CN113281521B - Gateway binary plasmid vector for rapidly identifying plant stress particle associated protein, and construction method and application thereof - Google Patents
Gateway binary plasmid vector for rapidly identifying plant stress particle associated protein, and construction method and application thereof Download PDFInfo
- Publication number
- CN113281521B CN113281521B CN202110548048.6A CN202110548048A CN113281521B CN 113281521 B CN113281521 B CN 113281521B CN 202110548048 A CN202110548048 A CN 202110548048A CN 113281521 B CN113281521 B CN 113281521B
- Authority
- CN
- China
- Prior art keywords
- seq
- vector
- plasmid vector
- nucleotide sequence
- pab2
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6486—Measuring fluorescence of biological material, e.g. DNA, RNA, cells
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Hematology (AREA)
- General Physics & Mathematics (AREA)
- Urology & Nephrology (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Biotechnology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention belongs to the field of crop genetic engineering, and particularly relates to a Gateway binary plasmid vector for rapidly identifying plant stress particle-associated protein, and a construction method and application thereof. The vector comprises a PAB2 expression frame (shown in SEQ ID NO.1 from 27 th to 3954 th), a Super-GW-GFP-3Flag expression frame (shown in SEQ ID NO.1 from 3973 rd to 7869 th) and a herbicide Basta resistance gene expression frame (shown in SEQ ID NO.1 from 14581 th to 15729 th). The invention also provides a recombinant vector constructed by using the plasmid vector, and application of the recombinant vector in tobacco leaves and model plant Arabidopsis. The plasmid vector can rapidly and efficiently identify whether the target protein is a stress particle component, and can successfully obtain a stable expression transgenic plant with double fluorescence localization.
Description
Technical Field
The invention belongs to the field of crop genetic engineering, and particularly relates to a Gateway binary plasmid vector for rapidly identifying plant stress particle-associated protein, and a construction method and application thereof.
Background
Global warming causes frequent occurrence of high-temperature weather, seriously influences the growth and development of plants and seriously reduces the yield of crops. High temperature has become an important environmental factor influencing the growth and development of plants, and the analysis of the tolerance mechanism of the plants to the high temperature becomes a scientific problem to be solved urgently at present. The current mechanism for the tolerance of plants to high temperature is mainly focused on the transcriptional activation of heat shock transcription factors. However, the gene transcription level changes for a longer time than it takes to rapidly cope with stress. To address this challenge, plant cells have evolved another protection mechanism-the formation of stress granules (stress granules).
The formation of stress granules is an important post-transcriptional and translational regulation mechanism, and when eukaryotic cells are stimulated by external stress, non-envelope coated compact granules consisting of translation initiation factors, mRNAs, Poly (A) binding protein, RNA binding protein and the like are formed in cytoplasm, namely the stress granules. In mammalian and yeast cells, the formation of stress particles is closely related to neurodegenerative diseases, cancer cell death, viral infection, immune response, apoptosis, inflammatory response, and the like. Research shows that the formation of stress particles of plant cells can enhance the high temperature sensitivity of plants, and suggests that the formation of the stress particles plays an important role in adapting the high temperature stress of the plants. However, the mechanism of formation, composition and biological function of stress particles in plants is still poorly understood.
The formation of stress particles serves as a protective pathway for the cell to resist external adverse conditions, minimizing damage during cellular stress, which triggers a process that results in the inhibition of translation of most mRNAs, which are then released and translated when stress is removed, and reprogramming which allows the cell to conserve energy and maintain cellular homeostasis. At present, the components and biological functions of stress particles in mammalian and yeast cells have been reported largely, but the research in plants is still few, and no binary plasmid vector capable of identifying and analyzing plant stress particle proteins rapidly and with high throughput exists.
Disclosure of Invention
The invention aims to provide a binary Gateway binary plasmid vector pSGRB7FWG2 for rapid, efficient and high-throughput analysis of stress particles and provides a powerful tool for accelerating the research of plant stress particles aiming at the defects of the prior art.
In a first aspect of the invention, a Gateway binary plasmid vector for rapidly identifying plant stress particle-associated protein is provided, wherein the plasmid vector is pSGRB7FWG2, and the nucleotide sequence of the plasmid vector is shown as SEQ ID NO. 1.
Further, the vector comprises a PAB2 expression frame, a Super-GW-GFP-3Flag expression frame and a herbicide Basta resistance gene expression frame, wherein the nucleotide sequence of the PAB2 expression frame is shown as 27 th to 3954 th positions of SEQ ID No. 1; the nucleotide sequence of the Super-GW-GFP-3Flag expression cassette is shown as position 3973 to 7869 of SEQ ID No. 1; the nucleotide sequence of the expression frame of the herbicide Basta resistance gene is shown as 14581-15729 of SEQ ID No. 1.
Further, the PAB2 expression cassette includes: 35S promoter, the nucleotide sequence of which is shown as 2927 to 3954 of SEQ ID No. 1; the nucleotide sequence of the PAB2 gene is shown as the 986 th to 2872 th positions of Seq ID No. 1; a coding sequence of red fluorescent protein RFP, the nucleotide sequence of which is shown as 274 th to 952 th positions of SEQ ID No. 1; and a T35S terminator, the nucleotide sequence of which is shown as SEQ ID No.1, positions 27 to 252;
further, the Super-GW-GFP-3Flag expression cassette comprises: a Super promoter, the nucleotide sequence of which is shown in positions 3973 to 5105 of Seq ID No. 1; the ccdB sequence has the nucleotide sequence as shown in positions 6346 to 6651 of SEQ ID No. 1; a GFP-3Flag sequence, the nucleotide sequence of which is shown as 6818 th to 7600 th positions of SEQ ID No. 1; the nucleotide sequence of the NOS terminator is shown as positions 7617 to 7869 of SEQ ID No. 1.
Still further, the vector further comprises: a left border sequence and a right border sequence of T-DNA, wherein the nucleotide sequence of the left border sequence is shown as 14245 th to 14577 th positions of SEQ ID No.1, the nucleotide sequence of the right border sequence is shown as 7887 th to 8086 th positions of SEQ ID No.1, and the PAB2 expression box, the Super-GW-GFP-3Flag expression box and the herbicide Basta resistance gene expression box are positioned between the left border sequence and the right border sequence.
In a second aspect of the present invention, there is provided a method for constructing a Gateway binary plasmid vector for rapidly identifying a plant stress particle-associated protein, comprising the steps of:
s1, digesting a binary plasmid vector PAB2-PB7RWG2 by using a restriction enzyme SacI, wherein the PAB2-PB7RWG2 is obtained by constructing a CDS sequence of a PAB2 gene into an entry vector pDONR221 vector through a BP reaction and then connecting the CDS sequence to a pB7RWG2 vector through an LR reaction;
s2, taking a plasmid vector pSuper-GW-GFP-3Flag as a template, and carrying out PCR (polymerase chain reaction) by using a primer SG-Maker-F: gaccatatgggagagctcgcccggttattgttaagctc and SG-Maker-R: caagctcaagctaagcttatgattacgaattcccgatc amplifying Super-GW-GFP-3Flag reading frame;
s3, connecting the Super-GW-GFP-3Flag reading frame to the PAB2-PB7RWG2 plasmid, transforming Escherichia coli DB3.1 competent cells, screening target clones in a spectinomycin Spe resistant LB plate, and finally completing the construction of a target plasmid vector pSGRB7FWG2 through PCR verification and sequencing analysis.
