CN112048518A - Preparation method and application of zein degrading enzyme - Google Patents
Preparation method and application of zein degrading enzyme Download PDFInfo
- Publication number
- CN112048518A CN112048518A CN202010852694.7A CN202010852694A CN112048518A CN 112048518 A CN112048518 A CN 112048518A CN 202010852694 A CN202010852694 A CN 202010852694A CN 112048518 A CN112048518 A CN 112048518A
- Authority
- CN
- China
- Prior art keywords
- zein
- degrading enzyme
- enzyme
- zdp
- ppicz alpha
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/63—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from plants
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23J—PROTEIN COMPOSITIONS FOR FOODSTUFFS; WORKING-UP PROTEINS FOR FOODSTUFFS; PHOSPHATIDE COMPOSITIONS FOR FOODSTUFFS
- A23J3/00—Working-up of proteins for foodstuffs
- A23J3/30—Working-up of proteins for foodstuffs by hydrolysis
- A23J3/32—Working-up of proteins for foodstuffs by hydrolysis using chemical agents
- A23J3/34—Working-up of proteins for foodstuffs by hydrolysis using chemical agents using enzymes
- A23J3/346—Working-up of proteins for foodstuffs by hydrolysis using chemical agents using enzymes of vegetable proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/06—Preparation of peptides or proteins produced by the hydrolysis of a peptide bond, e.g. hydrolysate products
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Nutrition Science (AREA)
- Food Science & Technology (AREA)
- Polymers & Plastics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Enzymes And Modification Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a preparation method and application of zein degrading enzyme, and belongs to the technical field of molecular biology. The invention discloses a preparation method of zein degrading enzyme, which utilizes modern molecular technology to successfully optimize the gene sequence of the zein degrading enzyme, constructs an expression vector pPICZ alpha A-ZDP capable of expressing the zein degrading enzyme in vitro, and utilizes the vector and Pichia to prepare the zein degrading enzyme, thereby providing technical support for the application of the zein degrading enzyme in production.
Description
Technical Field
The invention relates to the technical field of molecular biology, in particular to a preparation method and application of zein degrading enzyme.
Background
Corn is the main ingredient of concentrate in the current ruminant feeding system. Starch, which accounts for about 70% of dry matter in corn, is an important energy source for ruminants. An important way for ruminants to utilize corn starch is to utilize rumen microorganisms to degrade it. However, despite the complex rumen environment, where a wide range of starch degrading microorganisms exist, the starch rumen digestibility is often less than 60%, and for dry milled corn is often less than 50%, the most common in ruminant breeding systems in our country is just dry milled corn. Insufficient rumen starch digestibility will inhibit rumen microbial protein synthesis, thereby reducing animal productivity. Therefore, increasing the ruminal digestibility of starch is an important measure for optimizing the energy supply of starch and increasing animal production. Factors affecting the rumen digestibility of corn starch include the type of corn, the mowing time, the starch composition (the ratio of amylose to amylopectin), the processing mode, the zein content and the like. Among them, in recent years, studies on the influence of zein content in corn on rumen starch degradation in ruminants have been receiving attention.
Zein is the main storage protein in corn endosperm, exists in a cross-linked complex with starch granules, is insoluble in water, low salt solution and rumen environment, and is soluble in 60-95% ethanol solution. The rumen insoluble nature of zein determines that it is difficult to degrade by microorganisms in the rumen, thereby limiting the contact of rumen microorganisms with starch granules, resulting in reduced starch degradability. Research shows that when the zein content is increased from 7.6 percent to 9.1 percent, the effective degradation rate of rumen starch is reduced from 61.9 percent to 46.2 percent. Similarly, in another study, the content of zein was increased from 3.09% to 6.04%, the in vitro rumen starch degradation rate was decreased from 62.1% to 52.9%, and the rumen effective degradation rate was decreased from 49.3% to 39.6%, and regression statistics showed that zein has a very significant negative correlation with both the in vitro rumen starch degradation rate and the rumen starch effective degradation rate. In conclusion, the zein has a remarkable inhibiting effect on rumen digestion of starch in corn, and an effective measure for degrading the zein is found, so that the zein is an important way for improving the rumen starch digestion rate.
For how to degrade zein in corn, measures such as processing corn and adding exogenous enzyme preparations are mainly adopted at present. The corn kernels are subjected to steam tabletting, ensiling and fermentation treatment, so that zein can be damaged or degraded to a certain extent, and the rumen digestibility of starch is improved, but the defects of high energy consumption and high cost exist; the corn kernel is subjected to ensiling fermentation and is mainly applied to high-moisture corn, and the measure is not suitable for the current livestock production environment in China. Some industrial fields try to degrade zein by using alkaline, neutral and acid proteases and microbial fermentation complex enzymes, but the effect is very little, and the degradation rate of the zein by the enzymes is only 15-33% even under the optimal action condition, which is mainly because the selected enzymes lack specificity in the aspect of degrading the zein, and the importance of selecting zein specific degrading enzymes is highlighted.
Corn seeds draw on stored protein during germination to provide nutrients necessary for embryo growth. It was found that corn seeds almost completely degrade storage proteins (containing zein) during germination by secreted specific zein degrading enzymes (ZDP). However, the protein components produced by the corn seeds in the germination process are complex, the concentration of the secreted zein degrading enzyme is low, and the separation and purification are difficult, so that the further application of the zein degrading enzyme in production is hindered.
Therefore, it is an urgent need to solve the problems of the art to provide a preparation method of zein degrading enzyme and application thereof.
Disclosure of Invention
In view of the above, the present invention provides a method for preparing zein degrading enzyme and application thereof.
In order to achieve the purpose, the invention adopts the following technical scheme:
a preparation method of zein degrading enzyme comprises the following specific steps:
(1) optimizing zein degrading enzyme genes;
(2) constructing a recombinant expression vector pPICZ alpha A-ZDP;
(3) transforming the recombinant expression vector pPICZ alpha A-ZDP into pichia pastoris to obtain positive clones, and culturing;
(4) centrifuging the cultured bacterial liquid to obtain culture supernatant; and (4) carrying out affinity chromatography purification to obtain the purified zein degrading enzyme.
Further, the zein degrading enzyme gene is optimized in the step (1) according to the codon preference of pichia pastoris and the characteristics of a pPICZ alpha A vector, and the optimized zein degrading enzyme gene is SEQ ID NO. 1.
Further, the specific steps of constructing the recombinant expression vector pPICZ alpha A-ZDP in the step (2) are as follows: carrying out double enzyme digestion on the zein degrading enzyme gene segment and the expression plasmid pPICZ alpha A by using EcoR I and Xba I restriction endonucleases respectively; recovering zein degrading enzyme gene fragments and pPICZ alpha A plasmid fragments from glue; taking 4 mul of target fragment of zein degrading enzyme, 5 mul of T4 ligase and buffer, uniformly mixing 1 mul of purified pPICZ alpha A carrier, and incubating overnight in a circulating water bath at 16 ℃; transforming an escherichia coli competent cell DH5 alpha, and screening positive clones in an LB culture medium containing Amp; and (3) selecting white colonies, adding the white colonies into a liquid LB culture medium containing Amp, shaking at 37 ℃ for overnight culture, extracting a recombinant expression vector plasmid pPICZ alpha A-ZDP after the culture medium is turbid, and performing enzyme digestion verification.
Further, the step (3) of transforming the pichia pastoris comprises the following specific steps: carrying out enzyme digestion on the recombinant expression vector pPICZ alpha A-ZDP by using restriction enzyme Sac I, and purifying an enzyme digestion product; transferring the purified expression vector pPICZ alpha A-ZDP into a Pichia pastoris X33 competent cell, culturing in a YPD culture medium containing bleomycin, and screening positive clones through PCR amplification reaction; selecting 1 white colony of the positive clone, adding the white colony into 2mL YPD culture medium, and shaking at 30 ℃ and 160rpm for overnight culture; all the bacterial liquid was transferred to 200mL BMGY medium, and cultured overnight at 30 ℃ with shaking for use in fermenter culture.
Further, the zein degrading enzyme is applied to the hydrolysis of zein.
Furthermore, the zein degrading enzyme is applied to promoting the amylase to degrade the corn starch.
According to the technical scheme, compared with the prior art, the invention discloses a preparation method and application of the zein degrading enzyme, the gene sequence of the zein degrading enzyme is successfully optimized by using the modern molecular technology, the expression vector pPICZ alpha A-ZDP capable of expressing the zein degrading enzyme in vitro of yeast is constructed, the zein degrading enzyme can be prepared by using the vector and the Pichia pastoris, and then technical support is provided for the application of the zein degrading enzyme in production.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.
FIG. 1 is a diagram showing SDS-PAGE and Western blot analysis of the recombinant zein degrading enzyme of the invention;
FIG. 2 is a graph showing the determination of the optimum pH for zein degrading enzyme of the present invention;
FIG. 3 is a graph showing the determination of the optimum temperature for zein degrading enzyme in accordance with the present invention;
FIG. 4 is a drawing illustrating the degradation of commercial zein by the zein degrading enzyme of the present invention;
FIG. 5 is a scanning electron micrograph of a control group of dry ground corn of the present invention; the scale size is 20 μm;
FIG. 6 is a scanning electron micrograph of dry-milled corn of a zein degrading enzyme treatment group in accordance with the present invention; the scale size is 20 μm;
FIG. 7 is a schematic representation of the hydrolysis of dry ground corn by zein degrading enzymes in accordance with the present invention;
FIG. 8 is a drawing showing the synergistic effect of zein degrading enzyme of the present invention on starch degradation in corn by amylase.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Coli competent cell DH5 α was purchased from Tiangen Biochemical technology (Beijing) Ltd (CB 101-01); the pichia pastoris and the expression vector pPICZ alpha A are preserved in the laboratory; DNA gel recovery kit (SK8743), PCR product purification kit (SK8741), plasmid miniprep kit (SK8791) were purchased from Biotechnology, Inc., T4-DNA ligase, Premix Taq (Ex Taq Version 2.0) PCR mixture (RR003A), restriction enzyme EcoR I, Sac I, Xba I, pMD 19-T cloning vector kit were purchased from Dalibao bioengineering.
Example 1 optimization of zein degrading enzyme genes
According to the codon preference of pichia pastoris and the characteristics of pPICZ alpha A vector, the gene sequence of the zein degrading enzyme in NCBI (GenBank: NM-001137099.2, https:// www.ncbi.nlm.nih.gov/nuccore/NM-001137099.2 /) is optimized, and the optimized zein degrading enzyme gene is as follows:
attgaatttgatgagagagatttggcttctgatgaagctttgtgggatttgtacgagagatggcaaactcatcacagagttcatagacatcacggtgaaaagggtagaagatttggtactttcaaagagaacgctagattcattcatgctcacaataagagaggagatagaccatatagattgagattgaacagattcggagatatgggtagagaagagtttagatctggtttcgctgattccagaattaacgatttgagaagagagccaactgctgctccagctgttcctggttttatgtacgatgatgctactgatttgcctagatctgttgattggagacaaaagggtgctgttactgctgttaaaaaccaaggtagatgtggttcttgttgggctttctctactgttgttgctgttgaaggtattaatgctattagaactggttctttggtttctttgtctgaacaagagttgattgattgtgatactgatgaaaacggttgtcaaggtggtttgatggaaaacgctttcgagttcattaagtctcatggtggtattactactgagtctgcttacccttatcacgcttctaacggtacttgtgatggtgctagagctagaagaggtagagttgttgctattgatggtcatcaagctgttccagctggttctgaagatgctttggctaaagctgttgctcaccaacctgtttctgttgctattgatgctggtggtcaagctttgcaattttactctgagggtgttttcactggagattgtggtactgatttggatcacggtgttgctgctgttggttacggtgtttctgatgatggtactccatactggatcgttaaaaattcttggggtccttcttggggtgaaggtggttatattagaatgcaaagaggtactggtaacggtggtttgtgtggtattgctatggaggcttctttcccaattaagacttctccaaatccttccagaaaacctagaagagctttgattactagagatgcttcttctcaa；SEQ ID NO.1。
and adding restriction enzyme EcoR I and XbaI sites at two ends of the optimized zein degrading enzyme gene fragment to obtain the zein degrading enzyme gene fragment.
Example 2 construction of recombinant expression vector pPICZ alpha A-ZDP
Carrying out double enzyme digestion on the zein degrading enzyme gene segment and the expression plasmid pPICZ alpha A by using EcoR I and Xba I restriction endonucleases respectively, wherein the enzyme digestion system is as follows: 10 Xquick Cut buffer 5 u L, EcoRI 1 u L, Xba I1 u L, plasmid 8 u L, sterile water 35 u L, 37 degrees C were incubated for 10-15 min. Recovering zein degrading enzyme gene fragments and pPICZ alpha A plasmid fragments from glue; and (3) taking 4 mu l of target fragment of zein degrading enzyme, 5 mu l of T4 ligase and buffer, uniformly mixing 1 mu l of purified pPICZ alpha A carrier, and incubating overnight in a circulating water bath at 16 ℃. Coli competent cells DH 5. alpha. were transformed and positive clones were selected in LB medium containing 100. mu.g/ml Amp. And (3) selecting white colonies, adding the white colonies into a liquid LB culture medium containing 100 mu g/ml Amp, shaking the white colonies overnight at 37 ℃, culturing the white colonies till the culture medium is turbid, extracting a recombinant expression vector plasmid pPICZ alpha A-ZDP by using a plasmid extraction kit, and performing enzyme digestion verification.
The sequence of the constructed pPICZ alpha A-ZDP gene is as follows:
agatctaacatccaaagacgaaaggttgaatgaaacctttttgccatccgacatccacaggtccattctcacacataagtgccaaacgcaacaggaggggatacactagcagcagaccgttgcaaacgcaggacctccactcctcttctcctcaacacccacttttgccatcgaaaaaccagcccagttattgggcttgattggagctcgctcattccaattccttctattaggctactaacaccatgactttattagcctgtctatcctggcccccctggcgaggttcatgtttgtttatttccgaatgcaacaagctccgcattacacccgaacatcactccagatgagggctttctgagtgtggggtcaaatagtttcatgttccccaaatggcccaaaactgacagtttaaacgctgtcttggaacctaatatgacaaaagcgtgatctcatccaagatgaactaagtttggttcgttgaaatgctaacggccagttggtcaaaaagaaacttccaaaagtcggcataccgtttgtcttgtttggtattgattgacgaatgctcaaaaataatctcattaatgcttagcgcagtctctctatcgcttctgaaccccggtgcacctgtgccgaaacgcaaatggggaaacacccgctttttggatgattatgcattgtctccacattgtatgcttccaagattctggtgggaatactgctgatagcctaacgttcatgatcaaaatttaactgttctaacccctacttgacagcaatatataaacagaaggaagctgccctgtcttaaacctttttttttatcatcattattagcttactttcataattgcgactggttccaattgacaagcttttgattttaacgacttttaacgacaacttgagaagatcaaaaaacaactaattattcgaaacgatgagatttccttcaatttttactgctgttttattcgcagcatcctccgcattagctgctccagtcaacactacaacagaagatgaaacggcacaaattccggctgaagctgtcatcggttactcagatttagaaggggatttcgatgttgctgttttgccattttccaacagcacaaataacgggttattgtttataaatactactattgccagcattgctgctaaagaagaaggggtatctctcgagaaaagagaggctgaagctgaattcattgaatttgatgagagagatttggcttctgatgaagctttgtgggatttgtacgagagatggcaaactcatcacagagttcatagacatcacggtgaaaagggtagaagatttggtactttcaaagagaacgctagattcattcatgctcacaataagagaggagatagaccatatagattgagattgaacagattcggagatatgggtagagaagagtttagatctggtttcgctgattccagaattaacgatttgagaagagagccaactgctgctccagctgttcctggttttatgtacgatgatgctactgatttgcctagatctgttgattggagacaaaagggtgctgttactgctgttaaaaaccaaggtagatgtggttcttgttgggctttctctactgttgttgctgttgaaggtattaatgctattagaactggttctttggtttctttgtctgaacaagagttgattgattgtgatactgatgaaaacggttgtcaaggtggtttgatggaaaacgctttcgagttcattaagtctcatggtggtattactactgagtctgcttacccttatcacgcttctaacggtacttgtgatggtgctagagctagaagaggtagagttgttgctattgatggtcatcaagctgttccagctggttctgaagatgctttggctaaagctgttgctcaccaacctgtttctgttgctattgatgctggtggtcaagctttgcaattttactctgagggtgttttcactggagattgtggtactgatttggatcacggtgttgctgctgttggttacggtgtttctgatgatggtactccatactggatcgttaaaaattcttggggtccttcttggggtgaaggtggttatattagaatgcaaagaggtactggtaacggtggtttgtgtggtattgctatggaggcttctttcccaattaagacttctccaaatccttccagaaaacctagaagagctttgattactagagatgcttcttctcaatttctagaacaaaaactcatctcagaagaggatctgaatagcgccgtcgaccatcatcatcatcatcattgagtttgtagccttagacatgactgttcctcagttcaagttgggcacttacgagaagaccggtcttgctagattctaatcaagaggatgtcagaatgccatttgcctgagagatgcaggcttcatttttgatacttttttatttgtaacctatatagtataggattttttttgtcattttgtttcttctcgtacgagcttgctcctgatcagcctatctcgcagctgatgaatatcttgtggtaggggtttgggaaaatcattcgagtttgatgtttttcttggtatttcccactcctcttcagagtacagaagattaagtgagaccttcgtttgtgcggatcccccacacaccatagcttcaaaatgtttctactccttttttactcttccagattttctcggactccgcgcatcgccgtaccacttcaaaacacccaagcacagcatactaaattttccctctttcttcctctagggtgtcgttaattacccgtactaaaggtttggaaaagaaaaaagagaccgcctcgtttctttttcttcgtcgaaaaaggcaataaaaatttttatcacgtttctttttcttgaaatttttttttttagtttttttctctttcagtgacctccattgatatttaagttaataaacggtcttcaatttctcaagtttcagtttcatttttcttgttctattacaactttttttacttcttgttcattagaaagaaagcatagcaatctaatctaaggggcggtgttgacaattaatcatcggcatagtatatcggcatagtataatacgacaaggtgaggaactaaaccatggccaagttgaccagtgccgttccggtgctcaccgcgcgcgacgtcgccggagcggtcgagttctggaccgaccggctcgggttctcccgggacttcgtggaggacgacttcgccggtgtggtccgggacgacgtgaccctgttcatcagcgcggtccaggaccaggtggtgccggacaacaccctggcctgggtgtgggtgcgcggcctggacgagctgtacgccgagtggtcggaggtcgtgtccacgaacttccgggacgcctccgggccggccatgaccgagatcggcgagcagccgtgggggcgggagttcgccctgcgcgacccggccggcaactgcgtgcacttcgtggccgaggagcaggactgacacgtccgacggcggcccacgggtcccaggcctcggagatccgtcccccttttcctttgtcgatatcatgtaattagttatgtcacgcttacattcacgccctccccccacatccgctctaaccgaaaaggaaggagttagacaacctgaagtctaggtccctatttatttttttatagttatgttagtattaagaacgttatttatatttcaaatttttcttttttttctgtacagacgcgtgtacgcatgtaacattatactgaaaaccttgcttgagaaggttttgggacgctcgaaggctttaatttgcaagctggagaccaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagatc；SEQ ID NO.2。
example 3 transformation of Pichia pastoris
Carrying out enzyme digestion on the recombinant expression vector pPICZ alpha A-ZDP by using restriction enzyme Sac I, wherein the enzyme digestion system is as follows: 10 Xquick Cut buffer 5. mu.L, Sac I1. mu.L, plasmid 8. mu.L, sterile water 36. mu.L, incubation at 37 ℃ for 10-15 min. Purifying the enzyme digestion product by using a PCR product purification kit; the purified expression vector pPICZ. alpha.A-ZDP was transferred into Pichia pastoris X33 competent cells using an electroporator, cultured in YPD medium (1% yeast extract, 2% peptone, 2% glucose) containing 30. mu.g/ml bleomycin, and positive clones were selected by PCR amplification reaction using ZDP specific primers (5'-GATTTGTACGAGAGATGGC-3'; SEQ ID NO. 3; and 5'-TCTGGAAGGATTTGGAGAAGTC-3'; SEQ ID NO.4) under the PCR conditions: pre-denaturation at 94 ℃ for 1 min; circulating for 30 times at 98 deg.C for 10s, 55 deg.C for 15s, and 68 deg.C for 1.5 min; extension at 72 ℃ for 10 min. White colonies of 1 positive clone were picked and added to 2mL YPD medium, and cultured overnight at 30 ℃ with shaking at 160 rpm. The whole was transferred to 200mL BMGY medium (1% yeast extract, 2% peptone, 1.34% yeast nitrogen base, 4X 10-5% biotin, 100mM potassium phosphate buffer pH 6.0, 1% glycerol), shaking overnight at 30 ℃ for culture in a fermenter.
Example 4 fermenter culture
Adding 1.5-2L of fermentation basal salt culture medium (containing 26.7mL of 85% phosphoric acid, 0.93g of calcium sulfate, 18.2g of potassium sulfate, 14.9g of magnesium sulfate heptahydrate, 4.13g of potassium hydroxide and 40g of glycerol per liter) into a fermentation tank, autoclaving at 121 ℃ for 20min, and cooling to room temperature; adding 4-5mL of trace element salt culture medium into a fermentation tank through a 0.22 mu m filter head; adjusting the fermentation tank to make the temperature at 30 ℃ and the pH value at 5-6; the bacterial liquid in the embodiment 3 is completely added into a fermentation tank under the aseptic condition for culture; culturing until the dissolved oxygen is more than 60%, adding 50% glycerol culture medium (diluting pure glycerol to 50%, adding trace element salt culture medium to make the concentration of glycerol contain 12-13mL of trace element salt culture medium per liter), culturing for 24h, stopping adding 50% glycerol culture medium, continuing for 4-5h when the dissolved oxygen is more than 60%, starting adding 100% methanol culture medium (pure methanol is 100%, adding trace element salt culture medium to make the concentration of methanol contain 12-13mL of trace element salt culture medium per liter, wherein the trace element salt culture medium contains 6g of blue vitriol per liter, 0.08g of sodium iodide, 3g of manganese sulfate monohydrate, 0.2g of sodium molybdate dihydrate, 0.02g of boric acid, 0.5g of cobalt chloride, 20g of zinc chloride, 65g of ferrous sulfate heptahydrate, 0.2g of biotin, 5mL of sulfuric acid, adding water to 1L, and the flow rate is 3-10 mL/hour per initial culture medium volume, regulating rotation speed and ventilation amount to ensure that the dissolved oxygen content of the fermentation liquor is not less than 20%, and continuously culturing for 72-120 h.
The cultured bacterial liquid is centrifuged to obtain a culture supernatant. The obtained supernatant was concentrated by passing through a membrane separation system equipped with a 10kDa organic membrane, and exchanged with Binding Buffer (containing 0.05M sodium dihydrogenphosphate and 0.3M sodium chloride) having a pH of 8.0, followed by affinity chromatography through a 5mL nickel column and a low-pressure chromatography system at a flow rate of 1.5 mL/min. The zein degrading enzyme bound to the nickel column was washed first with Washing buffer (containing 0.05M imidazole, 0.05M sodium dihydrogen phosphate and 0.3M sodium chloride) at pH 8.0 and finally collected with Elution buffer (containing 0.25M imidazole, 0.05M sodium dihydrogen phosphate and 0.3M sodium chloride) to obtain purified zein degrading enzyme.
The molecular weight and purity of the purified zein degrading enzyme were determined by SDS-PAGE and Western blot techniques, and the results are shown in FIG. 1. The result of figure 1 shows that the recombinant zein degrading enzyme of the invention is successfully expressed, the molecular weight is 41kDa, and the purity is 30 percent.
Example 5 characterisation of zein degrading enzymes
Placing a reaction system of 0.5 microgram of purified zein degrading enzyme, 0.25% azocasein and 100mM citric acid buffer solution (pH 3.0-7.0) in a gas bath shaker at 40 ℃, shaking and culturing for 2h, adding 12% trichloroacetic acid solution into the reaction system according to a ratio of 1:1, placing in ice for 30min, measuring absorbance at 340nm, calculating the difference value between the absorbance and the absorbance of a control group (without adding enzyme), and determining the dependence of the zein degrading enzyme on the pH, wherein the result is shown in figure 2. The results in FIG. 2 show that zein degrading enzymes are most active at pH 5.0. Similarly, the reaction system is placed in a buffer solution with pH 5.0, shake culture is carried out for 2h at 20-80 ℃, and the temperature dependence of the zein degrading enzyme is determined, and the result is shown in figure 3. The results in FIG. 3 show that the optimal temperature for the zein degrading enzyme of the present invention is 40 ℃. Placing zein degrading enzyme at 20-80 deg.C for 1h, and determining residual enzyme activity at 40 deg.C and pH of 5.0 according to the above procedure to determine temperature tolerance of zein; the results show that the activity of the zein degrading enzyme is hardly influenced by placing the zein degrading enzyme for 1 hour at 20-40 ℃ in advance; after the zein degrading enzyme is placed for 1 hour at the temperature of 50-80 ℃, the zein degrading enzyme still keeps more than 70 percent of activity, which shows that the zein degrading enzyme has better tolerance to temperature.
Example 6 hydrolysis of pure zein by zein degrading enzyme
Treatment group: 20mg of zein (Z3625, sigma) was weighed, 1ml of 0.1M citric acid buffer containing 0.7, 1.4, 2.8. mu.g of purified zein degrading enzyme and 5mM dithiothreitol was added, shake-cultured at 40 ℃ for 2 hours, and the amino acid content was determined. The control group was not added zein degrading enzyme and the other conditions were the same as the treated group, and the results are shown in fig. 4. Figure 4 results show that 0.7, 1.4, 2.8 micrograms of purified zein degrading enzyme produced 4.3, 6.9, 6.3 micromolar amino acids in the process of zein degradation compared to the control. The zein degrading enzyme has obvious degradation capability on pure zein.
Example 7 Effect of zein degrading enzymes on corn grain Structure
In order to show that the zein degrading enzyme can degrade the zein on the surfaces of corn particles, 50mg of dry and crushed corn is weighed and respectively put into a centrifuge tube, 1ml of 0.1M citric acid buffer solution containing 2.8 micrograms of purified zein degrading enzyme is added, shake culture is carried out for 12h at 40 ℃, centrifugation is carried out, the obtained residue is dried, scanning electron microscope observation is carried out, and the result is shown in a figure 5-figure 6. The results of fig. 5-6 show that the surface of the control group (without added zein degrading enzyme) corn pellet was significantly different from the surface of the corn pellet treated with zein degrading enzyme. Most of the starch granules in the corn granules of the control group are deeply embedded in the zein matrix, so that the starch-zein cross-linked structure is more compact. And the zein degradation enzyme treatment obviously damages and degrades the zein of the cross-linked starch, so that the starch-zein cross-linked structure is disintegrated, and loose and smooth starch spherical particles are released. These results clearly and intuitively show and verify the degradation of zein by zein degrading enzymes.
Example 8 hydrolysis of Dry ground corn by zein degrading enzymes and synergistic enhancement of Amylase degradation of corn starch
Treatment group: weighing 50mg of dry crushed corn, respectively putting the dry crushed corn into a centrifuge tube, adding 1ml of 0.1M citric acid buffer solution containing 2.8 micrograms of purified zein degrading enzyme, performing shake culture at 40 ℃ for 4, 8 and 12 hours, centrifuging, and measuring the concentration of amino acid released in a supernatant. The solid residue was resuspended in 1mL PBS, amylase was added, incubated at 40 ℃ for 30min, and the released reducing sugar content was determined. The control group was not added with zein degrading enzyme and the other conditions were the same as the treated group, and the results are shown in fig. 7-8. The results show that the zein degrading enzyme increased the amino acid release in the supernatant from 2.5 micromolar at 4h to 6.1 micromolar at 12h as the incubation time was extended compared to the control group (fig. 7), again indicating that the zein degrading enzyme was able to degrade zein in the dry crushed corn. In addition, the reducing sugar produced by the corn residue after the corn residue is treated by the zein degrading enzyme is 83.3 hours (8 hours) and 95.0 micromoles (12 hours) higher than that of the control group (figure 8), which shows that the zein degrading enzyme synergistically promotes the degradation of the corn by the amylase.
The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Sequence listing
<110> university of agriculture in Jiangxi
<120> preparation method and application of zein degrading enzyme
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1032
<212> DNA
<213> Artificial Sequence
<400> 1
attgaatttg atgagagaga tttggcttct gatgaagctt tgtgggattt gtacgagaga 60
tggcaaactc atcacagagt tcatagacat cacggtgaaa agggtagaag atttggtact 120
ttcaaagaga acgctagatt cattcatgct cacaataaga gaggagatag accatataga 180
ttgagattga acagattcgg agatatgggt agagaagagt ttagatctgg tttcgctgat 240
tccagaatta acgatttgag aagagagcca actgctgctc cagctgttcc tggttttatg 300
tacgatgatg ctactgattt gcctagatct gttgattgga gacaaaaggg tgctgttact 360
gctgttaaaa accaaggtag atgtggttct tgttgggctt tctctactgt tgttgctgtt 420
gaaggtatta atgctattag aactggttct ttggtttctt tgtctgaaca agagttgatt 480
gattgtgata ctgatgaaaa cggttgtcaa ggtggtttga tggaaaacgc tttcgagttc 540
attaagtctc atggtggtat tactactgag tctgcttacc cttatcacgc ttctaacggt 600
acttgtgatg gtgctagagc tagaagaggt agagttgttg ctattgatgg tcatcaagct 660
gttccagctg gttctgaaga tgctttggct aaagctgttg ctcaccaacc tgtttctgtt 720
gctattgatg ctggtggtca agctttgcaa ttttactctg agggtgtttt cactggagat 780
tgtggtactg atttggatca cggtgttgct gctgttggtt acggtgtttc tgatgatggt 840
actccatact ggatcgttaa aaattcttgg ggtccttctt ggggtgaagg tggttatatt 900
agaatgcaaa gaggtactgg taacggtggt ttgtgtggta ttgctatgga ggcttctttc 960
ccaattaaga cttctccaaa tccttccaga aaacctagaa gagctttgat tactagagat 1020
gcttcttctc aa 1032
<210> 2
<211> 4570
<212> DNA
<213> Artificial Sequence
<400> 2
agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag 60
gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt 120
tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc 180
agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta 240
acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta 300
tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg 360
agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct 420
gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg 480
ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcggca taccgtttgt 540
cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct 600
ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct 660
ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact 720
gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat 780
atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt 840
actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga 900
caacttgaga agatcaaaaa acaactaatt attcgaaacg atgagatttc cttcaatttt 960
tactgctgtt ttattcgcag catcctccgc attagctgct ccagtcaaca ctacaacaga 1020
agatgaaacg gcacaaattc cggctgaagc tgtcatcggt tactcagatt tagaagggga 1080
tttcgatgtt gctgttttgc cattttccaa cagcacaaat aacgggttat tgtttataaa 1140
tactactatt gccagcattg ctgctaaaga agaaggggta tctctcgaga aaagagaggc 1200
tgaagctgaa ttcattgaat ttgatgagag agatttggct tctgatgaag ctttgtggga 1260
tttgtacgag agatggcaaa ctcatcacag agttcataga catcacggtg aaaagggtag 1320
aagatttggt actttcaaag agaacgctag attcattcat gctcacaata agagaggaga 1380
tagaccatat agattgagat tgaacagatt cggagatatg ggtagagaag agtttagatc 1440
tggtttcgct gattccagaa ttaacgattt gagaagagag ccaactgctg ctccagctgt 1500
tcctggtttt atgtacgatg atgctactga tttgcctaga tctgttgatt ggagacaaaa 1560
gggtgctgtt actgctgtta aaaaccaagg tagatgtggt tcttgttggg ctttctctac 1620
tgttgttgct gttgaaggta ttaatgctat tagaactggt tctttggttt ctttgtctga 1680
acaagagttg attgattgtg atactgatga aaacggttgt caaggtggtt tgatggaaaa 1740
cgctttcgag ttcattaagt ctcatggtgg tattactact gagtctgctt acccttatca 1800
cgcttctaac ggtacttgtg atggtgctag agctagaaga ggtagagttg ttgctattga 1860
tggtcatcaa gctgttccag ctggttctga agatgctttg gctaaagctg ttgctcacca 1920
acctgtttct gttgctattg atgctggtgg tcaagctttg caattttact ctgagggtgt 1980
tttcactgga gattgtggta ctgatttgga tcacggtgtt gctgctgttg gttacggtgt 2040
ttctgatgat ggtactccat actggatcgt taaaaattct tggggtcctt cttggggtga 2100
aggtggttat attagaatgc aaagaggtac tggtaacggt ggtttgtgtg gtattgctat 2160
ggaggcttct ttcccaatta agacttctcc aaatccttcc agaaaaccta gaagagcttt 2220
gattactaga gatgcttctt ctcaatttct agaacaaaaa ctcatctcag aagaggatct 2280
gaatagcgcc gtcgaccatc atcatcatca tcattgagtt tgtagcctta gacatgactg 2340
ttcctcagtt caagttgggc acttacgaga agaccggtct tgctagattc taatcaagag 2400
gatgtcagaa tgccatttgc ctgagagatg caggcttcat ttttgatact tttttatttg 2460
taacctatat agtataggat tttttttgtc attttgtttc ttctcgtacg agcttgctcc 2520
tgatcagcct atctcgcagc tgatgaatat cttgtggtag gggtttggga aaatcattcg 2580
agtttgatgt ttttcttggt atttcccact cctcttcaga gtacagaaga ttaagtgaga 2640
ccttcgtttg tgcggatccc ccacacacca tagcttcaaa atgtttctac tcctttttta 2700
ctcttccaga ttttctcgga ctccgcgcat cgccgtacca cttcaaaaca cccaagcaca 2760
gcatactaaa ttttccctct ttcttcctct agggtgtcgt taattacccg tactaaaggt 2820
ttggaaaaga aaaaagagac cgcctcgttt ctttttcttc gtcgaaaaag gcaataaaaa 2880
tttttatcac gtttcttttt cttgaaattt ttttttttag tttttttctc tttcagtgac 2940
ctccattgat atttaagtta ataaacggtc ttcaatttct caagtttcag tttcattttt 3000
cttgttctat tacaactttt tttacttctt gttcattaga aagaaagcat agcaatctaa 3060
tctaaggggc ggtgttgaca attaatcatc ggcatagtat atcggcatag tataatacga 3120
caaggtgagg aactaaacca tggccaagtt gaccagtgcc gttccggtgc tcaccgcgcg 3180
cgacgtcgcc ggagcggtcg agttctggac cgaccggctc gggttctccc gggacttcgt 3240
ggaggacgac ttcgccggtg tggtccggga cgacgtgacc ctgttcatca gcgcggtcca 3300
ggaccaggtg gtgccggaca acaccctggc ctgggtgtgg gtgcgcggcc tggacgagct 3360
gtacgccgag tggtcggagg tcgtgtccac gaacttccgg gacgcctccg ggccggccat 3420
gaccgagatc ggcgagcagc cgtgggggcg ggagttcgcc ctgcgcgacc cggccggcaa 3480
ctgcgtgcac ttcgtggccg aggagcagga ctgacacgtc cgacggcggc ccacgggtcc 3540
caggcctcgg agatccgtcc cccttttcct ttgtcgatat catgtaatta gttatgtcac 3600
gcttacattc acgccctccc cccacatccg ctctaaccga aaaggaagga gttagacaac 3660
ctgaagtcta ggtccctatt tattttttta tagttatgtt agtattaaga acgttattta 3720
tatttcaaat ttttcttttt tttctgtaca gacgcgtgta cgcatgtaac attatactga 3780
aaaccttgct tgagaaggtt ttgggacgct cgaaggcttt aatttgcaag ctggagacca 3840
acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt 3900
ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt 3960
ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc 4020
gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa 4080
gcgtggcgct ttctcaatgc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct 4140
ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta 4200
actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg 4260
gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc 4320
ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta 4380
ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg 4440
gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt 4500
tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg 4560
tcatgagatc 4570
<210> 3
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 3
gatttgtacg agagatggc 19
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 4
tctggaagga tttggagaag tc 22
Claims (6)
1. A preparation method of zein degrading enzyme is characterized by comprising the following specific steps:
(1) optimizing zein degrading enzyme genes;
(2) constructing a recombinant expression vector pPICZ alpha A-ZDP;
(3) transforming the recombinant expression vector pPICZ alpha A-ZDP into pichia pastoris to obtain positive clones, and culturing;
(4) centrifuging the cultured bacterial liquid to obtain culture supernatant; and (4) carrying out affinity chromatography purification to obtain the purified zein degrading enzyme.
2. The preparation method of zein degrading enzyme according to claim 1, characterized in that, in step (1), zein degrading enzyme gene is optimized according to codon preference of pichia pastoris and pPICZ alpha A vector characteristics, and the optimized gene segment is SEQ ID No. 1.
3. The method for preparing zein degrading enzyme according to claim 2, wherein the specific steps of constructing the recombinant expression vector pPICZ α A-ZDP in step (2) are as follows: carrying out double enzyme digestion on the zein degrading enzyme gene segment and the expression plasmid pPICZ alpha A by using EcoR I and Xba I restriction endonucleases respectively; recovering zein degrading enzyme gene fragments and pPICZ alpha A plasmid fragments from glue; taking 4 mul of target fragment of zein degrading enzyme, 5 mul of T4 ligase and buffer, uniformly mixing 1 mul of purified pPICZ alpha A carrier, and incubating overnight in a circulating water bath at 16 ℃; transforming an escherichia coli competent cell DH5 alpha, and screening positive clones in an LB culture medium containing Amp; and (3) selecting white colonies, adding the white colonies into a liquid LB culture medium containing Amp, shaking at 37 ℃ for overnight culture, extracting a recombinant expression vector plasmid pPICZ alpha A-ZDP after the culture medium is turbid, and performing enzyme digestion verification.
4. The method for preparing zein degrading enzyme according to claim 3, wherein the step (3) of transforming Pichia pastoris comprises the following steps: carrying out enzyme digestion on the recombinant expression vector pPICZ alpha A-ZDP by using restriction enzyme SacI, and purifying an enzyme digestion product; transferring the purified expression vector pPICZ alpha A-ZDP into a Pichia pastoris X33 competent cell, culturing in a YPD culture medium containing bleomycin, and screening positive clones through PCR amplification reaction; selecting 1 white colony of the positive clone, adding the white colony into 2mL YPD culture medium, and shaking at 30 ℃ and 160rpm for overnight culture; all the bacterial liquid was transferred to 200mL BMGY medium, and cultured overnight at 30 ℃ with shaking for use in fermenter culture.
5. Use of a zein degrading enzyme as claimed in any of claims 1 to 4 in the hydrolysis of zein.
6. Use of a zein degrading enzyme as claimed in any of claims 1 to 4 in promoting the degradation of corn starch by amylase.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010852694.7A CN112048518B (en) | 2020-08-22 | 2020-08-22 | Preparation method and application of zein degrading enzyme |
| NL2026932A NL2026932B1 (en) | 2020-08-22 | 2020-11-19 | Preparation method for zein-degrading protease and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010852694.7A CN112048518B (en) | 2020-08-22 | 2020-08-22 | Preparation method and application of zein degrading enzyme |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112048518A true CN112048518A (en) | 2020-12-08 |
| CN112048518B CN112048518B (en) | 2022-06-24 |
Family
ID=73599564
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010852694.7A Active CN112048518B (en) | 2020-08-22 | 2020-08-22 | Preparation method and application of zein degrading enzyme |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN112048518B (en) |
| NL (1) | NL2026932B1 (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH1017595A (en) * | 1996-07-01 | 1998-01-20 | Sanei Touka Kk | Modified zein and its production |
| US20060121573A1 (en) * | 2004-11-29 | 2006-06-08 | Margarita Torrent | Production of proteins |
| CN101096696A (en) * | 2007-07-06 | 2008-01-02 | 山东天久生物技术有限公司 | Industrial production method of corn protein polypeptide from corn protein powder by enzymatical process |
| CN102505034A (en) * | 2011-12-02 | 2012-06-20 | 安徽燕之坊食品有限公司 | Method for preparing active polypeptide from corn protein powder |
| CN102753680A (en) * | 2009-12-11 | 2012-10-24 | 诺维信公司 | Protease variants |
| CN105063138A (en) * | 2015-09-14 | 2015-11-18 | 河南省科学院生物研究所有限责任公司 | Method for producing trametes versicolor immunomodulatory protein by virtue of pichia pastoris expression system |
| CN110029123A (en) * | 2019-04-03 | 2019-07-19 | 江西农业大学 | The method and application of Yeast expression carrier building and expression circumscribed-type cellulase |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE10105911A1 (en) * | 2001-02-09 | 2002-08-14 | Roche Diagnostics Gmbh | Expression of the recombinant proteinase K from Tritirachium album in yeast |
| WO2008033995A2 (en) * | 2006-09-15 | 2008-03-20 | Monsanto Technology Llc. | Methods for increasing the fermentability of plant material to yield ethanol |
| JP2019534691A (en) * | 2016-09-23 | 2019-12-05 | デュポン ニュートリション バイオサイエンシス エーピーエス | Use of low pH active alpha-1,4; / 1,6-glycoside hydrolase as a feed additive for ruminants to promote starch digestion |
-
2020
- 2020-08-22 CN CN202010852694.7A patent/CN112048518B/en active Active
- 2020-11-19 NL NL2026932A patent/NL2026932B1/en active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH1017595A (en) * | 1996-07-01 | 1998-01-20 | Sanei Touka Kk | Modified zein and its production |
| US20060121573A1 (en) * | 2004-11-29 | 2006-06-08 | Margarita Torrent | Production of proteins |
| CN101096696A (en) * | 2007-07-06 | 2008-01-02 | 山东天久生物技术有限公司 | Industrial production method of corn protein polypeptide from corn protein powder by enzymatical process |
| CN102753680A (en) * | 2009-12-11 | 2012-10-24 | 诺维信公司 | Protease variants |
| CN102505034A (en) * | 2011-12-02 | 2012-06-20 | 安徽燕之坊食品有限公司 | Method for preparing active polypeptide from corn protein powder |
| CN105063138A (en) * | 2015-09-14 | 2015-11-18 | 河南省科学院生物研究所有限责任公司 | Method for producing trametes versicolor immunomodulatory protein by virtue of pichia pastoris expression system |
| CN110029123A (en) * | 2019-04-03 | 2019-07-19 | 江西农业大学 | The method and application of Yeast expression carrier building and expression circumscribed-type cellulase |
Non-Patent Citations (1)
| Title |
|---|
| DEBARROS, EG等: "Cloning of a cDNA encoding a putative cysteine protease from germinating maize seeds", 《PLANT SCIENCE》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| NL2026932B1 (en) | 2021-07-20 |
| CN112048518B (en) | 2022-06-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110551752B (en) | xCas9n-epBE base editing system and application thereof in genome base replacement | |
| CN107119063B (en) | Method for increasing cordycepin content in cordyceps militaris | |
| KR102056250B1 (en) | Recombinant cell and production method for isoprene | |
| CN109912720B (en) | Design and synthesis method and spinning of spider silk protein | |
| CN101565680B (en) | Mycoplasma hyopneumoniae P97R1 gene recombined Pichia pastoris and expression protein | |
| CN110760538B (en) | Method for creating fusarium wilt-resistant watermelon seed material | |
| CN112126658A (en) | Plant over-expressed luciferase reporter gene recombinant vector, construction method and application | |
| CN111592990A (en) | Recombinant expression strain of feruloyl esterase, preparation method and application thereof | |
| CN110656114A (en) | Tobacco pigment synthesis related gene and application thereof | |
| CN112048518B (en) | Preparation method and application of zein degrading enzyme | |
| CN110656122A (en) | Method for increasing yield of nortetracycline | |
| KR101608078B1 (en) | Strain for producing succinate from carbon dioxide and method for succinate production using the strain | |
| CN107142274A (en) | A kind of method that cecropin antimicrobial peptides are overexpressed in Cordyceps militaris | |
| CN109485707B (en) | Application of protein OsVPE1 in regulation and control of inorganic phosphorus output capacity of plant vacuole | |
| CN109232726B (en) | Application of protein OsVPE2 in regulation and control of inorganic phosphorus output capacity of plant vacuole | |
| CN107058368A (en) | A kind of method that plectasin antibacterial peptide is overexpressed in Cordyceps militaris | |
| CN115058439A (en) | Rhododendron micranthum SAMT gene overexpression vector and construction method and application thereof | |
| KR20180029450A (en) | Gluconacetobacter genus microorganism having enhanced cellulose productivity, method for producing cellulose using the same, and method for producing the microorganism | |
| CN108841862A (en) | A kind of construction method of plant expression plasmid carrier containing HA protein fusion label and its carrier | |
| CN104237508A (en) | Mycobacterium tuberculosis detecting kit and application thereof | |
| CN113122516B (en) | Plant EPSPS mutant and application thereof in plants | |
| CN111394385A (en) | Method for rapidly identifying bidirectional promoter of rice | |
| CN115466319A (en) | Sorghum SbMS1 protein and coding gene and application thereof | |
| CN109337925B (en) | Method for improving artemisinin content in artemisia annua by using AaADS-transferred gene taking artemisia annua suspension cell line as receptor | |
| CN113281521B (en) | Gateway binary plasmid vector for rapidly identifying plant stress particle associated protein, and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |