with hypersecretion expression rFIP-tvc is carried out fermentation culture or abduction delivering 3-7d, at 8000rpm, 4 DEG C to the centrifugal 5min of fermented liquid, collect supernatant liquor, precipitates overnight is carried out with 80% ammonium sulfate, then to abandon supernatant liquor after 20000rpm, 4 DEG C of centrifugal 30min, precipitation level pad dissolves, with level pad, the dialysis membrane of molecular weight cut-off 3.5kD carries out dialysis equilibrium 24-48h;

Described level pad is: 300mM sodium-chlor, 50mM SODIUM PHOSPHATE, MONOBASIC, 10mM imidazoles, 10mMTris-HCl, pH8.0;

With equilibration buffer Ni-NTA chromatography column 10 column volumes, by the protein sample upper prop after above-mentioned dialysis equilibrium, carry out affine displacement chromatography, after sample upper prop, continue with Equilibration buffer wash 20 column volumes, then gradient stepwise elution is carried out with the level pad containing 100,200,400 and 1000mM imidazole concentration respectively, collect elutriant, namely the recombinant protein rFIP-tvc after purifying is obtained, with dialysis or the mode desalination with desalting column wash-out, vacuum lyophilization or spraying dry, obtain the rFIP-tvc powder of solid.