In a third aspect of the present invention, there is provided an application of the Gateway binary plasmid vector for rapidly identifying a plant stress particle-associated protein in identifying a stress particle in an epidermal cell or a protoplast of a plant leaf, comprising: connecting a target gene to a Gateway entry vector and sequencing, carrying out LR reaction of Gateway cloning on the correctly sequenced Gateway entry vector containing the target gene and a binary plasmid vector pSGRB7FWG2, transforming a reaction product into escherichia coli DH5 alpha competent cells, screening target clones in a spectinomycin Spe resistant LB plate, verifying through PCR, completing construction of a recombinant vector, expressing the recombinant vector in tobacco leaf epidermal cells or protoplasts through agrobacterium-mediated or other-mediated transient transformation, analyzing through a laser confocal microscope, and determining whether the target protein is a stress particle component or not under normal conditions and adversity stress conditions according to the fluorescent co-localization condition of the target protein and the PAB2 protein.
Further, the Gateway entry vector is pDONR 207.
Further, the plants include, but are not limited to, tobacco, Arabidopsis, rice, and maize.
In a fourth aspect of the present invention, there is provided an application of the Gateway binary plasmid vector for rapidly identifying a plant stress particle-associated protein in the preparation of heat-tolerant or heat-sensitive plants, ABA, NaCl-tolerant or sensitive plants, including but not limited to tobacco, arabidopsis thaliana, rice and corn.
Compared with the prior art, the invention has the following beneficial effects:
the invention relates to a Gateway binary plasmid vector for rapidly identifying plant stress particle-associated proteins, which comprises a PAB2 expression frame, a Super-GW-GFP-3Flag expression frame and a herbicide Basta resistance gene expression frame, and the two are positioned between a left border sequence and a right border sequence of T-DNA of the same binary vector. The PAB2 expression frame is composed of 35S promoter, PAB2 gene coding sequence, red fluorescent protein RFP coding sequence and T35S terminator in turn; the Super-GW-GFP-3Flag expression frame is composed of a Super promoter, a ccdB coding sequence, a GFP-3Flag coding sequence and an NOS terminator in sequence. The invention also provides a recombinant vector containing a target sequence constructed by using the plasmid vector, and application of the recombinant vector in tobacco leaves and model plant Arabidopsis. The plasmid vector can rapidly and efficiently identify whether the target protein is a stress particle component, and can successfully obtain a stable expression plant with double fluorescence localization.
Drawings
FIG. 1 is a mapping of Gateway binary plasmid vector pSGRB7FWG2 of the present invention
FIG. 2 is a map of the targeting vector pSGRB7FWG2-Gene A of example 2 of the present invention;
FIG. 3 is a graph showing the transient expression of the target vector pSGRB7FWG2-Gene A in epidermal cells of tobacco leaves, normal status and co-localization of Gene A and PAB2 after heat shock treatment, which are obtained from example 3 of the present invention, wherein columns A, B and C are the GFP fluorescence of GeneA, the RFP fluorescence of PAB2, and the GFP and RFP are superimposed on each other.
FIG. 4 is a diagram showing the case where the target vector pSGRB7FWG2-Gene A of example 3 of the present invention is stably expressed in Arabidopsis plants, and the co-localization of Gene A and PAB2 was analyzed by confocal laser microscopy for normal conditions and after heat shock treatment, in which columns A, B and C are the GFP fluorescence of GeneA, the RFP fluorescence of PAB2, and the GFP and RFP are superimposed on each other, respectively.
Detailed Description
The invention is described in detail below with reference to the figures and the specific embodiments, but the invention should not be construed as being limited thereto. The technical means used in the following examples are conventional means well known to those skilled in the art, and materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Biological material information: a Gateway binary plasmid vector pSGRB7FWG2 for quickly identifying the stress particle associated protein of plant.
As shown in FIG. 1, the binary plasmid vector provided by the invention comprises a PAB2 expression frame, a Super-GW-GFP-3Flag expression frame and a herbicide Basta resistance gene expression frame. The nucleotide sequence of the PAB2 expression cassette is shown as the 27 th to 3954 th positions of SEQ ID No. 1; the nucleotide sequence of the Super-GW-GFP-3Flag expression cassette is shown as 3973 to 7869 of SEQ ID No. 1; the nucleotide sequence of the expression frame of the herbicide Basta resistance gene is shown as 14581-15729 of SEQ ID No. 1.
The PAB2 expression cassette includes: 35S promoter, the nucleotide sequence of which is shown as 2927 to 3954 of SEQ ID No. 1; the nucleotide sequence of the PAB2 gene is shown as 986 th to 2872 th positions of SEQ ID No. 1; a red fluorescent protein RFP coding sequence, the nucleotide sequence of which is shown as 274 th to 952 th positions of SEQ ID No. 1; and a T35S terminator, the nucleotide sequence of which is shown as position 27 to 252 of SEQ ID No. 1.
The Super-GW-GFP-3Flag expression box comprises: a Super promoter, the nucleotide sequence of which is shown in the positions 3973 to 5105 of SEQ ID No. 1; the ccdB sequence has the nucleotide sequence as shown in positions 6346 to 6651 of SEQ ID No. 1; a GFP-3Flag sequence, the nucleotide sequence of which is shown as 6818 th to 7600 th positions of SEQ ID No. 1; the nucleotide sequence of the NOS terminator is shown in positions 7617 to 7869 of SEQ ID No. 1.
The plasmid vector further comprises: a left border sequence and a right border sequence of T-DNA, wherein the nucleotide sequence of the left border sequence is shown as 14245 th to 14577 th positions of SEQ ID No.1, the nucleotide sequence of the right border sequence is shown as 7887 th to 8086 th positions of SEQ ID No.1, the PAB2 expression box, the Super-GW-GFP-3Flag expression box and the herbicide Basta resistance gene expression box. Between the left border sequence and the right border sequence.
As shown in FIG. 2, a Gene Gene A (GENE ID: AT3G 13460) of the present example was constructed into pSGRB7FWG2 vector by LR reaction of Gateway cloning to form a target vector map pSGRB7FWG2-Gene A.
The invention provides application of a Gateway binary plasmid vector pSGRB7FWG2 for rapidly identifying plant stress particle-associated protein in tobacco to identifying stress particle-associated protein, wherein the target Gene A can be transiently co-expressed in tobacco leaf epidermal cells with PAB2, and forms stress particles co-located with PAB2 under heat shock stress.
The invention provides application of a Gateway binary plasmid vector pSGRB7FWG2 for rapidly identifying plant stress particle-related protein in arabidopsis thaliana, wherein the target Gene A can be stably co-expressed in arabidopsis thaliana plants together with PAB2, and forms stress particles co-located with PAB2 under heat shock stress.
Example 1
The construction of Gateway binary plasmid vector for fast identification of plant stress particle associated protein includes the following steps:
1) the binary plasmid vector PAB2-PB7RWG2 is cut by using a restriction enzyme SacI; 2) taking the existing plasmid vector pSuper-GW-GFP-3Flag as a template, and using a primer SG-Maker-F: gaccatatgggagagctcgcccggttattgttaagctc (SEQ ID NO. 2) and SG-Maker-R: caagctcaagctaagcttatgattacgaattcccgatc (SEQ ID NO. 3) amplifying the Super-GW-GFP-3Flag reading frame; 3) the Super-GW-GFP-3Flag reading frame is connected to the PAB2-PB7RWG2 plasmid by utilizing a Novozan homologous recombination Kit (Clonexpress II One Step Cloning Kit, the cargo number C112-01) and escherichia coli DB3.1 competent cells are transformed, target clones are screened in a spectinomycin Spe resistant LB plate, and the construction of a target plasmid vector pSGRB7FWG2 is finally completed through PCR verification and sequencing analysis.
Example 2
Construction of binary plasmid vector pSGRB7FWG2-Gene A, the procedure was as follows:
the LR reaction of Gateway clones was performed by pDONR207-Gene A ligated to the Gateway entry vector and sequenced correctly with the Gateway binary plasmid vector pSGRB7FWG2 in example 1, the reaction product transformed into competent cells of E.coli DH 5. alpha. and the target clones were selected on spectinomycin Spe resistant LB plates and verified by PCR to complete the construction of the target plasmid vector pSGRB7FWG2-Gene A.
Example 3
The application of binary plasmid vector pSGRB7FWG2-Gene A comprises the following steps:
1) transforming Agrobacterium GV3101 competent cells with the constructed plasmid vector of interest pSGRB7FWG2-GenEA and selecting clones of interest in spectinomycin Spe and rifampicin Rif resistant LB plates, culturing the correct clones with 20ml LB liquid medium overnight and centrifuging the supernatant;
2a) for tobacco injection: the mycelia were impregnated with an equal volume of tobacco injection-staining solution (10 mM MES (pH 5.6), 200. mu.M acetosyringone, 10 mM MgCl2) Resuspending, standing in dark at room temperature for 3 hours, injecting the resuspension into Benshi tobacco leaves of about one month by using a 1ml syringe, and performing fluorescence observation by using a laser confocal microscope after normal culture for 3 days; 2b) for arabidopsis infection: the cells were infected with an equal volume of Arabidopsis genetic transformation (5% sucrose, 0.05% Silrwet L-77, 0.01M MgCl)2) And (3) carrying out arabidopsis dropping infection after resuspension, wrapping infected arabidopsis plants by using a preservative film, keeping the fresh from light and keeping the moisture overnight, carrying out normal culture, carrying out infection again after 1 week, carrying out Basta screening on T1 generation seeds after the seeds are mature, and carrying out fluorescence observation on obtained positive strains.
Tobacco and positive lines were treated as follows:
tobacco: after 3 days of normal culture after the completion of tobacco injection, a small piece (about 0.5 cm. times.0.5 cm) of the leaf was removed with scissors and placed in 1/2MS medium, and after heat shock in a water bath at 39 ℃ for 60min, fluorescence observation was performed.
Positive lines: taking 4-6 days arabidopsis thaliana plantlets normally cultured in 1/2MS, wrapping the plantlets with a sealing film, carrying out heat shock on the plantlets together with a 1/2MS culture dish in a water bath at 39 ℃ for 60min, and carrying out fluorescence observation.
The results are shown in fig. 3 and 4, and show that: in tobacco epidermal cells, the proteins encoded by GeneA are normally localized mainly in the nucleus and cytoplasm, PAB2 is localized mainly in the cytoplasm, and after heat shock stress GeneA is able to co-localize with PAB2 in the stress granule, suggesting that the proteins encoded by GeneA are a component of the stress granule (fig. 3); similarly, in arabidopsis root apical meristem cells, the protein encoded by GeneA is normally localized mainly in the nucleus and cytoplasm, PAB2 is localized mainly in the cytoplasm, and after heat shock stress GeneA is able to co-localize with PAB2 in the stress granule, suggesting that the protein encoded by GeneA is a component of the stress granule (fig. 4).
While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.
It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.
Sequence listing
<110> university of Henan
<120> Gateway binary plasmid vector for rapidly identifying plant stress particle associated protein, construction method and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 15762
<212> DNA
<213> Artificial sequence
<400> 1
cgacgtcgcc gacgtcgcat gcctgcaggt cactggattt tggttttagg aattagaaat 60<>
tttattgata gaagtatttt acaaatacaa atacatacta agggtttctt atatgctcaa 120<>
cacatgagcg aaaccctata agaaccctaa ttcccttatc tgggaactac tcacacatta 180<>
ttctggagaa aaatagagag agatagattt gtagagagag actggtgatt tttgcggact 240<>
ctagcatggc cgctcccggc cgccatggcc gcggttaggc gccggtggag tggcggccct 300<>
cggcgcgctc gtactgttcc acgatggtgt agtcctcgtt gtgggaggtg atgtccagct 360<>
tgatgtcggt cttgtaggcg ccgggcagct gcacgggctt cttggccatg taggtggtct 420<>
tgacctcggc gtcgtagtgg ccgccgtcct tcagcttcag cctcatcttg atctcgccct 480<>
tcagggcgcc gtcctcgggg tacatccgct cggtggaggc ctcccagccc atggtcttct 540<>
tctgcattac ggggccgtcg gaggggaagt tggtgccgcg cagcttcacc ttgtagatga 600<>
actcgccgtc ctgcagggag gagtcctggg tcacggtcac cacgccgccg tcctcgaagt 660<>
tcatcacgcg ctcccacttg aagccctcgg ggaaggacag cttcaagtag tcggggatgt 720<>
cggcggggtg cttcacgtag gccttggagc cgtactggaa ctgaggggac aggatgtccc 780<>
aggcgaaggg cagggggccg cccttggtca ccttcagctt ggcggtctgg gtgccctcgt 840<>
aggggcggcc ctcgccctcg ccctcgatct cgaactcgtg gccgttcacg gagccctcca 900<>
tgcgcacctt gaagcgcatg aactccttga tgacgtcctc ggaggaggcc attgatatca 960<>
ccactttgta caagaaagct gggtcagaga ggttcaagga agcgagctgc tcggttgcac 1020<>
caccagcagc gacactcctg agaacatcca tagcctctgc aactttggcc ttgagagctt 1080<>
ctggtgactc caacagatgg agcacttcag tctggtccat ctccaaaagc atcccagtca 1140<>
ctttggctgc agactctgcc tcaacctgct ccaccaacgg gtacagcacc tcacccagca 1200<>
tcgtcctctg ttgctctgga gtagcattag acagatttga agccaaagct ccaatagtca 1260<>
atggcatgtt gttgcccata tcatatggag gcacatcacc actaccacca cgcccttggg 1320<>
gataccggaa catccgaccc cttggatgca tctgttgctg catcatggga ttttgctgct 1380<>
gggagtgttg gattccccca ggacgtcttc ctcctccagg acgctgctgc tgtggctgaa 1440<>
ccataggcat gaagaaactg ggtacaggac ccccaccagg tctcattcca ggaacaagct 1500<>
gctgttggta tccataccca ggctggggag gaatcatggc aggaggggcc tgaccataga 1560<>
acatttgttg tccaatacca ggaccacccg ggggatacac tggcatgcgg ggaccaacag 1620<>
acggctgcat tgcaactggc ctcacttggg aaaactgagc ctgtagtctg acccttctgt 1680<>
cttccttccg ctgtgcaata gccacataga gtggcttgct ttcgatcatt ttaccgctca 1740<>
actgtgacat agcttcagtt gcttcttcgg gagttgcgaa agcaacaaaa cctgagcctt 1800<>
tgcttgttcc attaggatcc cgcatcacct tgctagatgt aacggtacca aaaggagaaa 1860<>
agatctcttt aagtttctca tctgaaatgc taggatccaa attcttaaca tacaagtttg 1920<>
aactttgaaa cttgtctgca gcttccttca aattctgttc ataacggacc cttaattctg 1980<>
tttccctctc tgacttcttc tgggctctac caacatacca ctccttatca tcaaatttgt 2040<>
gcccattgag agactccaca gccctagcag catcatcagc attttcaaag ttgacaaacc 2100<>
caaagccctt ggacttccct tctccatctt tcatcacgac agcacttgtt atctttccat 2160<>
actcgccaaa agcattcttc aagtcatcat cggtagtact ttccgcgaga ttcttcacat 2220<>
acacattggt gaatttcgtt ttgttagcag tggagtctct ttcttgtctc ctcaggaaag 2280<>
gacccacata cacttgcttg tcattgagca acatgccgtt cagtttctct atagctttct 2340<>
gggcagattc ttcattggcg tattgcacaa acccatagcc ttttgactgg cctgaagaat 2400<>
cgacagctac cttgcacgac acaatgtttc caaacgatga aaaagtatca tgcagtgctt 2460<>
tgtggtcgat ggactcgtcc aaattcttaa taaaaatgtt gccagcgcca cttcggcgaa 2520<>
cactaggatc acgatgagaa tacataaccc taataggttt tccataaaga ggtatgtaat 2580<>
tcagttcttg gatcgctctt gcagcgtctt ggggattggt gaagttaacg tatccatagc 2640<>
caagagatcg gcgagtgacc aaatccctac agacacgaac ggtgaccaca gtacccattt 2700<>
ggccaaacgc atcgaaaagc tgcgagtccg tcacattgaa atcgagatcc cccacataaa 2760<>
gcgacgtgtt accaaactgg gtcgccgttg ctccacctga cgtcgccgga gcagaagtga 2820<>
ccgccgcggt cgaaccattc ggagtctgac cctgaagttg aacctgcgcc atggagcctg 2880<>
cttttttgta caaacttgtg atatcactag tgcggccgcc tgcaggtcga ctagaatagt 2940<>
aaattgtaat gttgtttgtt gtttgttttg ttgtggtatt gttgtaaaaa taccggagtc 3000<>
ctctccaaat gaaatgaact tccttatata gaggaagggt cttgcgaagg atagtgggat 3060<>
tgtgcgtcat cccttacgtc agtggagata tcacatcaat ccacttgctt tgaagacgtg 3120<>
gttggaacgt cttctttttc cacgatgctc ctcgtgggtg ggggtccatc tttgggacca 3180<>
ctgtcggcag aggcatcttg aacgatagcc tttcctttat cgcaatgatg gcatttgtag 3240<>
gtgccacctt ccttttctac tgtccttttg atgaagtgac agatagctgg gcaatggaat 3300<>
ccgaggaggt ttcccgatat taccctttgt tgaaaagtct caatagccct ttggtcttct 3360<>
gagactgtat ctttgatatt cttggagtag acgagagtgt cgtgctccac catgttgacg 3420<>
aagattttct tcttgtcatt gagtcgtaaa agactctgta tgaactgttc gccagtcttc 3480<>
acggcgagtt ctgttagatc ctcgatctga atttttgact ccatggcctt tgattcagta 3540<>
ggaactactt tcttagagac tccaatctct attacttgcc ttggtttatg aagcaagcct 3600<>
tgaatcgtcc atactggaat agtacttctg atcttgagaa atatatcttt ctctgtgttc 3660<>
ttgatgcagt tagtcctgaa tcttttgact gcatctttaa ccttcttggg aaggtatttg 3720<>
atctcctgga gattattact cgggtagatc gtcttgatga gacctgccgc gtaggcctct 3780<>
ctaaccatct gtgggtcagc attctttctg aaattgaaga ggctaatctt ctcattatcg 3840<>
gtggtgaaca tggtatcgtc accttctccg tcgaactttc ttcctagatc gtagagatag 3900<>
agaaagtcgt ccatggtgat ctccggggca aaggagatca gcttggctct agtcgaccat 3960<>
atgggagagc tcgcccggtt attgttaagc tcgcggatcc tgaagcgacg ttggatgtta 4020<>
acatctacaa attgcctttt cttatcgacc atgtacgtaa gcgcttacgt ttttggtgga 4080<>
cccttgagga aactggtagc tgttgtgggc ctgtggtctc aagatggatc attaatttcc 4140<>
accttcacct acgatggggg gcatcgcacc ggtgagtaat attgtacggc taagagcgaa 4200<>
tttggcctgt aggatccctg aaagcgacgt tggatgttaa catctacaaa ttgccttttc 4260<>
ttatcgacca tgtacgtaag cgcttacgtt tttggtggac ccttgaggaa actggtagct 4320<>
gttgtgggcc tgtggtctca agatggatca ttaatttcca ccttcaccta cgatgggggg 4380<>
catcgcaccg gtgagtaata ttgtacggct aagagcgaat ttggcctgta ggatccctga 4440<>
aagcgacgtt ggatgttaac atctacaaat tgccttttct tatcgaccat gtacgtaagc 4500<>
gcttacgttt ttggtggacc cttgaggaaa ctggtagctg ttgtgggcct gtggtctcaa 4560<>
gatggatcat taatttccac cttcacctac gatggggggc atcgcaccgg tgagtaatat 4620<>
tgtacggcta agagcgaatt tggcctgtag gatccgcgag ctggtcaatc ccattgcttt 4680<>
tgaagcagct caacattgat ctctttctcg atcgagggag atttttcaaa tcagtgcgca 4740<>
agacgtgacg taagtatccg agtcagtttt tatttttcta ctaatttggt cgtttatttc 4800<>
ggcgtgtagg acatggcaac cgggcctgaa tttcgcgggt attctgtttc tattccaact 4860<>
ttttcttgat ccgcagccat taacgacttt tgaatagata cgctgacacg ccaagcctcg 4920<>
ctagtcaaaa gtgtaccaaa caacgcttta cagcaagaac ggaatgcgcg tgacgctcgc 4980<>
ggtgacgcca tttcgccttt tcagaaatgg ataaatagcc ttgcttccta ttatatcttc 5040<>
ccaaattacc aatacattac actagcatct gaatttcata accaatctcg atacaccaaa 5100<>
tcgactctag aacaagtttg tacaaaaaag ctgaacgaga aacgtaaaat gatataaata 5160<>
tcaatatatt aaattagatt ttgcataaaa aacagactac ataatactgt aaaacacaac 5220<>
atatccagtc actatggcgg ccgcattagg caccccaggc tttacacttt atgcttccgg 5280<>
ctcgtataat gtgtggattt tgagttagga tccggcgaga ttttcaggag ctaaggaagc 5340<>
taaaatggag aaaaaaatca ctggatatac caccgttgat atatcccaat ggcatcgtaa 5400<>
agaacatttt gaggcatttc agtcagttgc tcaatgtacc tataaccaga ccgttcagct 5460<>
ggatattacg gcctttttaa agaccgtaaa gaaaaataag cacaagtttt atccggcctt 5520<>
tattcacatt cttgcccgcc tgatgaatgc tcatccggaa ttccgtatgg caatgaaaga 5580<>
cggtgagctg gtgatatggg atagtgttca cccttgttac accgttttcc atgagcaaac 5640<>
tgaaacgttt tcatcgctct ggagtgaata ccacgacgat ttccggcagt ttctacacat 5700<>
atattcgcaa gatgtggcgt gttacggtga aaacctggcc tatttcccta aagggtttat 5760<>
tgagaatatg tttttcgtct cagccaatcc ctgggtgagt ttcaccagtt ttgatttaaa 5820<>
cgtggccaat atggacaact tcttcgcccc cgttttcacc atgggcaaat attatacgca 5880<>
aggcgacaag gtgctgatgc cgctggcgat tcaggttcat catgccgtct gtgatggctt 5940<>
ccatgtcggc agaatgctta atgaattaca acagtactgc gatgagtggc agggcggggc 6000<>
gtaaacgcgt ggatccggct tactaaaagc cagataacag tatgcgtatt tgcgcgctga 6060<>
tttttgcggt ataagaatat atactgatat gtatacccga agtatgtcaa aaagaggtgt 6120<>
gctatgaagc agcgtattac agtgacagtt gacagcgaca gctatcagtt gctcaaggca 6180<>
tatatgatgt caatatctcc ggtctggtaa gcacaaccat gcagaatgaa gcccgtcgtc 6240<>
tgcgtgccga acgctggaaa gcggaaaatc aggaagggat ggctgaggtc gcccggttta 6300<>
ttgaaatgaa cggctctttt gctgacgaga acagggactg gtgaaatgca gtttaaggtt 6360<>
tacacctata aaagagagag ccgttatcgt ctgtttgtgg atgtacagag tgatattatt 6420<>
gacacgcccg ggcgacggat ggtgatcccc ctggccagtg cacgtctgct gtcagataaa 6480<>
gtctcccgtg aactttaccc ggtggtgcat atcggggatg aaagctggcg catgatgacc 6540<>
accgatatgg ccagtgtgcc ggtctccgtt atcggggaag aagtggctga tctcagccac 6600<>
cgcgaaaatg acatcaaaaa cgccattaac ctgatgttct ggggaatata aatgtcaggc 6660<>
tcccttatac acagccagtc tgcaggtcga ccatagtgac tggatatgtt gtgttttaca 6720<>
gtattatgta gtctgttttt tatgcaaaat ctaatttaat atattgatat ttatatcatt 6780<>
ttacgtttct cgttcagctt tcttgtacaa agtggtcgtg agcaagggcg aggagctgtt 6840<>
caccggggtg gtgcccatcc tggtcgagct ggacggcgac gtaaacggcc acaagttcag 6900<>
cgtgtccggc gagggcgagg gcgatgccac ctacggcaag ctgaccctga agttcatctg 6960<>
caccaccggc aagctgcccg tgccctggcc caccctcgtg accaccctga cctacggcgt 7020<>
gcagtgcttc agccgctacc ccgaccacat gaagcagcac gacttcttca agtccgccat 7080<>
gcccgaaggc tacgtccagg agcgcaccat cttcttcaag gacgacggca actacaagac 7140<>
ccgcgccgag gtgaagttcg agggcgacac cctggtgaac cgcatcgagc tgaagggcat 7200<>
cgacttcaag gaggacggca acatcctggg gcacaagctg gagtacaact acaacagcca 7260<>
caacgtctat atcatggccg acaagcagaa gaacggcatc aaggtgaact tcaagatccg 7320<>
ccacaacatc gaggacggca gcgtgcagct cgccgaccac taccagcaga acacccccat 7380<>
cggcgacggc cccgtgctgc tgcccgacaa ccactacctg agcacccagt ccgccctgag 7440<>
caaagacccc aacgagaagc gcgatcacat ggtcctgctg gagttcgtga ccgccgccgg 7500<>
gatcactctc ggcatggacg agctgtacaa ggactacaaa gaccatgatg gagactataa 7560<>
ggatcacgac atcgattaca aggacgatga cgataagtaa gagctcgaat ttccccgatc 7620<>
gttcaaacat ttggcaataa agtttcttaa gattgaatcc tgttgccggt cttgcgatga 7680<>
ttatcatata atttctgttg aattacgtta agcatgtaat aattaacatg taatgcatga 7740<>
cgttatttat gagatgggtt tttatgatta gagtcccgca attatacatt taatacgcga 7800<>
tagaaaacaa aatatagcgc gcaaactagg ataaattatc gcgcgcggtg tcatctatgt 7860<>
tactagatcg ggaattcgta atcataagct tagcttgagc ttggatcaga ttgtcgtttc 7920<>
ccgccttcag tttaaactat cagtgtttga caggatatat tggcgggtaa acctaagaga 7980<>
aaagagcgtt tattagaata acggatattt aaaagggcgt gaaaaggttt atccgttcgt 8040<>
ccatttgtat gtgcatgcca accacagggt tcccctcggg atcaaagtac tttgatccaa 8100<>
cccctccgct gctatagtgc agtcggcttc tgacgttcag tgcagccgtc ttctgaaaac 8160<>
gacatgtcgc acaagtccta agttacgcga caggctgccg ccctgccctt ttcctggcgt 8220<>
tttcttgtcg cgtgttttag tcgcataaag tagaatactt gcgactagaa ccggagacat 8280<>
tacgccatga acaagagcgc cgccgctggc ctgctgggct atgcccgcgt cagcaccgac 8340<>
gaccaggact tgaccaacca acgggccgaa ctgcacgcgg ccggctgcac caagctgttt 8400<>
tccgagaaga tcaccggcac caggcgcgac cgcccggagc tggccaggat gcttgaccac 8460<>
ctacgccctg gcgacgttgt gacagtgacc aggctagacc gcctggcccg cagcacccgc 8520<>
gacctactgg acattgccga gcgcatccag gaggccggcg cgggcctgcg tagcctggca 8580<>
gagccgtggg ccgacaccac cacgccggcc ggccgcatgg tgttgaccgt gttcgccggc 8640<>
attgccgagt tcgagcgttc cctaatcatc gaccgcaccc ggagcgggcg cgaggccgcc 8700<>
aaggcccgag gcgtgaagtt tggcccccgc cctaccctca ccccggcaca gatcgcgcac 8760<>
gcccgcgagc tgatcgacca ggaaggccgc accgtgaaag aggcggctgc actgcttggc 8820<>
gtgcatcgct cgaccctgta ccgcgcactt gagcgcagcg aggaagtgac gcccaccgag 8880<>
gccaggcggc gcggtgcctt ccgtgaggac gcattgaccg aggccgacgc cctggcggcc 8940<>
gccgagaatg aacgccaaga ggaacaagca tgaaaccgca ccaggacggc caggacgaac 9000<>
cgtttttcat taccgaagag atcgaggcgg agatgatcgc ggccgggtac gtgttcgagc 9060<>
cgcccgcgca cgtctcaacc gtgcggctgc atgaaatcct ggccggtttg tctgatgcca 9120<>
agctggcggc ctggccggcc agcttggccg ctgaagaaac cgagcgccgc cgtctaaaaa 9180<>
ggtgatgtgt atttgagtaa aacagcttgc gtcatgcggt cgctgcgtat atgatgcgat 9240<>
gagtaaataa acaaatacgc aaggggaacg catgaaggtt atcgctgtac ttaaccagaa 9300<>
aggcgggtca ggcaagacga ccatcgcaac ccatctagcc cgcgccctgc aactcgccgg 9360<>
ggccgatgtt ctgttagtcg attccgatcc ccagggcagt gcccgcgatt gggcggccgt 9420<>
gcgggaagat caaccgctaa ccgttgtcgg catcgaccgc ccgacgattg accgcgacgt 9480<>
gaaggccatc ggccggcgcg acttcgtagt gatcgacgga gcgccccagg cggcggactt 9540<>
ggctgtgtcc gcgatcaagg cagccgactt cgtgctgatt ccggtgcagc caagccctta 9600<>
cgacatatgg gccaccgccg acctggtgga gctggttaag cagcgcattg aggtcacgga 9660<>
tggaaggcta caagcggcct ttgtcgtgtc gcgggcgatc aaaggcacgc gcatcggcgg 9720<>
tgaggttgcc gaggcgctgg ccgggtacga gctgcccatt cttgagtccc gtatcacgca 9780<>
gcgcgtgagc tacccaggca ctgccgccgc cggcacaacc gttcttgaat cagaacccga 9840<>
gggcgacgct gcccgcgagg tccaggcgct ggccgctgaa attaaatcaa aactcatttg 9900<>
agttaatgag gtaaagagaa aatgagcaaa agcacaaaca cgctaagtgc cggccgtccg 9960<>
agcgcacgca gcagcaaggc tgcaacgttg gccagcctgg cagacacgcc agccatgaag 10020<>
cgggtcaact ttcagttgcc ggcggaggat cacaccaagc tgaagatgta cgcggtacgc 10080<>
caaggcaaga ccattaccga gctgctatct gaatacatcg cgcagctacc agagtaaatg 10140<>
agcaaatgaa taaatgagta gatgaatttt agcggctaaa ggaggcggca tggaaaatca 10200<>
agaacaacca ggcaccgacg ccgtggaatg ccccatgtgt ggaggaacgg gcggttggcc 10260<>
aggcgtaagc ggctgggttg tctgccggcc ctgcaatggc actggaaccc ccaagcccga 10320<>
ggaatcggcg tgacggtcgc aaaccatccg gcccggtaca aatcggcgcg gcgctgggtg 10380<>
atgacctggt ggagaagttg aaggccgcgc aggccgccca gcggcaacgc atcgaggcag 10440<>
aagcacgccc cggtgaatcg tggcaagcgg ccgctgatcg aatccgcaaa gaatcccggc 10500<>
aaccgccggc agccggtgcg ccgtcgatta ggaagccgcc caagggcgac gagcaaccag 10560<>
attttttcgt tccgatgctc tatgacgtgg gcacccgcga tagtcgcagc atcatggacg 10620<>
tggccgtttt ccgtctgtcg aagcgtgacc gacgagctgg cgaggtgatc cgctacgagc 10680<>
ttccagacgg gcacgtagag gtttccgcag ggccggccgg catggccagt gtgtgggatt 10740<>
acgacctggt actgatggcg gtttcccatc taaccgaatc catgaaccga taccgggaag 10800<>
ggaagggaga caagcccggc cgcgtgttcc gtccacacgt tgcggacgta ctcaagttct 10860<>
gccggcgagc cgatggcgga aagcagaaag acgacctggt agaaacctgc attcggttaa 10920<>
acaccacgca cgttgccatg cagcgtacga agaaggccaa gaacggccgc ctggtgacgg 10980<>
tatccgaggg tgaagccttg attagccgct acaagatcgt aaagagcgaa accgggcggc 11040<>
cggagtacat cgagatcgag ctagctgatt ggatgtaccg cgagatcaca gaaggcaaga 11100<>
acccggacgt gctgacggtt caccccgatt actttttgat cgatcccggc atcggccgtt 11160<>
ttctctaccg cctggcacgc cgcgccgcag gcaaggcaga agccagatgg ttgttcaaga 11220<>
cgatctacga acgcagtggc agcgccggag agttcaagaa gttctgtttc accgtgcgca 11280<>
agctgatcgg gtcaaatgac ctgccggagt acgatttgaa ggaggaggcg gggcaggctg 11340<>
gcccgatcct agtcatgcgc taccgcaacc tgatcgaggg cgaagcatcc gccggttcct 11400<>
aatgtacgga gcagatgcta gggcaaattg ccctagcagg ggaaaaaggt cgaaaaggtc 11460<>
tctttcctgt ggatagcacg tacattggga acccaaagcc gtacattggg aaccggaacc 11520<>
cgtacattgg gaacccaaag ccgtacattg ggaaccggtc acacatgtaa gtgactgata 11580<>
taaaagagaa aaaaggcgat ttttccgcct aaaactcttt aaaacttatt aaaactctta 11640<>
aaacccgcct ggcctgtgca taactgtctg gccagcgcac agccgaagag ctgcaaaaag 11700<>
cgcctaccct tcggtcgctg cgctccctac gccccgccgc ttcgcgtcgg cctatcgcgg 11760<>
ccgctggccg ctcaaaaatg gctggcctac ggccaggcaa tctaccaggg cgcggacaag 11820<>
ccgcgccgtc gccactcgac cgccggcgcc cacatcaagg caccctgcct cgcgcgtttc 11880<>
ggtgatgacg gtgaaaacct ctgacacatg cagctcccgg agacggtcac agcttgtctg 11940<>
taagcggatg ccgggagcag acaagcccgt cagggcgcgt cagcgggtgt tggcgggtgt 12000<>
cggggcgcag ccatgaccca gtcacgtagc gatagcggag tgtatactgg cttaactatg 12060<>
cggcatcaga gcagattgta ctgagagtgc accatatgcg gtgtgaaata ccgcacagat 12120<>
gcgtaaggag aaaataccgc atcaggcgct cttccgcttc ctcgctcact gactcgctgc 12180<>
gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat 12240<>
ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca 12300<>
ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc 12360<>
atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc 12420<>
aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg 12480<>
gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta 12540<>
ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg 12600<>
ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac 12660<>
acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag 12720<>
gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat 12780<>
ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat 12840<>
ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc 12900<>
gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt 12960<>
ggaacgaaaa ctcacgttaa gggattttgg tcatgcatga tatatctccc aatttgtgta 13020<>
gggcttatta tgcacgctta aaaataataa aagcagactt gacctgatag tttggctgtg 13080<>
agcaattatg tgcttagtgc atctaatcgc ttgagttaac gccggcgaag cggcgtcggc 13140<>
ttgaacgaat ttctagctag acattatttg ccgactacct tggtgatctc gcctttcacg 13200<>
tagtggacaa attcttccaa ctgatctgcg cgcgaggcca agcgatcttc ttcttgtcca 13260<>
agataagcct gtctagcttc aagtatgacg ggctgatact gggccggcag gcgctccatt 13320<>
gcccagtcgg cagcgacatc cttcggcgcg attttgccgg ttactgcgct gtaccaaatg 13380<>
cgggacaacg taagcactac atttcgctca tcgccagccc agtcgggcgg cgagttccat 13440<>
agcgttaagg tttcatttag cgcctcaaat agatcctgtt caggaaccgg atcaaagagt 13500<>
tcctccgccg ctggacctac caaggcaacg ctatgttctc ttgcttttgt cagcaagata 13560<>
gccagatcaa tgtcgatcgt ggctggctcg aagatacctg caagaatgtc attgcgctgc 13620<>
cattctccaa attgcagttc gcgcttagct ggataacgcc acggaatgat gtcgtcgtgc 13680<>
acaacaatgg tgacttctac agcgcggaga atctcgctct ctccagggga agccgaagtt 13740<>
tccaaaaggt cgttgatcaa agctcgccgc gttgtttcat caagccttac ggtcaccgta 13800<>
accagcaaat caatatcact gtgtggcttc aggccgccat ccactgcgga gccgtacaaa 13860<>
tgtacggcca gcaacgtcgg ttcgagatgg cgctcgatga cgccaactac ctctgatagt 13920<>
tgagtcgata cttcggcgat caccgcttcc cccatgatgt ttaactttgt tttagggcga 13980<>
ctgccctgct gcgtaacatc gttgctgctc cataacatca aacatcgacc cacggcgtaa 14040<>
cgcgcttgct gcttggatgc ccgaggcata gactgtaccc caaaaaaaca tgtcataaca 14100<>
agaagccatg aaaaccgcca ctgcgccgtt accaccgctg cgttcggtca aggttctgga 14160<>
ccagttgcgt gacggcagtt acgctacttg cattacagct tacgaaccga acgaggctta 14220<>
tgtccactgg gttcgtgccc gaattgatca caggcagcaa cgctctgtca tcgttacaat 14280<>
caacatgcta ccctccgcga gatcatccgt gtttcaaacc cggcagctta gttgccgttc 14340<>
ttccgaatag catcggtaac atgagcaaag tctgccgcct tacaacggct ctcccgctga 14400<>
cgccgtcccg gactgatggg ctgcctgtat cgagtggtga ttttgtgccg agctgccggt 14460<>
cggggagctg ttggctggct ggtggcagga tatattgtgg tgtaaacaaa ttgacgctta 14520<>
gacaacttaa taacacattg cggacgtttt taatgtactg aattaacgcc gaattgaatt 14580<>
atcagcttgc atgccggtcg atctagtaac atagtagatg acaccgcgcg cgataattta 14640<>
tcctagtttg cgcgctatat tttgttttct atcgcgtatt aaatgtataa ttgcgggact 14700<>
ctaatcataa aaacccatct cataaataac gtcatgcatt acatgttaat tattacatgc 14760<>
ttaacgtaat tcaacagaaa ttatatgata atcatcgcaa gaccggcaac aggattcaat 14820<>
cttaagaaac tttattgcca aatgtttgaa cgatctgctt gactctaggg gtcatcagat 14880<>
ttcggtgacg ggcaggaccg gacggggcgg caccggcagg ctgaagtcca gctgccagaa 14940<>
acccacgtca tgccagttcc cgtgcttgaa gccggccgcc cgcagcatgc cgcggggggc 15000<>
atatccgagc gcctcgtgca tgcgcacgct cgggtcgttg ggcagcccga tgacagcgac 15060<>
cacgctcttg aagccctgtg cctccaggga cttcagcagg tgggtgtaga gcgtggagcc 15120<>
cagtcccgtc cgctggtggc ggggggagac gtacacggtc gactcggccg tccagtcgta 15180<>
ggcgttgcgt gccttccagg gacccgcgta ggcgatgccg gcgacctcgc cgtccacctc 15240<>
ggcgacgagc cagggatagc gctcccgcag acggacgagg tcgtccgtcc actcctgcgg 15300<>
ttcctgcggc tcggtacgga agttgaccgt gcttgtctcg atgtagtggt tgacgatggt 15360<>
gcagaccgcc ggcatgtccg cctcggtggc acggcggatg tcggccgggc gtcgttctgg 15420<>
gctcatggta gatcccctcg atcgagttga gagtgaatat gagactctaa ttggataccg 15480<>
aggggaattt atggaacgtc agtggagcat ttttgacaag aaatatttgc tagctgatag 15540<>
tgaccttagg cgacttttga acgcgcaata atggtttctg acgtatgtgc ttagctcatt 15600<>
aaactccaga aacccgcggc tcagtggctc cttcaacgtt gcggttctgt cagttccaaa 15660<>
cgtaaaacgg cttgtcccgc gtcatcggcg ggggtcataa cgtgactccc ttaattctca 15720<>
tgtatgataa ttcgagggta cccggggatc ctctagaggg cc 15762<>
<210> 2
<211> 38
<212> DNA
<213> Artificial sequence
<400> 2
gaccatatgg gagagctcgc ccggttattg ttaagctc 38<>
<210> 3
<211> 38
<212> DNA
<213> Artificial sequence
<400> 3
caagctcaag ctaagcttat gattacgaat tcccgatc 38<>
Claims (9)
1. The Gateway binary plasmid vector for rapidly identifying the plant stress particle-associated protein is characterized in that the vector is pSGRB7FWG2, and the nucleotide sequence of the vector is shown as SEQ ID No. 1; the vector comprises a PAB2 expression frame, a Super-GW-GFP-3Flag expression frame and a herbicide Basta resistance gene expression frame, wherein the nucleotide sequence of the PAB2 expression frame is shown as 27 th to 3954 th positions of SEQ ID No. 1; the nucleotide sequence of the Super-GW-GFP-3Flag expression cassette is shown as position 3973 to 7869 of SEQ ID No. 1; the nucleotide sequence of the expression frame of the herbicide Basta resistance gene is shown as 14581-15729 of SEQ ID No. 1.
2. The Gateway binary plasmid vector for rapid identification of plant stress granule-associated protein according to claim 1, wherein said PAB2 expression cassette comprises: 35S promoter, the nucleotide sequence of which is shown as 2927 to 3954 of SEQ ID No. 1; PAB2 gene, the nucleotide sequence of which is shown in the 986 th to 2872 th positions of Seq ID No. 1; a red fluorescent protein RFP coding sequence, the nucleotide sequence of which is shown as 274 th to 952 th positions of SEQ ID No. 1; and a T35S terminator, the nucleotide sequence of which is shown in SEQ ID No.1, positions 27 to 252.
3. The Gateway binary plasmid vector for the rapid identification of plant stress particle-associated protein according to claim 2,
the Super-GW-GFP-3Flag expression box comprises: a Super promoter, the nucleotide sequence of which is shown in positions 3973 to 5105 of Seq ID No. 1; a ccdB sequence, the nucleotide sequence of which is shown as positions 6346 to 6651 of SEQ ID No. 1; a GFP-3Flag sequence, the nucleotide sequence of which is shown as 6818 th to 7600 th of SEQ ID No. 1; the nucleotide sequence of the NOS terminator is shown in positions 7617 to 7869 of SEQ ID No. 1.
4. The Gateway binary plasmid vector for rapid identification of plant stress granule-associated protein according to claim 3, wherein said vector further comprises: a left border sequence and a right border sequence of T-DNA, wherein the nucleotide sequence of the left border sequence is shown as 14245 th to 14577 th positions of SEQ ID No.1, the nucleotide sequence of the right border sequence is shown as 7887 th to 8086 th positions of SEQ ID No.1, and the PAB2 expression cassette, the Super-GW-GFP-3Flag expression cassette and the herbicide Basta resistance gene expression cassette are positioned between the left border sequence and the right border sequence.
5. The method for constructing Gateway binary plasmid vector for rapidly identifying plant stress particle-associated protein as claimed in claim 4, comprising the steps of:
s1, digesting a binary plasmid vector PAB2-PB7RWG2 by using a restriction enzyme SacI, wherein the PAB2-PB7RWG2 is obtained by constructing a CDS sequence of a PAB2 gene into an entry vector pDONR221 vector through a BP reaction and then connecting the CDS sequence to a pB7RWG2 vector through an LR reaction;
s2, taking a plasmid vector pSuper-GW-GFP-3Flag as a template, and carrying out PCR (polymerase chain reaction) by using a primer SG-Maker-F: gaccatatgggagagctcgcccggttattgttaagctc and SG-Maker-R: caagctcaagctaagcttatgattacgaattcccgatc amplifying Super-GW-GFP-3Flag reading frame;
s3, connecting the Super-GW-GFP-3Flag reading frame to the PAB2-PB7RWG2 plasmid, transforming Escherichia coli DB3.1 competent cells, screening target clones in a spectinomycin Spe resistant LB plate, and finally completing the construction of a target plasmid vector pSGRB7FWG2 through PCR verification and sequencing analysis.
6. The use of Gateway binary plasmid vector for the rapid identification of plant stress particle-associated protein as claimed in claim 1 for identifying stress particles in epidermal cells or protoplasts of plant leaves, comprising: connecting a target gene to a Gateway entry vector and sequencing, carrying out LR reaction of Gateway cloning on the correctly sequenced Gateway entry vector containing the target gene and the binary plasmid vector pSGRB7FWG2 of claim 1, transforming a reaction product into Escherichia coli DH5 alpha competent cells, screening target clones in a spectinomycin Spe resistant LB plate, verifying through PCR, completing construction of a recombinant vector, expressing the recombinant vector in tobacco leaf epidermal cells or protoplasts through agrobacterium-mediated transient transformation expression, and determining whether the target protein is a stress particle component or not through laser confocal microscope analysis and under normal conditions and adverse stress conditions, wherein the fluorescent co-localization condition of the target protein and the PAB2 protein is adopted.
7. The use of the Gateway binary plasmid vector for the rapid identification of plant stress particle-associated protein as claimed in claim 6, wherein the Gateway entry vector is pDONR207 for identifying stress particles in epidermal cells or protoplasts of plant leaves.
8. The use of the Gateway binary plasmid vector for the rapid identification of plant stress particle associated proteins as claimed in claim 7, for identifying stress particles in epidermal cells or protoplasts of plant leaves, wherein said plants include but are not limited to tobacco, Arabidopsis, rice and maize.
9. Use of the Gateway binary plasmid vector of claim 1 for rapid identification of plant stress particle associated proteins in the preparation of plants with heat-tolerant or heat-sensitive traits, ABA, NaCl-tolerant or sensitive, including but not limited to tobacco, arabidopsis, rice and maize.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110548048.6A CN113281521B (en) | 2021-05-19 | 2021-05-19 | Gateway binary plasmid vector for rapidly identifying plant stress particle associated protein, and construction method and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202110548048.6A CN113281521B (en) | 2021-05-19 | 2021-05-19 | Gateway binary plasmid vector for rapidly identifying plant stress particle associated protein, and construction method and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN113281521A CN113281521A (en) | 2021-08-20 |
CN113281521B true CN113281521B (en) | 2022-07-22 |
Family
ID=77280018
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202110548048.6A Active CN113281521B (en) | 2021-05-19 | 2021-05-19 | Gateway binary plasmid vector for rapidly identifying plant stress particle associated protein, and construction method and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN113281521B (en) |
Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103319580A (en) * | 2012-03-19 | 2013-09-25 | 中国农业科学院作物科学研究所 | Plant stress tolerance-associated protein TaNHSF1, coding genes thereof and applications |
CN105481959A (en) * | 2016-01-27 | 2016-04-13 | 清华大学 | Method for improving tolerance of plants to NaCl by reducing content of PAB2 and PAB4 |
CN105566470A (en) * | 2016-01-27 | 2016-05-11 | 清华大学 | Method for improving NaCl tolerance of plants by reducing PAB2 and PAB8 |
CN106636180A (en) * | 2016-09-18 | 2017-05-10 | 山东农业大学 | Plasmid vector used for obtaining plant with hypersensitivity to salt stress and method |
WO2018043219A1 (en) * | 2016-09-02 | 2018-03-08 | 国立大学法人名古屋大学 | Cas protein expression cassette |
CN110511950A (en) * | 2019-07-29 | 2019-11-29 | 因之彩生物科技(武汉)有限公司 | Application of the PAB albumen in the fusion protein expression vector that building has the albumen effect of class companion sample |
CN112680386A (en) * | 2021-02-03 | 2021-04-20 | 河南大学 | Application of corn rhizosphere growth-promoting bacteria in promoting plant growth |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2018144831A1 (en) * | 2017-02-02 | 2018-08-09 | Duke University | Compositions and methods for controlling gene expression |
-
2021
- 2021-05-19 CN CN202110548048.6A patent/CN113281521B/en active Active
Patent Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103319580A (en) * | 2012-03-19 | 2013-09-25 | 中国农业科学院作物科学研究所 | Plant stress tolerance-associated protein TaNHSF1, coding genes thereof and applications |
CN105481959A (en) * | 2016-01-27 | 2016-04-13 | 清华大学 | Method for improving tolerance of plants to NaCl by reducing content of PAB2 and PAB4 |
CN105566470A (en) * | 2016-01-27 | 2016-05-11 | 清华大学 | Method for improving NaCl tolerance of plants by reducing PAB2 and PAB8 |
WO2018043219A1 (en) * | 2016-09-02 | 2018-03-08 | 国立大学法人名古屋大学 | Cas protein expression cassette |
CN106636180A (en) * | 2016-09-18 | 2017-05-10 | 山东农业大学 | Plasmid vector used for obtaining plant with hypersensitivity to salt stress and method |
CN110511950A (en) * | 2019-07-29 | 2019-11-29 | 因之彩生物科技(武汉)有限公司 | Application of the PAB albumen in the fusion protein expression vector that building has the albumen effect of class companion sample |
CN112680386A (en) * | 2021-02-03 | 2021-04-20 | 河南大学 | Application of corn rhizosphere growth-promoting bacteria in promoting plant growth |
Non-Patent Citations (4)
Title |
---|
Both CRISPR/Cas-based nucleases and nickases can be used efficiently for genome engineering in Arabidopsis thaliana;Fauser, Friedrich等;《Plant J.》;20140701;第79卷(第2期);第348-359页 * |
Multigene knockout utilizing offtarget mutations of the CRISPR/Cas9 system in rice;Endo, M.等;《Plant Cell Physiol.》;20141111;第56卷(第1期);第41-47页 * |
pKAMA-ITACHI Vectors for Highly Efficient CRISPR/Cas9-Mediated Gene Knockout in Arabidopsis thaliana;Hiroki Tsutsui等;《Plant and Cell Physiology》;20161117;第58卷(第11期);第46-56页 * |
拟南芥RBS1基因RNAi载体构建及遗传转化子的筛选;孟飒飒等;《辽宁大学学报(自然科学版)》;20200215;第47卷(第01期);第20-25页 * |
Also Published As
Publication number | Publication date |
---|---|
CN113281521A (en) | 2021-08-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN110551752B (en) | xCas9n-epBE base editing system and application thereof in genome base replacement | |
CN108203714B (en) | Cotton gene editing method | |
CN110283840B (en) | Accurate and efficient editing method of upland cotton genome | |
CN107119063B (en) | Method for increasing cordycepin content in cordyceps militaris | |
CN106834338B (en) | Expression vector of arabidopsis gene REM16 and application thereof in regulating and controlling plant flowering period | |
CN110656114B (en) | Tobacco pigment synthesis related gene and application thereof | |
CN110760538B (en) | Method for creating fusarium wilt-resistant watermelon seed material | |
CN112126658A (en) | Plant over-expressed luciferase reporter gene recombinant vector, construction method and application | |
CN109321576A (en) | A kind of method for creating of the low gossypol Cotton Germplasms of Non-gland body | |
CN113281521B (en) | Gateway binary plasmid vector for rapidly identifying plant stress particle associated protein, and construction method and application thereof | |
CN109485707B (en) | Application of protein OsVPE1 in regulation and control of inorganic phosphorus output capacity of plant vacuole | |
CN109232726B (en) | Application of protein OsVPE2 in regulation and control of inorganic phosphorus output capacity of plant vacuole | |
CN115058439A (en) | Rhododendron micranthum SAMT gene overexpression vector and construction method and application thereof | |
KR101608078B1 (en) | Strain for producing succinate from carbon dioxide and method for succinate production using the strain | |
CN111394385A (en) | Method for rapidly identifying bidirectional promoter of rice | |
CN109337925B (en) | Method for improving artemisinin content in artemisia annua by using AaADS-transferred gene taking artemisia annua suspension cell line as receptor | |
CN108841862A (en) | A kind of construction method of plant expression plasmid carrier containing HA protein fusion label and its carrier | |
KR20210137055A (en) | Inhibition of target gene expression through genome editing of native miRNAs | |
CN113122516B (en) | Plant EPSPS mutant and application thereof in plants | |
CN107815435A (en) | The gluconacetobacter of cellulose production capacity with enhancing | |
TW201210471A (en) | Method for enhancing thermotolerance of plant and applicatibility of transgenic plant | |
CN106459161A (en) | Constructs and methods involving genes encoding glutamate receptor polypeptides | |
CN115466319A (en) | Sorghum SbMS1 protein and coding gene and application thereof | |
KR20220114958A (en) | Method for manufacturing probe set used for next generation sequencing in transgenic plant | |
CN114591996B (en) | Expression vector of bacillus coagulans H-1, construction method and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |