RU2704859C1 - Beauveria bassiana fungus strain used to produce a biopreparation for the colorado potato beetle, fungal pathogens and potato growth stimulation during the vegetative period, a biopreparation based on the same, and a potato growth stimulation method during the vegetation period, protecting it from the colorado potato beetle and crater rot - Google Patents

Beauveria bassiana fungus strain used to produce a biopreparation for the colorado potato beetle, fungal pathogens and potato growth stimulation during the vegetative period, a biopreparation based on the same, and a potato growth stimulation method during the vegetation period, protecting it from the colorado potato beetle and crater rot Download PDF

Info

Publication number
RU2704859C1
RU2704859C1 RU2019122943A RU2019122943A RU2704859C1 RU 2704859 C1 RU2704859 C1 RU 2704859C1 RU 2019122943 A RU2019122943 A RU 2019122943A RU 2019122943 A RU2019122943 A RU 2019122943A RU 2704859 C1 RU2704859 C1 RU 2704859C1
Authority
RU
Russia
Prior art keywords
potato
strain
biopreparation
potatoes
beauveria bassiana
Prior art date
Application number
RU2019122943A
Other languages
Russian (ru)
Inventor
Анастасия Александровна Леляк
Александр Иванович Леляк
Маргарита Владимировна Штерншис
Вера Павловна Цветкова
Владислава Сергеевна Масленникова
Original Assignee
Александр Иванович Леляк
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Александр Иванович Леляк filed Critical Александр Иванович Леляк
Priority to RU2019122943A priority Critical patent/RU2704859C1/en
Application granted granted Critical
Publication of RU2704859C1 publication Critical patent/RU2704859C1/en

Links

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)

Abstract

FIELD: biotechnology.
SUBSTANCE: invention represents a strain of entomopathogenic fungus Beauveria bassiana IC 1530-25-1, a method which includes pre-planting treatment of potato tubers with biopreparation and biopreparation. When the potatoes tubers are pre-planted, the liquid biopreparation used is 1–3 % aqueous solution of the spore-mycelial biomass of the Beauveria bassiana IC 1530-25-1 entomopathogenic fungus strain and nutrient medium components with a titre of not less than 105 CFU/ml. Potato tubers are treated with the above biopreparation aqueous solution once with consumption of aqueous solution of biopreparation 10 liters per 1 t of potatoes. When potatoes are sprayed during the vegetation period with the aqueous solution of the biopreparation, a spore-micellar biomass of the strain of the entomopathogenic fungus Beauveria bassiana IC 1530-25-1 and nutrient medium components with a titre of not less than 106 CFU/ml and water solution of biopreparation 300 l per 1 hectare of potato planting area.
EFFECT: invention allows to protect potatoes from Colorado potato beetle, fungal pathogen Thanatephorus cucumeris (imperfect stage of fungus – Rhizoctonia solani), causing crater rot or black potato scab, as well as stimulates growth of potatoes during vegetation period.
3 cl, 12 tbl

Description

Изобретение относится к микробиологической промышленности, в частности, к производству средств защиты растений от вредных насекомых и грибных патогенов, и касается нового штамма гриба Beauveria bassiana для производства энтомопатогенного препарата и способа стимуляции роста картофеля в вегетационный период, защиты его от колорадского жука и ризоктониоза.The invention relates to the microbiological industry, in particular, to the production of plant protection products from harmful insects and fungal pathogens, and relates to a new strain of Beauveria bassiana fungus for the production of an entomopathogenic preparation and a method for stimulating potato growth during the growing season, protecting it from the Colorado potato beetle and rhizoctonia.

Энтомопатогенный гриб Beauveria bassiana представляет собой несовершенный гриб (Fungi imperfacti) и подразделение Deuteromycotonia. Род Beauveria Vuille относится к классу Deuteromycites; и отличается от других родов наличием конидий, которые держатся поодиночке, не располагаются мелкими цепочками, и имеют фертильную часть конидиофоры в форме зигзага и вытянутую кверху. Вид Beauveria bassiana имеет сферические, не эллипсоидальные конидии размером 2-3 - 2-2,5 мкм, и с конидофорами, образующими плотные пучки.The entomopathogenic fungus Beauveria bassiana is an imperfect fungus (Fungi imperfacti) and a division of Deuteromycotonia. The genus Beauveria Vuille belongs to the class Deuteromycites; and differs from other genera by the presence of conidia, which are kept alone, are not arranged in small chains, and have a fertile part of the conidiophore in the form of a zigzag and elongated upward. The Beauveria bassiana species has spherical, non-ellipsoidal conidia 2-3–2–2.5 μm in size, and with conidophores forming dense bundles.

Известен штамм грибов вида Beauveria bassiana ВКПМ Г-399 для производства энтомопатогенных препаратов (авторское свидет. СССР №1688820, МПК A01N 63/00, опубл. 07.11.1991 г.).A known strain of fungi of the species Beauveria bassiana VKPM G-399 for the production of entomopathogenic preparations (author's certificate. USSR No. 1688820, IPC A01N 63/00, publ. 07.11.1991).

Указанный штамм имеет недостаточную продуктивность и низкую терморезистентность.The specified strain has insufficient productivity and low thermal resistance.

Известен штамм гриба Beauveria bassiana ТС-92 для получения энтомопатогенного препарата (против трипса, вредящего растениям огурца), который получен путем селекции штамма Beauveria bassiana 124/1 на жидких и твердых питательных средах, содержащих гидролизат белково-витаминного концентрата (БВК) и глицерин с последующим отбором чистых культур по продуктивности, биологической активности на тест-насекомых и терморезистентности (патент РФ №2034469, МПК A01N 63/04, опубл. 10.05.1995 г. Штамм депонирован в Центральной коллекции микроорганизмов государственного концерна "Биопрепарат" (ЦКМК"Б") под № ЦКМ F-54Ц.A known strain of the fungus Beauveria bassiana TC-92 for producing an entomopathogenic preparation (against thrips that is harmful to plants of cucumber), which is obtained by selection of the Beauveria bassiana 124/1 strain on liquid and solid nutrient media containing protein-vitamin concentrate (BVC) hydrolyzate and glycerin with subsequent selection of pure cultures for productivity, biological activity on test insects and thermal resistance (RF patent No. 2034469, IPC A01N 63/04, publ. 05/10/1995, the Strain was deposited in the Central collection of microorganisms of the state concern "Bio Reparata "(TSKMK" B ") under the number CCM F-54TS.

Известен штамм гриба Beauveria bassiana АТСС N 74040 (патент РФ №2103873, МПК A01N 63/00, C12N 1/14, опубл. 10.02.1998 г.), предназначенный для получения энтомопатогенного препарата против хлопкового долгоносика, белянки сладкого картофеля и хлопкового слепняка.A known strain of the fungus Beauveria bassiana ATCC N 74040 (RF patent No. 2103873, IPC A01N 63/00, C12N 1/14, publ. 02/10/1998), intended to obtain an entomopathogenic preparation against cotton weevil, sweet potato whites and cotton horsefly.

Известен штамм Beauveria bassiana, депонированый в коллекции микроорганизмов Института биохимии и физиологии микроорганизмов РАН в г. Москве под номером ВКМ F-3732 D и предназначенный против личинок и яиц саранчи в кубышках (патент РФ №2172588, МПК A01N 63/00, C12N 1/14, опубл. 27.08.2001 г.). Штамм Beauveria bassiana ВКМ F-3732 D получен в результате направленной изменчивости продуктивности наиболее активной культуры, выделенной из природных источников в местах массовой гибели насекомых в условиях сибирского региона. Обладает повышенной продуктивностью по сравнению с известным штаммом в условиях глубинного режима ферментации - 1,2-2,0⋅109 сп/мл. При выращивании на твердой питательной среде его продуктивность составляет 2,2-5,1⋅109 спор/г. Биологическая активность культуральной жидкости штамма при внесении с кормом, определяемая по гибели личинок саранчи, составляет 72-92%, а при внесении в почву - гибель яиц саранчи в кубышках составляет 69-92%.A known strain of Beauveria bassiana, deposited in the collection of microorganisms of the Institute of Biochemistry and Physiology of Microorganisms of the Russian Academy of Sciences in Moscow under the number VKM F-3732 D and designed against locust larvae and eggs in capsules (RF patent No. 2172588, IPC A01N 63/00, C12N 1 / 14, published on August 27, 2001). The strain Beauveria bassiana VKM F-3732 D was obtained as a result of directed variability in the productivity of the most active culture isolated from natural sources in places of mass death of insects in the Siberian region. It has increased productivity compared with the known strain in the conditions of the deep fermentation regime - 1.2-2.0 ⋅ 10 9 sp / ml. When grown on solid nutrient medium, its productivity is 2.2-5.1⋅10 9 spores / g. The biological activity of the culture fluid of the strain when introduced with food, determined by the death of locust larvae, is 72-92%, and when introduced into the soil - the death of locust eggs in egg capsules is 69-92%.

Наиболее близким аналогом (прототипом) является штамм гриба Beauveria bassiana IMB F-100043, депонированный в Институте микробиологии и вирусологии им. Заболотного НАН Украины и применяемого для производства инсектицидных биопрепаратов (патент Украины №84325, МПК A01N 63/00, опубл. 10.11.2008 г.). Штамм получен в результате селекции изолята гриба Beauveria bassiana, полученного из погибших особей колорадского жука. Штамм обладает высокой инсектицидной активностью в отношении деструктивных насекомых, например, колорадского жука, американского белого мотылька, всеядного листовика, яблонной моли и может культивироваться на дешевой питательной среде.The closest analogue (prototype) is a strain of the fungus Beauveria bassiana IMB F-100043, deposited at the Institute of Microbiology and Virology. Zabolotnogo NAS of Ukraine and used for the production of insecticidal biological products (Ukrainian patent No. 84325, IPC A01N 63/00, publ. 10.11.2008). The strain was obtained by selection of the isolate of the fungus Beauveria bassiana, obtained from dead individuals of the Colorado potato beetle. The strain has high insecticidal activity against destructive insects, for example, the Colorado potato beetle, American white moth, omnivorous leaflet, apple moth and can be cultivated on a cheap nutrient medium.

Однако, указанный штамм-прототип не исследован против возбудителей парши картофеля, особенно - грибного патогена Thanatephorus cucumeris (А.В. Frank) Donk. (более широко распространено название несовершенной стадии гриба - Rhizoctonia solani J.G. Kuhn), вызывающего ризоктониоз или черную паршу картофеля, а также, не обладает свойством стимулирования роста картофеля в вегетационный период.However, this prototype strain has not been studied against pathogens of potato scab, especially the fungal pathogen Thanatephorus cucumeris (A.V. Frank) Donk. (the name of the imperfect stage of the fungus, Rhizoctonia solani J.G. Kuhn, is more widespread), which causes rhizoctonia or black scab of potatoes, and also does not have the property of stimulating potato growth during the growing season.

Известно применение антимикробного и фунгицидного химического соединения дицитратобората оксихинолиния в качестве средства против грибного патогена Rhizotonia solani Kuehn, вызывающего заболевание ризоктониоз (черная ножка) томатов и картофеля (патент РФ №2200393, МПК A01N 55/08, опубл. 20.03.2003 г.). Заявленное соединение обладает стимулирующим действием на рост некоторых растений, что способствует повышению их болезнеустойчивости.It is known to use the antimicrobial and fungicidal chemical compound of hydroxyquinoline dicitratoborate as an agent against the fungal pathogen Rhizotonia solani Kuehn, which causes the disease rhizoctonia (black leg) of tomatoes and potatoes (RF patent No. 2200393, IPC A01N 55/08, published on March 20, 2003). The claimed compound has a stimulating effect on the growth of some plants, which helps to increase their disease resistance.

Однако, указанное химическое соединение не обладает энтомопатогенным действием, т.е. не защищает растения от насекомых-вредителей, а также не приведены данные о стимулировании роста картофеля в фазе вегетации. Кроме того, данный препарат имеет свойство накапливаться в организме человека при неправильном применении препарата во время обработки растений (при нарушении техники безопасности при применении препарата во время обработки растений).However, this chemical compound does not have an entomopathogenic effect, i.e. It does not protect plants from insect pests, and data on stimulating potato growth in the growing phase are also not provided. In addition, this drug tends to accumulate in the human body if the drug is used improperly during plant treatment (in case of safety violations when using the drug during plant treatment).

Известен препарат для защиты растений от возбудителей болезней сельскохозяйственных культур и винограда с ростстимулирующим эффектом, включающий культуральную жидкость штаммов микроорганизмов, отличающийся тем, что в качестве культуральной жидкости штаммов микроорганизмов он содержит культуральные жидкости штамма бактерий Bacillus subtilis БАГ-65 и штамма актиномицета Streptomyces sindenensis БАГ-55, а также, вспомогательные добавки и наполнители при следующем соотношении компонентов, мас. %: культуральная жидкость Bacillus subtilis БАГ-65 - 20,0-50,0; культуральная жидкость Streptomyces sindenensis БАГ-55 - 5,0-20,0; вспомогательные добавки и наполнители - остальное (патент РФ №2313941, МПК A01N 63/02, опубл. 10.01.2008 г.). Данный препарат обладает антагонистической активностью против грибного патогена Rhizotonia solani Kuehn, вызывающего заболевание ризоктониоз картофеля.Known drug for protecting plants from pathogens of crops and grapes with a growth-promoting effect, including the culture fluid of microorganism strains, characterized in that as the culture fluid of microorganism strains, it contains culture fluid of the bacterial strain Bacillus subtilis BAG-65 and actinomycete strain Streptomyces sindenensis BAG- 55, as well as auxiliary additives and fillers in the following ratio of components, wt. %: Bacillus subtilis BAG-65 culture fluid - 20.0-50.0; culture liquid Streptomyces sindenensis BAG-55 - 5.0-20.0; auxiliary additives and fillers - the rest (RF patent No. 2313941, IPC A01N 63/02, publ. 10.01.2008). This drug has antagonistic activity against the fungal pathogen Rhizotonia solani Kuehn, which causes the disease of potato rhizoctonia.

Однако данный препарат не обладает энтомопатогенным действием, т.е. не защищает растения от насекомых-вредителей, а также не приведены данные о стимулировании роста картофеля в фазе вегетации. Технология производства препарата сложна, требует раздельного культивирования каждого микроорганизма с последующим их смешиванием с наполнителем для получения готовой формы.However, this drug does not have an entomopathogenic effect, i.e. It does not protect plants from insect pests, and data on stimulating potato growth in the growing phase are also not provided. The production technology of the drug is complex, it requires separate cultivation of each microorganism with their subsequent mixing with the filler to obtain the finished form.

Способ микробиологической защиты растений от вредителей с использованием средства, включающее смесь культуральных жидкостей Trichoderma viride, Azotobacter chroococcum, Bacillus megaterium, Beauveria bassiana, Metarhizium anisopliae с необходимым количеством воды при соотношении культур в смеси 1:1:1:1:1 при титре каждой культуры не менее 1×107 КОЕ/мл (патент РФ №2539025, МПК A01N 63/00, опубл. 10.01.2015 г.). Способ защиты включает 2-3-кратное опрыскивание растений в период вегетации в дозировке 12,5 л средства на 1 га посевов, при достижении средних температур воздуха не ниже 15°С, с интервалом две-три недели.A method of microbiological protection of plants from pests using an agent comprising a mixture of culture fluids Trichoderma viride, Azotobacter chroococcum, Bacillus megaterium, Beauveria bassiana, Metarhizium anisopliae with the required amount of water in the ratio of cultures in the mixture 1: 1: 1: 1: 1 for each culture titer not less than 1 × 10 7 CFU / ml (RF patent No. 2539025, IPC A01N 63/00, publ. 01/10/2015). The method of protection includes 2-3-fold spraying of plants during the growing season at a dosage of 12.5 liters of product per 1 ha of crops, when average air temperatures are at least 15 ° C, with an interval of two to three weeks.

Однако данный способ обработки направлен на защиту пшеницы от насекомых-вредителей. Информация о защите картофеля от насекомых-вредителей, грибных патогенов и стимулирования роста стеблей картофеля в период вегетации отсутствует.However, this processing method is aimed at protecting wheat from pests. Information on the protection of potatoes from insect pests, fungal pathogens and stimulation of the growth of potato stems during the growing season is not available.

Известен способ борьбы с почвенными патогенами картофеля в мерзлотных почвах, включающий предпосевную обработку клубней картофеля препаратом на основе Bacillus subtilis «ТНП-5 - ДЕП» из расчета 300 мл/кг и обработку растений картофеля в период вегетации препаратом «Мизорин» 23 мл/кг (патент РФ №2534889, МПК A01N 63/02, опубл. 10.12.2014 г.). «Мизорин» - бактериальный препарат на основе Arthrobacter mysorens.A known method of controlling soil potato pathogens in permafrost soils, including pre-sowing treatment of potato tubers with a preparation based on Bacillus subtilis "TNP-5 - DEPT" at a rate of 300 ml / kg and processing of potato plants during the growing season with "Mizorin" 23 ml / kg ( RF patent No. 2534889, IPC A01N 63/02, publ. 10.12.2014). Mizorin is a bacterial drug based on Arthrobacter mysorens.

Однако указанный способ трудоемок, требует вначале предпосевной обработки клубней картофеля препаратом на основе Bacillus subtilis «ТНП-5 - ДЕП», а затем обработку растений картофеля в период вегетации бактериальным препаратом на основе Arthrobacter mysorens.However, this method is laborious, it requires first presowing treatment of potato tubers with a preparation based on Bacillus subtilis "TNP-5 - DEPT", and then processing potato plants during the growing season with a bacterial preparation based on Arthrobacter mysorens.

Наиболее близким биопрепаратом-аналогом (прототипом) является средство для борьбы с колорадским жуком и повышения урожайности картофеля, содержащее экстракт лишайников Usnea, в количестве 0,0010-0,0015 г, полученный кипячением воздушно-сухого сырья в изопропиловом спирте, и водную суспензию конидий энтомопатогенного гриба Beauveria bassiana или Metarhizium anisopliae с титром соответственно 15×107 или 75×106 на 100 мл водной суспензии средства (патент РФ №2570548, МПК A01N 65/00, опубл. 10.12.2015 г.).The closest biological product analogue (prototype) is an agent for combating the Colorado potato beetle and increasing potato productivity, containing Usnea lichen extract in an amount of 0.0010-0.0015 g obtained by boiling air-dried raw materials in isopropyl alcohol, and an aqueous suspension of conidia entomopathogenic fungus Beauveria bassiana or Metarhizium anisopliae with a titer of 15 × 10 7 or 75 × 10 6 , respectively, per 100 ml of an aqueous suspension of the agent (RF patent No. 2570548, IPC A01N 65/00, publ. 10.12.2015).

Способ применения против колорадского жука указанного биопрепарата в виде суспензии конидий энтомопатогенного гриба Beauveria bassiana 15×107 состоит в обработке картофеля (путем опрыскивания) в вегетационный период водным раствором указанного биопрепарата с титром 1,5×106 КОЕ/мл. (патент РФ №2570548).A method of using said biological product against a Colorado potato beetle in the form of a suspension of conidia of an entomopathogenic fungus Beauveria bassiana 15 × 10 7 consists in processing potatoes (by spraying) during the growing season with an aqueous solution of the biological product with a titer of 1.5 × 10 6 CFU / ml. (RF patent No. 2570548).

Однако, данный биопрепарат содержит высокий титр 1,5×106 КОЕ/мл. энтомопатогенного гриба Beauveria bassiana в рабочей жидкости для обеспечения достаточной инсектицидной активности, что требует большой расход препарата (в 15 раз больше, чем в заявляемом). Кроме того, отсутствуют сведения об использовании данного препарата для защиты от грибных патогенов и стимуляции роста картофеля в период вегетации.However, this biological product contains a high titer of 1.5 × 10 6 CFU / ml. entomopathogenic fungus Beauveria bassiana in the working fluid to ensure sufficient insecticidal activity, which requires a large consumption of the drug (15 times more than in the claimed). In addition, there is no information on the use of this drug to protect against fungal pathogens and stimulate the growth of potatoes during the growing season.

Наиболее близким аналогом способа применения является способ биологической защиты растений картофеля от фитофтороза и колорадского жука, включающий обработку клубней перед посадкой замачиванием и опрыскивание растений картофеля в период вегетации биопрепаратом в смеси с прилипателем (патент России №2343667, МПК А01С 1/00, A01N 63/00, опубл. 20.01.2009 г.). Для обработки клубней картофеля замачиванием в качестве биопрепарата используют планриз из расчета 1000 мл на тонну клубней, а для обработки опрыскиванием 1 га посадок растений в период вегетации используют смесь биопрепаратов планриз в количестве 0,5 л и банкол в количестве 0,2 л, разведенных в 300-350 л минеральной воды «Заманкул», при этом в качестве прилипателя используют кукурузный клейстер в количестве 1-1,5% от объема смеси.The closest analogue of the method of application is the method of biological protection of potato plants from late blight and the Colorado potato beetle, including treating tubers before planting by soaking and spraying potato plants during the growing season with a biological product mixed with adhesive (Russian patent No. 2343667, IPC А01С 1/00, A01N 63 / 00, published on January 20, 2009). Soaking potato tubers by soaking as a biological product, planriz is used at a rate of 1000 ml per ton of tubers, and for spraying 1 hectare of plantings during the growing season, a mixture of biopreparations Planriz in the amount of 0.5 l and bankol in the amount of 0.2 l diluted in 300-350 liters of Zamankul mineral water, with corn paste in the amount of 1-1.5% of the mixture volume as an adhesive.

Однако в данном способе отсутствуют данные о возможности стимулирования роста и защиты картофеля от ризоктониоза. Кроме того в способе используется сложная многокомпонентная смесь из фунгицида, инсектицида, миниральной воды и прилипателя, что повышает стоимость обработки, ограничивает область применения способа, т.к. используемая многокомпонентная смесь не является единой препаративной формой и требует наличия всех компонентов используемой смеси. Например, минеральная вода находится в источнике в Северной Осетии и труднодоступна для других регионов.However, in this method there is no data on the possibility of stimulating the growth and protection of potatoes from rhizoctonia. In addition, the method uses a complex multicomponent mixture of fungicide, insecticide, mineral water and adhesive, which increases the cost of processing, limits the scope of the method, because the multicomponent mixture used is not a single preparative form and requires the presence of all components of the mixture used. For example, mineral water is located in a source in North Ossetia and is difficult to access for other regions.

Техническим результатом заявляемого изобретения является получение штамма гриба Beauveria bassiana, обладающего свойством защиты картофеля от колорадского жука, возбудителей парши, особенно - грибного патогена Thanatephorus cucumeris (несовершенная стадия гриба - Rhizoctonia solani), вызывающего ризоктониоз или черную паршу картофеля, а также обладающего свойством стимулирования роста картофеля в вегетационный период.The technical result of the claimed invention is to obtain a strain of the fungus Beauveria bassiana, which has the property of protecting potatoes from the Colorado potato beetle, the causative agents of scab, especially the fungal pathogen Thanatephorus cucumeris (imperfect stage of the fungus - Rhizoctonia solani), which causes rhizoctonia or black scab of potato, as well as stimulating growth potatoes during the growing season.

Указанный технический результат достигается созданием нового штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1, полученного в результате селекции изолята гриба Beauveria bassiana, полученного из погибших личинок колорадского жука, обеспечивающего защиту картофеля от ризоктониоза (черной парши) и стимулирование роста картофеля в вегетационный период и депонированного в Биоресурсном Центре Всероссийской Коллекции Микроорганизмов (БРЦ ВКПМ) НИЦ «Курчатовский институт» - ГосНИИ генетика, регистрационный номер ВКПМ: F-1447 (справка о депонировании штамма прилагается).The specified technical result is achieved by creating a new strain of entomopathogenic fungus Beauveria bassiana IC 1530-25-1, obtained by selection of the isolate of the fungus Beauveria bassiana, obtained from dead larvae of the Colorado potato beetle, which protects the potato from rhizoctonia (black scab) and stimulates the growth of potato during the growing season and deposited in the Bioresource Center of the All-Russian Collection of Microorganisms (BRC VKPM) SIC “Kurchatov Institute” - State Research Institute of Genetics, registration number VKPM: F-1447 (certificate of deposit w tamma is attached).

Указанный технический результат достигается также тем, что в биопрепарате против колорадского жука, грибных патогенов и стимуляции роста картофеля в вегетационный период, включающем суспензию культуральной жидкости микроорганизма, согласно изобретения, в качестве суспензии культуральной жидкости микроорганизма, он содержит спорово-мицелиальную биомассу штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 с титром не менее 109 КОЕ/мл и компоненты питательной среды после культивирования указанного штамма энтомопатогенного гриба.The specified technical result is also achieved by the fact that in the biological product against the Colorado potato beetle, fungal pathogens and stimulation of potato growth in the growing season, including a suspension of the culture fluid of the microorganism, according to the invention, it contains a spore-mycelial biomass of the strain of the entomopathogenic fungus Beauveria bassiana IC 1530-25-1 with a titer of at least 10 9 CFU / ml and components of the nutrient medium after culturing the indicated strain of entomopathogenic fungus.

Указанный технический результат достигается также тем, что в способе стимуляции роста картофеля в вегетационный период, защиты его от колорадского жука и грибных патогенов, включающем предпосадочную обработку клубней картофеля биопрепаратом в жидкой форме путем погружения в него клубней картофеля и/или опрыскивание картофеля в вегетационный период водным раствором биопрепарата распылением, согласно изобретения, при предпосадочной обработке клубней картофеля в качестве жидкой формы биопрепарата используют 1-3%-ный водный раствор спорово-мицелиальной биомассы штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды по п.п. 1, 2 формулы с титром не менее 105 КОЕ/мл, обработку клубней картофеля указанным водным раствором биопрепарата производят однократно с расходом водного раствора биопрепарата 10 литров на 1 тонну картофеля, а при опрыскивании картофеля в вегетационный период водным раствором биопрепарата в качестве него используют спорово-мицелиальную биомассу штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды по п.п. 1, 2 формулы с титром не менее 106 КОЕ/мл и расходом водного раствора биопрепарата 300 л на 1 гектар площади посадки картофеля.The specified technical result is also achieved by the fact that in the method of stimulating the growth of potatoes in the growing season, protecting it from the Colorado potato beetle and fungal pathogens, including pre-planting treatment of potato tubers with a biological product in liquid form by immersing potato tubers in it and / or spraying the potatoes with water in the growing season by spraying a biological product according to the invention, when preplanting potato tubers, a 1-3% aqueous solution is used as a liquid form of a biological product ovo mycelial biomass strain entomopathogenic fungus Beauveria bassiana IC 1530-25-1 and culture medium components pp 1, 2 formulas with a titer of at least 10 5 CFU / ml, potato tubers are treated with the specified aqueous solution of a biological product once with a flow rate of an aqueous solution of a biological product of 10 liters per 1 ton of potato, and when spraying potatoes with a water solution of a biological product during the growing season, a spore is used as it - mycelial biomass of a strain of an entomopathogenic fungus Beauveria bassiana IC 1530-25-1 and nutrient components according to claims 1, 2 formulas with a titer of at least 10 6 CFU / ml and a flow rate of an aqueous solution of a biological product of 300 l per 1 hectare of potato planting area.

Характеристика заявляемого штамма гриба Beauveria bassiana IC-1530-25-1. Родительский штамм гриба Beauveria bassiana IC-1530-25-1 выделен из личинок колорадского жука на территории Новосибирской области. Заявляемый штамм гриба Beauveria bassiana IC-1530-25-1 получен путем селекции и идентифицирован на основании секвенированного фрагмента ДНК депонируемого штамма гриба Beauveria bassiana IC-1530-25-1.Characterization of the inventive strain of the fungus Beauveria bassiana IC-1530-25-1. The parent strain of the fungus Beauveria bassiana IC-1530-25-1 was isolated from the larvae of the Colorado potato beetle in the Novosibirsk region. The inventive strain of the fungus Beauveria bassiana IC-1530-25-1 obtained by selection and identified on the basis of the sequenced DNA fragment of the deposited strain of the fungus Beauveria bassiana IC-1530-25-1.

Идентификация штамма IC 1530-25-1 на основе анализа последовательности рибосомальных генов (выписка из отчета Биоресурсного Центра Всероссийской Коллекции Микроорганизмов (БРЦ ВКПМ) НИЦ «Курчатовский институт» - ГосНИИ генетика от 25.09.2018 г.).Identification of strain IC 1530-25-1 based on analysis of the sequence of ribosomal genes (extract from the report of the Bioresource Center of the All-Russian Collection of Microorganisms (BRC VKPM) SIC “Kurchatov Institute” - State Research Institute of Genetics from 09.25.2018).

1. Рассев культуры заказчика до отдельных колоний и получение биомассы для анализа 18S РНК.1. Sieving the customer culture to individual colonies and obtaining biomass for analysis of 18S RNA.

2. Выделение ДНК. (Genomic DNA Purification Kit)2. Isolation of DNA. (Genomic DNA Purification Kit)

3. Идентификация штамма по последовательности 18S рДНК.3. Identification of the strain according to the sequence of 18S rDNA.

3.1. Выбор праймеров и режимы ПЦР3.1. Selection of primers and PCR modes

Консервативные праймеры для наработки последовательности гена, кодирующего 18S рРНК (Michael A. Innis, David Н. Gelfand, John J. Sninsky, Thomas J. White. PCR protocols. A guide to methods and applications. Academic press, INC. 1990.) [1]:Conservative primers for generating the sequence of a gene encoding 18S rRNA (Michael A. Innis, David N. Gelfand, John J. Sninsky, Thomas J. White. PCR protocols. A guide to methods and applications. Academic press, INC. 1990.) [ one]:

NS1 - gtagtcatatgcttgtctcNS1 - gtagtcatatgcttgtctc

NS4 - cttccgtcaattcctttaagNS4 - cttccgtcaattcctttaag

Режим реакции ПЦР:PCR reaction mode:

- 95°C - 3 мин.- 95 ° C - 3 min.

- 35 циклов:- 35 cycles:

95°С - 30 сек.95 ° C - 30 sec.

57°С - 30 сек.57 ° C - 30 sec.

72°С - 30 сек.72 ° C - 30 sec.

- 72°С - 5 мин- 72 ° C - 5 min

Консервативные праймеры для наработки последовательности гена, кодирующего 5.8S рРНК и внутренние транскрибируемые спейсеры ITS1 и ITS2 (Биохимия, 2007, 72, 12, 1659-1667) [2]:Conservative primers for generating the sequence of a gene encoding 5.8S rRNA and internal transcribed spacers ITS1 and ITS2 (Biochemistry, 2007, 72, 12, 1659-1667) [2]:

ITS1 - TCCGTAGGTGAACCTGCGITS1 - TCCGTAGGTGAACCTGCG

ITS4 - TCCTCCGCTTATTGATATGCITS4 - TCCTCCGCTTATTGATATGC

Режим реакции ПЦР:PCR reaction mode:

- 95°С - 3 мин.- 95 ° C - 3 min.

- 35 циклов:- 35 cycles:

95°С - 30 сек.95 ° C - 30 sec.

57°С - 30 сек.57 ° C - 30 sec.

72°С - 30 сек.72 ° C - 30 sec.

- 72°С - 5 мин.- 72 ° C - 5 min.

Консенвативные праймеры для амплификации домена D1/D2 гена 26S рРНК:Conservative primers for amplification of the D1 / D2 domain of the 26S rRNA gene:

NL-1 GCATATCAATAAGCGGAGGAAAGNL-1 GCATATCAATAAGCGGAGGAAAG

NL-4 GGTCCGTGTTTCAAGACGGNL-4 GGTCCGTGTTTCAAGACGG

Режим реакции ПЦР:PCR reaction mode:

- 95°С - 3 мин.- 95 ° C - 3 min.

- 35 циклов:- 35 cycles:

95°С - 30 сек.95 ° C - 30 sec.

52°С - 30 сек.52 ° C - 30 sec.

72°С - 30 сек.72 ° C - 30 sec.

- 72°С - 5 мин- 72 ° C - 5 min

3.2. Секвенирование генов 18S рРНК и 5.8S рРНК, сравнение секвенсов и построение деревьев родства.3.2. Sequencing of 18S rRNA and 5.8S rRNA genes, comparing sequencing and building related trees.

Секвенирование проводилось на автоматическом секвенаторе АЕ3000.Sequencing was carried out on an automatic sequencer AE3000.

Для анализа секвенсов использовалась специализированная компьютерная программа BLAST [http://www.ncbi.nlm.nih.gov/blast].For sequencing analysis, the specialized BLAST computer program [http://www.ncbi.nlm.nih.gov/blast] was used.

Достоверность результатов. Были определены последовательности достаточные для отнесения штамма к определенной таксономической группе микроорганизмов.The reliability of the results. Sequences have been determined that are sufficient to classify a strain as a specific taxonomic group of microorganisms.

4. Условия электрофореза ПЦР исследуемых образцов. 1,0% агарозный гель, электрофорез при напряженности электрического поля 5 В/см.4. Conditions for PCR electrophoresis of the studied samples. 1.0% agarose gel, electrophoresis with an electric field strength of 5 V / cm.

Этапы анализа.Stages of analysis.

а) Секвенирование участков последовательности, кодирующей ген 18S рРНК.a) Sequencing of portions of the sequence encoding the 18S rRNA gene.

При секвенировании участка ДНК, кодирующего ген 18S рДНК исследуемого штамма, получена следующая последовательность:When sequencing a portion of DNA encoding the 18S rDNA gene of the studied strain, the following sequence was obtained:

Figure 00000001
Figure 00000001

Figure 00000002
Figure 00000002

б) Анализ последовательностей гена, кодирующего 18S рРНК.b) Sequence analysis of the gene encoding 18S rRNA.

Анализ сходства нуклеотидной последовательности гена, кодирующего 18S рДНК, изучаемого штамма был проведен с помощью сервера BLAST [http://www.ncbi.nlm.nih.gov/blast].The analysis of the similarity of the nucleotide sequence of the gene encoding the 18S rDNA of the studied strain was carried out using the BLAST server [http://www.ncbi.nlm.nih.gov/blast].

Результаты. Критерием отнесения микроорганизма к тому или иному виду считается гомология не менее 97% [2].Results. The criterion for classifying a microorganism to a particular species is considered to be at least 97% homology [2].

Первичный скрининг по базе данных GenBank показал, что исследуемый штамм принадлежит к следующей систематической группе: Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Sordariomycetes; Hypocreomycetidae; Hypocreales; Cordycipitaceae; Beauveria.Initial screening using the GenBank database showed that the studied strain belongs to the following systematic group: Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Sordariomycetes; Hypocreomycetidae; Hypocreales; Cordycipitaceae; Beauveria.

Для установления филогенетического родства близких видов был также использован метод сравнения нуклеотидных последовательностей, кодирующих ген 5,8 S рРНК и внутренние транскрибируемые спейсеры ITS1 и ITS2 [2].To establish the phylogenetic kinship of closely related species, we also used the method of comparing nucleotide sequences encoding the 5.8 S rRNA gene and internal transcribed spacers ITS1 and ITS2 [2].

При секвенировании участка ДНК, кодирующего ген 5,8 S рРНК и внутренние транскрибируемые спейсеры ITS1 и ITS2, получена следующая последовательность:When sequencing a portion of DNA encoding the 5.8 S rRNA gene and the internal transcribed spacers ITS1 and ITS2, the following sequence was obtained:

Figure 00000003
Figure 00000003

Кроме того, для установления филогенетического родства близких видов был также использован метод сравнения нуклеотидных последовательностей, кодирующих домен D1/D2 гена 26S рРНК.In addition, a method for comparing nucleotide sequences encoding the D1 / D2 domain of the 26S rRNA gene was also used to establish the phylogenetic relationship of closely related species.

При секвенировании участка ДНК, кодирующего домен D1/D2 гена 26S рРНК, получена следующая последовательность:When sequencing a portion of DNA encoding the D1 / D2 domain of the 26S rRNA gene, the following sequence was obtained:

Figure 00000004
Figure 00000004

Анализ филогенетического родства, построенный с использованием штаммов близкородственных микроорганизмов, показал, что наиболее близким к исследуемому штамму является вид Beauveria bassiana.An analysis of phylogenetic kinship, constructed using strains of closely related microorganisms, showed that the species Beauveria bassiana is the closest to the studied strain.

Заключение. По результатам проведенного анализа нуклеотидной последовательности, кодирующей часть генов рРНК установлено, что исследуемый штамм наиболее близок к виду Beauveria bassiana (99%).Conclusion According to the results of the analysis of the nucleotide sequence encoding part of the rRNA genes, it was found that the studied strain is closest to Beauveria bassiana (99%).

Штамм гриба Beauveria bassiana IC-1530-25-1 характеризуется следующими культурально-морфологическими признаками.The strain of the fungus Beauveria bassiana IC-1530-25-1 is characterized by the following cultural and morphological characteristics.

При выращивании штамма на твердой среде Чапека при 26-27°С в течение 6 суток колонии беловатого цвета с точкой в центре, с ровными краями. Воздушный мицелий разветвленный, септированный, гифы мицелия в диаметре 3,0-5,0 мкм, конидиеносцы бутылевидные формируются одиночно, попарно или мутовками. Размер конидий 2,8-3,5 мкм одноклеточные, одноядерные на среде Сабуро при тех же условиях выращивания колонии с ровными краями белые пушистые колонии войлочного типа сверху и снизу, врастающие в агар, после спороношения - порошистые.When growing the strain on a solid Chapek medium at 26-27 ° C for 6 days, a whitish colony with a dot in the center, with smooth edges. Branched, septated aerial mycelium, mycelial hyphae in diameter 3.0–5.0 μm, conidiophores bottle-shaped are formed singly, in pairs or whorls. The size of the conidia is 2.8-3.5 μm unicellular, mononuclear on the Saburo medium under the same conditions for growing colonies with even edges, white fluffy felt colonies above and below, growing into agar, after sporulation - powdery.

Характер роста: колония пушистая по всей площади, край ровный.Character of growth: the colony is fluffy over the entire area, the edge is even.

Размер колонии (при определенном времени инкубации): на 14-15 сутки роста диаметр колонии составляет 35-40 мм.Colony size (at a certain incubation time): on the 14-15th day of growth, the diameter of the colony is 35-40 mm.

Воздушный мицелий: белый, спороношение белое, слегка порошистое;Aerial mycelium: white, sporulation white, slightly powdery;

Цвет обратной стороны колонии - белый.The color of the back of the colony is white.

Морфологические признаки штамма при культивировании на жидкой питательной среде Сабуро при 24-26°С в течение 72 ч:Morphological characteristics of the strain when cultured in a liquid nutrient medium Saburo at 24-26 ° C for 72 hours:

- после 24 часов культивирования мицелий истонченный и составляет 15-20%, а 80-85% составляют не проросшие споры;- after 24 hours of cultivation, the mycelium is thinned and accounts for 15-20%, and 80-85% are non-germinated spores;

- после 48 часов культивирования мицелия мало, культура развивается слабо; мицелий имеет среднюю толщину; свободных спор 5-10%;- after 48 hours of cultivation, the mycelium is scarce, the culture is poorly developed; the mycelium has an average thickness; free spores 5-10%;

- после 72 часов культивирования мицелий составляет 50-60%; остальной мицелий утолщенный, с четкими перегородками.- after 72 hours of cultivation, the mycelium is 50-60%; the rest of the mycelium is thickened, with clear partitions.

Физиолого-биохимические признаки штамма.Physiological and biochemical characteristics of the strain.

Растет при 18-32°С, оптимально 25-27°, рН среды 5,35-7,2, оптимально 5,8-6,8.It grows at 18-32 ° C, optimally 25-27 °, the pH of the medium is 5.35-7.2, optimally 5.8-6.8.

Отношение к источникам углерода: усваивает сахарозу, глюкозу, лактозу, глицерин.Attitude to carbon sources: assimilates sucrose, glucose, lactose, glycerin.

Отношение к источникам азота: утилизирует пептон, казеин, рыбо-костную муку, мясной бульон, дрожжи и их гидролизаты.Attitude to nitrogen sources: utilizes peptone, casein, fish and bone meal, meat broth, yeast and their hydrolysates.

При глубинном культивировании штамма на различных составах сред происходит изменение рН культуральной жидкости различно в зависимости от состава среды.During the deep cultivation of the strain on different compositions of the media, the pH of the culture fluid changes differently depending on the composition of the medium.

Процентное содержание биомассы штамма Beauveria bassiana IC-1530-25-1 по сухому остатку после фильтрации культуральной жидкости составляет 15-17%.The percentage of biomass of the strain Beauveria bassiana IC-1530-25-1 on the dry residue after filtering the culture fluid is 15-17%.

Исследована терморезистентность предложенного штамма Beauveria bassiana IC-1530-25-1 и исходного штамма при 80°С в течение 1-2 мин.The thermal resistance of the proposed Beauveria bassiana IC-1530-25-1 strain and the initial strain at 80 ° C for 1-2 minutes was studied.

Заявляемый штамм устойчивее на 20%.The inventive strain is more stable by 20%.

Заявляемый штамм гриба Beauveria bassiana IC-1530-25-1 хранится:The inventive strain of the fungus Beauveria bassiana IC-1530-25-1 is stored:

- на картофельно-глюкозном агаре при температуре 6-8°С;- on potato-glucose agar at a temperature of 6-8 ° C;

- в 10-20%-ном глицерине при -70°С;- in 10-20% glycerol at -70 ° C;

Способ, условия и состав сред для размножения штамма:The method, conditions and composition of the media for the propagation of the strain:

- оптимальная среда агар Сабуро;- optimal agar medium Saburo;

- рН 4,6;- pH 4.6;

- время инкубации 20 дней;- incubation time of 20 days;

- в освещении необходимости нет;- there is no need for coverage;

- другие среды, используемые для культивирования: агар Чапека, картофельно-глюкозный агар;- other media used for cultivation: апapek agar, potato-glucose agar;

Среда для ферментации: бульон Сабуро.Fermentation medium: Saburo broth.

Штамм заявляемого гриба Beauveria bassiana IC-1530-25-1 является энтомопатогенным. Не патогенен для пчел.The strain of the inventive fungus Beauveria bassiana IC-1530-25-1 is entomopathogenic. Not pathogenic to bees.

Методы селекции исходного гриба В. bassiana при получении заявляемого штамма Beauveria bassiana IC-1530-25-1.Methods for the selection of the initial fungus B. bassiana upon receipt of the inventive strain Beauveria bassiana IC-1530-25-1.

Для селекции гриба использовали явление спонтанной изменчивости. При изучении спонтанной изменчивости штаммов в культуре использовали набор питательных сред, с помощью которых оценивали гетерогенность моноконидиальных изолятов по морфологии и культуральным свойствам. Кроме этого, в качестве показателей изменчивости изучали показатели ферментативной активности полученных морфологических вариантов и их вирулентность.For the selection of the fungus, the phenomenon of spontaneous variability was used. When studying the spontaneous variability of strains in culture, a set of culture media was used, with the help of which the heterogeneity of monoconidial isolates was evaluated by morphology and cultural properties. In addition, indicators of the enzymatic activity of the obtained morphological variants and their virulence were studied as indicators of variability.

Для выделения моноспоровых изолятов проводили рассевы суспензии смытых с поверхности агаризованной питательной среды конидий гриба, далее отбирали выросшие колонии, отсевали их в чашки Петри и оценивали морфологию в сравнении с родительскими штаммами. Сходные по морфологии колонии объединяли в морфологические группы. Для оценки стабильности морфоваров их культивировали в течение пяти вегетативных пассажей на наборе питательных сред. Согласно методике, все выделенные варианты во всех пассажах перевивали с каждой среды на ту же среду из используемого набора. При выявлении стабильных групп морфоваров проводили сравнение их биохимических свойств и вирулентности. Морфологию вновь полученных изолятов оценивали по окраске и форме колоний, размерам колоний и скорости роста мицелия на разных искусственных питательных средах.To isolate monospore isolates, the suspension of the conidia of the fungus washed off the surface of the agarized nutrient medium was screened, the grown colonies were selected, they were sieved in Petri dishes, and their morphology was evaluated in comparison with the parental strains. Colonies similar in morphology were combined into morphological groups. To assess the stability of morphovars, they were cultured for five vegetative passages on a set of nutrient media. According to the methodology, all selected variants in all passages were transferred from each medium to the same medium from the set used. In identifying stable groups of morphovars, their biochemical properties and virulence were compared. The morphology of the newly obtained isolates was evaluated by the color and shape of the colonies, the size of the colonies and the growth rate of mycelium on different artificial nutrient media.

Изучение ферментативной активности заявляемого гриба В. bassiana. Методика определения ферментативной активностиThe study of the enzymatic activity of the inventive fungus B. bassiana. Method for determination of enzymatic activity

Определение ферментативной активности проводили на агаризованных питательных средах, эстеразную активность определяли спектрофотометрическим методом.The determination of enzymatic activity was carried out on agarized nutrient media, esterase activity was determined by spectrophotometric method.

Протеазную активность оценивали по гидролизу казеина на среде следующего состава (в %): агар-агар - 2, молоко сухое обезжиренное - 0,5, глюкоза - 1, вода дистиллированная - 1000 мл, рН после стерилизации (6,5±0,1). Активность экзопротеаз определяли по ширине зоны просветления агаризованной среды вокруг колонии на 10-е сутки роста (за вычетом диаметра колонии из диаметра зоны лизиса).Protease activity was evaluated by casein hydrolysis on a medium of the following composition (in%): agar-agar - 2, skimmed milk powder - 0.5, glucose - 1, distilled water - 1000 ml, pH after sterilization (6.5 ± 0.1 ) The activity of exoproteases was determined by the width of the clarification zone of the agar medium around the colony on the 10th day of growth (minus the diameter of the colony from the diameter of the lysis zone).

Амилазную активность оценивали по гидролизу водорастворимого крахмала на среде следующего состава (в %): агар-агар - 2, крахмал - 0,2, глюкоза - 1, вода дистиллированная - 1000 мл, рН после стерилизации (6,5±0,1). Активность экзоамилаз определяли по ширине зоны лизиса среды вокруг колонии на 10-е сутки роста (за вычетом диаметра колонии из диаметра зоны лизиса), которая появлялась после окрашивания агаровой пластинки в чашке Петри с помощью раствора Люголя.Amylase activity was evaluated by hydrolysis of water-soluble starch on the medium of the following composition (in%): agar-agar - 2, starch - 0.2, glucose - 1, distilled water - 1000 ml, pH after sterilization (6.5 ± 0.1) . Exoamylase activity was determined by the width of the lysis zone of the medium around the colony on the 10th day of growth (minus the diameter of the colony from the diameter of the lysis zone), which appeared after staining the agar plate in a Petri dish using a Lugol solution.

Для определения липазной активности использовали две среды: с твином-80 и оливковым маслом. Состав (в %): агар-агар - 2,0; твин-80 - 1,0 (либо оливковое масло - 2,0); пептон - 1,0; дрожжевой экстракт - 0,2; вода дистиллированная - 1000 мл, рН после стерилизации (6,5±0,1). Активность липаз определяли по ширине зоны просветления агаризованной среды вокруг колонии на 10-е сутки роста (за вычетом диаметра колонии из диаметра зоны лизиса).Two media were used to determine lipase activity: with tween-80 and olive oil. Composition (in%): agar-agar - 2.0; tween-80 - 1.0 (or olive oil - 2.0); peptone - 1.0; yeast extract - 0.2; distilled water - 1000 ml, pH after sterilization (6.5 ± 0.1). Lipase activity was determined by the width of the clarification zone of the agar medium around the colony on the 10th day of growth (minus the diameter of the colony from the diameter of the lysis zone).

Хитиназную активность оценивали на среде с коллоидным хитином, полученным гидролитическим расщеплением хитина панцирей камчатских крабов с помощью уксусной кислоты. Активность липаз определяли по ширине зоны просветления агаризованной среды вокруг колонии на 10-е сутки роста (за вычетом диаметра колонии из диаметра зоны лизиса).Chitinase activity was evaluated on a medium with colloidal chitin obtained by hydrolytic cleavage of chitin of king crab shells with acetic acid. Lipase activity was determined by the width of the clarification zone of the agar medium around the colony on the 10th day of growth (minus the diameter of the colony from the diameter of the lysis zone).

Для определения эстеразной активности штаммы В. bassiana засевали в пенфлаконы с 10 мл жидкой среды Сабуро (дрожжевой экстракт - 0,2%, пептон - 1%, глюкоза - 4%, агар-агар - 2%, вода дистиллированная - 1000 мл) и инкубировали при (27±0,5)°С в течение 10 дней. После окончания времени инкубации из флаконов отбирали по 1 мл культуральной жидкости в пробирки Эппендорфа, образцы центрифугировали при 5000 оборотов в течение 10 мин. Субстрат готовили следующим образом: 1 мл 0,5М буфера трис-HCl с рН 7,0 доводили до объема 10 мл дистиллированной водой. Параллельно готовили навеску субстрата - р-нитрофенилацетата - из расчета 1 мг субстрата на 10 мл разведенного буфера. Навеску предварительно растворяли в 1 мл ацетона, затем переносили в емкость с буфером.To determine the esterase activity, B. bassiana strains were seeded in penflasks with 10 ml of Saburo liquid medium (yeast extract - 0.2%, peptone - 1%, glucose - 4%, agar-agar - 2%, distilled water - 1000 ml) and incubated at (27 ± 0.5) ° C for 10 days. After the end of the incubation time, 1 ml of culture liquid was taken from the vials into Eppendorf tubes, the samples were centrifuged at 5000 rpm for 10 min. The substrate was prepared as follows: 1 ml of 0.5M Tris-HCl buffer with a pH of 7.0 was adjusted to a volume of 10 ml with distilled water. At the same time, a weighed sample of the substrate, p-nitrophenyl acetate, was prepared at the rate of 1 mg of substrate per 10 ml of diluted buffer. A weighed portion was previously dissolved in 1 ml of acetone, then transferred into a container with buffer.

В кювету спектрофотометра наливали 100, 150 или 200 мкл культуральной жидкости (КЖ) и 1 мл буфера с субстратом. Оптическую плотность продукта реакции субстрата с КЖ определяли при длине волны 410 нм. Результаты исследования приведены в таблице 1.100, 150 or 200 μl of culture fluid (QL) and 1 ml of buffer with substrate were poured into the cuvette of the spectrophotometer. The optical density of the reaction product of the substrate with QOL was determined at a wavelength of 410 nm. The results of the study are shown in table 1.

Figure 00000005
Figure 00000005

Методы определения вирулентности заявляемого штамма гриба В. bassianaMethods for determining the virulence of the inventive strain of the fungus B. bassiana

Вирулентность полученного штамма Beauveria bassiana IC-1530-25-1 и исходного штамма определяли в лабораторных условиях на личинках колорадского жука Leptinotarsa decemlineata Say. Насекомых содержали при температуре (35±1)°С без освещения. В качестве корма использовали питательную среду Вейзера. Работу проводили с личинками 1-2 возраста.The virulence of the obtained Beauveria bassiana strain IC-1530-25-1 and the initial strain was determined in laboratory conditions on the larvae of the Colorado potato beetle Leptinotarsa decemlineata Say. Insects were kept at a temperature of (35 ± 1) ° С without illumination. Weizer nutrient medium was used as feed. The work was carried out with larvae of 1-2 age.

Заражение производили путем нанесения суспензии спор гриба исследуемых концентраций на личинок с помощью кисточки. Учет гибели насекомых проводили визуально, начиная с первых суток после инокуляции. Для проведения пассажей штаммов через живой организм использовали колорадского жука Leptinotarsa decemlineata. Личинок инфицировали путем погружения в суспензию конидий гриба.Infection was carried out by applying a suspension of fungal spores of the studied concentrations to the larvae using a brush. Accounting for the death of insects was carried out visually, starting from the first day after inoculation. To conduct passages of strains through a living organism, the Colorado potato beetle Leptinotarsa decemlineata was used. The larvae were infected by immersion in a suspension of conidia of the fungus.

После появления признаков заражения (множественные темные пятна на кутикуле) погибших насекомых переносили на поверхность питательной среды Сабуро в чашки Петри и инкубировали при комнатной температуре до появления обильного роста мицелия и развития спороношения.After the appearance of signs of infection (multiple dark spots on the cuticle), dead insects were transferred to the surface of Saburo's nutrient medium in Petri dishes and incubated at room temperature until there was an abundant growth of mycelium and the development of sporulation.

Споры собирали в стерильную пробирку и использовали для дальнейшего заражения следующей генерации личинок. Вирулентность полученных вариантов определяли описанным выше способом в лабораторных условиях. Учет гибели насекомых проводили визуально, начиная с первых суток после инокуляции. Результаты приведены в табл. 2.Spores were collected in a sterile tube and used to further infect the next generation of larvae. The virulence of the obtained variants was determined as described above under laboratory conditions. Accounting for the death of insects was carried out visually, starting from the first day after inoculation. The results are shown in table. 2.

Figure 00000006
Figure 00000006

Биологическая эффективность заявляемого штамма Beauveria bassiana IC-1530-25-1 и препарата на его основе на личинках колорадского жука составляет 98% на 5-е сутки, а у исходного родительского штамма соответственно 90%.The biological effectiveness of the claimed strain of Beauveria bassiana IC-1530-25-1 and a drug based on it on the larvae of the Colorado potato beetle is 98% on the 5th day, and the initial parent strain, respectively, 90%.

Таким образом, предложенный штамм превосходит родительский штамм по продуктивности и биологической эффективности.Thus, the proposed strain is superior to the parent strain in productivity and biological effectiveness.

Испытание заявляемого грибного штамма на фитопатогенахThe test of the inventive fungal strain on phytopathogens

Опыт проводили с использованием методики агаровых блоков. Суспензию препарата в концентрации с титром 105 спор/мл вносили в питательную среду с температурой 36-37°С. Для выращивания грибных фитопатогенов, в качестве питательной среды был взят картофельно-глюкозный агар. Инокулированную среду разливали в чашки Петри и на застывшую поверхность в центр помещали блок диаметром 10 мм, вырезанный из колонии фитопатогена.The experiment was carried out using agar block technique. The suspension of the drug in a concentration with a titer of 10 5 spores / ml was introduced into the nutrient medium with a temperature of 36-37 ° C. For the cultivation of fungal plant pathogens, potato-glucose agar was taken as a nutrient medium. The inoculated medium was poured into Petri dishes and a block 10 mm in diameter, cut from a phytopathogen colony, was placed on the frozen surface in the center.

Учет проводили на 3, 5, 7, 10 сутки. Активность препарата учитывали по изменению диаметра колонии гриба в сравнении с контролем (среда без внесения биопрепарата). На основании полученных данных определяли ингибирующую активность (табл. 3).Accounting was carried out on the 3rd, 5th, 7th, 10th day. The activity of the drug was taken into account by changing the diameter of the fungus colony in comparison with the control (medium without biologics). Based on the obtained data, the inhibitory activity was determined (Table 3).

Figure 00000007
Figure 00000007

Пример 1. Использование заявляемого штамма для получения энтомопатогенного препарата. Культивирование энтомопатогенного штамма гриба В. bassiana IC-1530-25-1. Схема культивирования энтомопатогенного гриба В. bassiana была выбрана согласно методическим указаниям (Евлахова, Велицкая, 1961) и включала в себя следующие стадии:Example 1. The use of the inventive strain to obtain an entomopathogenic drug. The cultivation of an entomopathogenic strain of the fungus B. bassiana IC-1530-25-1. The cultivation scheme of the entomopathogenic fungus B. bassiana was chosen according to the guidelines (Yevlakhova, Velitskaya, 1961) and included the following stages:

1. Получение исходной культуры штаммов из музейных пробирок;1. Obtaining the initial culture of strains from museum tubes;

2. Наработка посевного материала штаммов;2. The production of seed material of strains;

3. Получение биомассы штаммов;3. Obtaining biomass strains;

4. Контроль качества полученной биомассы по отобранным критериям.4. Quality control of the obtained biomass according to the selected criteria.

В процессе культивирования использовали следующее технологическое оборудование и материалы:In the process of cultivation used the following processing equipment and materials:

1. Автоклав ВК-75.1. Autoclave VK-75.

2. Баня водяная с терморегулятором, позволяющая поддерживать температуру 30°С-100°С с отклонением до 1°С от заданной.2. A water bath with a temperature regulator, which allows maintaining a temperature of 30 ° С-100 ° С with a deviation of up to 1 ° С from a given value.

3. Весы лабораторные общего назначения с наибольшим пределом взвешивания 200 г и пределом допускаемой погрешности ±2 мг для взвешивания реактивов.3. General-purpose laboratory scales with a maximum weighing limit of 200 g and a margin of error of ± 2 mg for weighing reagents.

4. Шкаф сушильный.4. Drying cabinet.

5. Термостаты электрические для выращивания культур грибов с автоматическим терморегулятором до температуры 35°С и с ценой деления 0,2°С.5. Electric thermostats for growing mushroom cultures with an automatic temperature controller up to a temperature of 35 ° C and with a division price of 0.2 ° C.

6. Холодильник бытовой электрический по ГОСТ 26678.6. The refrigerator is household electric in accordance with GOST 26678.

7. Центрифуга.7. Centrifuge.

8. Шейкер лабораторный на 6 колб.8. Laboratory shaker for 6 flasks.

9. Электроплита по ГОСТ 14919.9. Electric stove in accordance with GOST 14919.

10. Микроскоп световой биологический с увеличением в 900х - 1000х раз.10. Biological light microscope with a magnification of 900 x - 1000 x times.

11. рН-метр с пределом допускаемой погрешности не более 0,05 ед. рН.11. pH meter with a margin of error of not more than 0.05 units. pH

12. Дистиллятор.12. The distiller.

13. Термометры жидкостные стеклянные с диапазоном температуры 0°С-50°С и 50°С-100°С по ГОСТ 28498 с пределом допускаемой погрешности ±0,5°С с ценой деления шкалы 0,5°С.13. Liquid-in-glass thermometers with a temperature range of 0 ° С-50 ° С and 50 ° С-100 ° С according to GOST 28498 with a margin of error ± 0.5 ° С with a scale division value of 0.5 ° С.

Музейная культура В. bassiana хранилась на скошенной агаризованной питательной среде Сабуро следующего состава (на 1 дм3 дистиллированной воды): пептон мясной ферментативный - 10 г, глюкоза кристаллическая моногидрат - 40 г, дрожжевой экстракт - 0,5 г, агар микробиологический - 20 г, рН 6,5 до стерилизации.The museum culture of B. bassiana was stored on a Saburo slanted agar medium of the following composition (per 1 dm 3 of distilled water): meat enzymatic peptone - 10 g, glucose crystalline monohydrate - 40 g, yeast extract - 0.5 g, microbiological agar - 20 g pH 6.5 before sterilization.

На первом этапе технологического процесса культивирование осуществлялось размножением музейных культур путем поэтапного пересева спорово-мицелиальной массы на ряд последовательных пробирок со скошенной плотной питательной средой Сабуро.At the first stage of the technological process, cultivation was carried out by propagation of museum cultures by phased reseeding of spore-mycelial mass into a series of consecutive test tubes with Saburo's beveled dense nutrient medium.

На втором этапе осуществлялось получение посевного материала путем смыва спорово-мицелиальной массы с маточных пробирок стерильным физиологическим раствором в колбы вместимостью 50 см3. Полученную, таким образом суспензию, с титром 106 КОЕ/мл использовали для инокулирования ростовых колб вместимостью 500 см3, содержащих 250 см3 жидкой картофельно-глюкозной среды следующего состава (на 1 дм3 дистиллированной воды): картофель измельченный - 500 г, глюкоза кристаллическая моногидрат - 20 г, дрожжевой экстракт - 0,5 г, рН 6,5 до стерилизации. Колбы инкубировали на термостатируемом шейкере при температуре (23±1)°С в течение 7 дней. По окончании культивирования содержимое колб разливали в стерильные стеклянные флаконы, укупоривали резиновыми пробками и завальцовывали алюминиевыми колпачками. Полученная жидкая биомасса гриба Beauveria bassiana IC-1530-25-1 с титром 109 КОЕ/мл служит готовой препаративной формой, которую хранили в холодильнике при температуре (6±1)°С для дальнейшего использования. Технологический процесс наработки занимал 15 суток, включая стадию выращивания посевной культуры на агаризованной питательной среде.At the second stage, seed was obtained by washing the spore-mycelial mass from the fallopian tubes with sterile saline into flasks with a capacity of 50 cm 3 . Thus obtained suspension, with a titer of 10 6 CFU / ml, was used to inoculate growth flasks with a capacity of 500 cm 3 containing 250 cm 3 of liquid potato-glucose medium of the following composition (per 1 dm 3 of distilled water): chopped potatoes - 500 g, glucose crystalline monohydrate - 20 g, yeast extract - 0.5 g, pH 6.5 before sterilization. The flasks were incubated on a thermostatic shaker at a temperature of (23 ± 1) ° C for 7 days. At the end of cultivation, the contents of the flasks were poured into sterile glass vials, sealed with rubber stoppers and rolled with aluminum caps. The obtained liquid biomass of the fungus Beauveria bassiana IC-1530-25-1 with a titer of 10 9 CFU / ml serves as a finished formulation, which was stored in the refrigerator at a temperature of (6 ± 1) ° С for further use. The production process took 15 days, including the stage of cultivating the seed crop on an agarized nutrient medium.

Пример 2. Состав заявляемого биопрепарата. Биопрепарат против колорадского жука, грибных патогенов и стимуляции роста картофеля в вегетационный период содержит спорово-мицелиальную биомассу штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 с титром не менее 109 КОЕ/мл и компоненты питательной среды после культивирования указанного штамма энтомопатогенного гриба.Example 2. The composition of the claimed biological product. A biological product against the Colorado potato beetle, fungal pathogens, and potato growth stimulation during the growing season contains spore-mycelial biomass of the Beauveria bassiana IC 1530-25-1 strain of entomopathogenic fungus with a titer of at least 10 9 CFU / ml and nutrient medium components after cultivation of the said entomopathogenic fungus strain.

Хранят препарат в холодильнике при температуре от 0 до 10°С. Срок годности биопрепарата - 6 месяцев от даты изготовления. В 1 см3 препарата содержится не менее 1×109 КОЕ (колониеобразующих единиц) живых микробных клеток штамма гриба Beauveria bassiana.Store the drug in the refrigerator at a temperature of 0 to 10 ° C. The shelf life of the biological product is 6 months from the date of manufacture. 1 cm 3 of the preparation contains at least 1 × 10 9 CFU (colony forming units) of live microbial cells of the strain of the fungus Beauveria bassiana.

Пример. 3. Способ обработки клубней картофеля для защиты от грибных патогенов и стимуляции роста картофеля в вегетационный период.Example. 3. A method of processing potato tubers to protect against fungal pathogens and stimulate the growth of potatoes during the growing season.

3.1. Заявляемый способ включает предпосадочную обработку клубней картофеля биопрепаратом в жидкой форме путем полного погружения в него клубней картофеля или смачивания всей поверхности. В качестве жидкой формы биопрепарата используют 1-3%-ный рабочую суспензию спорово-мицелиальной биомассы штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды с титром не менее 105 КОЕ/мл. Обработку клубней картофеля указанным рабочим составом биопрепарата производят однократно перед посадкой с расходом рабочей суспензии биопрепарата 10 литров на 1 тонну картофеля.3.1. The inventive method includes pre-planting treatment of potato tubers with a biological product in liquid form by completely immersing potato tubers in it or wetting the entire surface. As a liquid form of the biological product, a 1-3% working suspension of spore-mycelial biomass of the strain of the entomopathogenic fungus Beauveria bassiana IC 1530-25-1 and nutrient components with a titer of at least 10 5 CFU / ml is used. Processing potato tubers with the specified working composition of a biological product is carried out once before planting with a flow rate of a working suspension of a biological product of 10 liters per 1 ton of potato.

3.2. Результаты полевых испытаний по стимуляции роста картофеля в вегетационный период и защиты его от ризоктониоза3.2. The results of field trials to stimulate the growth of potatoes in the growing season and protect it from rhizoctonia

Возбудитель болезни - гриб-базидиомицет Thanatephorus cucumeris (А.В. Frank) Donk. (более широко распространено название несовершенной стадии гриба - Rhizoctonia solani J.G. Kuhn). Базидиальная стадия не является обязательной в цикле развития патогена: базидиоспоры образуются при высокой влажности на мицелии, находящемся на стебле вблизи поверхности земли.The causative agent of the disease is the fungus-basidiomycete Thanatephorus cucumeris (A.V. Frank) Donk. (the name of the imperfect stage of the fungus - Rhizoctonia solani J.G. Kuhn is more widespread). The basidial stage is not necessary in the pathogen development cycle: basidiospores are formed at high humidity on the mycelium located on the stem near the surface of the earth.

Симптомы и жизненный цикл возбудителя болезни. Гриб Rhizoctonia solani J.G. Kuhn способен поражать картофель на всех этапах онтогенеза. В настоящее время насчитывают несколько форм проявления ризоктониоза. Заболевание проявляется в виде черной парши, углубленной (ямчатой) пятнистости и сетчатого некроза клубней, загнивания глазков и ростков, отмирания столонов и корней, а также в виде сухой гнили подземной части стебля в виде коричневых язв различной величины "трухлявая древесина" и "белой ножки" стеблей.Symptoms and life cycle of the causative agent of the disease. Mushroom Rhizoctonia solani J.G. Kuhn is able to infect potatoes at all stages of ontogenesis. Currently, there are several forms of manifestation of rhizoctonia. The disease manifests itself in the form of black scab, deep (pitted) spotting and net necrosis of tubers, decay of eyes and sprouts, death of stolons and roots, and also in the form of dry rot of the underground part of the stem in the form of brown ulcers of various sizes “rotting wood” and “white leg” "stems.

Гриб может перезимовывать в виде мицелия или склероциев на клубнях или в почве в течение 3-4 лет. Кроме картофеля, R. solani может поражать овощные культуры (томаты, тыквенные, свеклу) и многие дикорастущие сорные растения (осот, хвощ, лебеду и др.).The fungus can overwinter in the form of mycelium or sclerotia on tubers or in the soil for 3-4 years. In addition to potatoes, R. solani can affect vegetables (tomatoes, pumpkin, beets) and many wild weeds (thistle, horsetail, quinoa, etc.).

Важными условиями, определяющими развитие ризоктониоза на картофеле, являются температура и влажность почвы и воздуха. Оптимальная температура почвы для развития заболевания - около 17°С, влажность - 60-70% от полной влагоемкости. Оптимальные условия для инфицирования растений создаются на тяжелых (суглинистых) почвах. Кислотность в диапазоне рН от 4,5 до 8 не имеет существенного значения.Important conditions determining the development of rhizoctonia in potatoes are the temperature and humidity of the soil and air. The optimum soil temperature for the development of the disease is about 17 ° C, humidity - 60-70% of the total moisture capacity. Optimal conditions for plant infection are created on heavy (loamy) soils. Acidity in the pH range from 4.5 to 8 is not significant.

Вредоносность проявляется на всех формах развития заболевания. Особенно опасно поражение ростков и взошедших растений, приводящее к сильному изреживанию всходов (до 15-20%) и снижению продуктивности растений. Урожай стабильно уменьшается на 10-15%, а в отдельные годы - до 30-40%.Maliciousness manifests itself in all forms of the development of the disease. Especially dangerous is the defeat of shoots and sprouted plants, leading to severe thinning of seedlings (up to 15-20%) and a decrease in plant productivity. Harvest steadily decreases by 10-15%, and in some years - up to 30-40%.

Для защиты картофеля от ризоктониоза и стимуляции роста картофеля в вегетационный период его клубни обрабатывали препаратом в соответствии со способом по примеру 3.1. перед посадкой в почву.To protect potatoes from rhizoctoniosis and stimulate the growth of potatoes during the growing season, their tubers were treated with the drug in accordance with the method of example 3.1. before planting in the soil.

2015 год. В период вегетации были проведены 3 учета (через 4, 6, 10 недель после посадки) по оценке влияния биоагента на пораженность стеблей и столонов картофеля четырех сортов разных групп спелости: ранних сортах Любава и Юна, среднераннем - Свитанок киевский и среднеспелом - Хозяюшка.2015 year. During the growing season, 3 counts were performed (4, 6, 10 weeks after planting) to assess the effect of the bioagent on the affection of potato stems and stolons of four varieties of different ripeness groups: early varieties Lyubava and Yuna, mid-early - Svitanok Kiev and mid-season - Hostess.

Учет через 6 недель показал, что под действием заявляемого биопрепарата на всех сортах увеличивалась биомасса растений, особенно на раннем сорте Любава (в 3,8 раз), а на среднеспелом (Хозяюшка) - всего в 1,1 раза. Та же тенденция сохраняется по высоте растений и количеству стеблей.Accounting after 6 weeks showed that under the influence of the claimed biological product, the biomass of plants increased in all varieties, especially in the early Lyubava cultivar (3.8 times), and in mid-season (Hostess) - only 1.1 times. The same trend persists in plant height and the number of stems.

Суспензия энтомопатогенного гриба Beauveria bassiana (Bb) статистически достоверно оказала ростостимулирующее действие на картофель. Высота растений увеличивалась, особенно в начальный период роста и через 6 неделю на сорте Любава и Свитанок киевский в 1,3 (Bb) раза превышала контрольные растения.A suspension of the entomopathogenic fungus Beauveria bassiana (Bb) statistically significantly exerted a growth-promoting effect on potatoes. Plant height increased, especially in the initial growth period and after 6 weeks on the Lyubava and Svitanok Kiev cultivars, 1.3 (Bb) times higher than control plants.

В контрольных вариантах (без применения биопрепаратов) распространенность болезни на стеблях была самая высокая на сортах Юна и Хозяюшка, которая достигала 82,4-85,7%. В опытных образцах стебли, практически, не были поражены ризоктониозом (единично наблюдали штрихи и небольшие язвочки - поражение первым баллом, а в контроле - 1, 2 и 3 баллами, т.е. присутствовали язвы на стебле длиной 50 мм и более). Распространенность болезни на стеблях значительно снизилась на всех сортах, независимо от микробного агента в 2,1-14,1 раз. Однако, лучшие результаты получены при использовании В. bassiana, особенно на раннеспелых сортах Любава и Юна (снижение по сравнению с контролем в 5,3-6,2 раза). Соответственно снижалось и развитие болезни на стеблях: В. bassiana лучше оздоравливал ранние сорта - Любаву и Юну, на которых развитие болезни снизилось до 2,1-2,7%, т.е. - в 7,3-10,6 раз.In the control variants (without the use of biological products), the prevalence of the disease on the stems was the highest on the Yuna and Khozayushka varieties, which reached 82.4-85.7%. In the experimental samples, the stems were practically not affected by rhizoctoniosis (single strokes and small sores were observed - the lesion was the first point, and in the control - 1, 2 and 3 points, i.e. ulcers were present on the stalk with a length of 50 mm or more). The prevalence of the disease on the stems decreased significantly in all varieties, regardless of the microbial agent, 2.1-14.1 times. However, the best results were obtained using B. bassiana, especially on early ripening varieties Lyubava and Yuna (a decrease of 5.3-6.2 times compared with the control). Accordingly, the development of the disease on the stems decreased: B. bassiana better healed the early varieties - Lubava and Yuna, on which the development of the disease decreased to 2.1-2.7%, i.e. - 7.3-10.6 times.

Через 10 недель в опытных вариантах растения всех сортов достоверно были выше контрольных, в среднем в 1,2-1,6 раза (табл. 4). По увеличению количества стеблей в кусте достоверные различия получены на сортах Свитанок киевский и Юна. Под воздействием биоагентов статистически достоверно увеличивалась по сравнению с контролем (р<0.05) общая биомасса растений (Хозяюшка и Юна) в 2,0-2,3 раза при обработке В. bassiana.After 10 weeks in the experimental variants, plants of all varieties were significantly higher than the control ones, on average 1.2-1.6 times (Table 4). According to the increase in the number of stems in the bush, significant differences were obtained on the Svitanok Kievsky and Yuna varieties. Under the influence of bioagents, the total biomass of plants (Hostess and Yuna) was statistically significantly increased compared with the control (p <0.05) by 2.0–2.3 times when treated with B. bassiana.

В большей степени, на контроле были поражены ризоктониозом стебли сортов Свитанок киевский и Хозяюшка: средний балл поражения составил 0,6-0,8 баллов (отмечено поражение 3 и 4 баллами, т.е. язвы на стебле были длиной 50 мм и более). На сортах Любава и Юна средний балл поражения составил 0,4. Под воздействием препарата произошло значительное оздоровление стеблей на всех сортах (единично штрихи и небольшие язвочки - поражение первым баллом).To a greater extent, the stems of the Svitanok Kiev and Khozayushka varieties were affected by the rhizoctonia in the control: the average lesion score was 0.6-0.8 points (a lesion of 3 and 4 points was noted, i.e. ulcers on the stem were 50 mm or more in length) . On varieties Lyubava and Yuna, the average defeat score was 0.4. Under the influence of the preparation, a significant improvement of the stems occurred in all varieties (singular strokes and small sores - defeat with the first mark).

Figure 00000008
Figure 00000008

Микробные агенты положительно повлияли на увеличение общего количества столонов (в 2,8-2,2-1,3-1,7 раз) соответственно на сортах: Любава, Свитанок киевский, Хозяюшка и Юна, при снижении количества пораженных и опавших.Microbial agents positively influenced the increase in the total number of stolons (2.8-2.2-1.3-1.7 times), respectively, in the varieties: Lyubava, Svitanok Kiev, Khozayushka and Yuna, while reducing the number of affected and fallen.

Распространенность болезни на стеблях в контроле (без применения препарата) была самая высокая на сорте Свитанок киевский и достигала 94,4%, меньшее - на сорте Хозяюшка (но статистически не доказана).The prevalence of the disease on the stems in the control (without the use of the drug) was the highest on the Svitanok Kiev variety and reached 94.4%, the smaller on the Hostess variety (but not statistically proven).

Таким образом, применение препаратов позволило значительно снизить (р<0.05) распространенность болезни на всех сортах. При применении В. bassiana снизилась распространенность ризоктониоза на стеблях (р<0.05) в 4,5 (Любава) - 3,5 (Свитанок киевский) - 7,2 (Хозяюшка) - 3,5 (Юна).Thus, the use of drugs has significantly reduced (p <0.05) the prevalence of the disease in all varieties. When B. bassiana was used, the prevalence of rhizoctonia in the stems decreased (p <0.05) in 4.5 (Lyubava) - 3.5 (Svitanok Kiev) - 7.2 (Hostess) - 3.5 (Yuna).

Препарат на основе биомассы энтомопатогенного гриба В. bassiana был высокоэффективен. На ранних сортах: Любаве и Юне биологическая эффективность В. bassiana достигала 84,8-88,5%, а на среднеспелом сорте Хозяюшка - 94,0%.The drug based on the biomass of the entomopathogenic fungus B. bassiana was highly effective. In the early varieties: Lyubava and Yuna, the biological effectiveness of B. bassiana reached 84.8-88.5%, and in the mid-season variety Hostess - 94.0%.

Figure 00000009
Figure 00000009

При копке картофеля (3 сентября 2015 г.) была определена пораженность клубней путем оценки развития склероциального индекса (S.i.) и распространенности ризоктониоза (табл. 5). Препарат положительно повлиял на оздоровление клубней. Гриб В. bassiana снижал заболеваемость и увеличивал выход здоровых клубней, в среднем, в 1,5-2,7 раза. Пораженность опасной склероциальной формой ризоктониоза резко снизилась.When digging potatoes (September 3, 2015), tuber damage was determined by assessing the development of the sclerotic index (S.i.) and the prevalence of rhizoctonia (Table 5). The drug had a positive effect on the healing of tubers. The fungus B. bassiana reduced the incidence and increased the yield of healthy tubers, on average, 1.5-2.7 times. The prevalence of the dangerous sclerotic form of rhizoctonia has sharply decreased.

Склероциальный индекс снизился в 11,4 (с. Любава) и в 5,7 (с. Юна) раз. Энтомопатогенный гриб В. bassiana положительно повлиял на снижение (в 3,2-5,7 раз) склероциальной стадии на этих сортах.The sclerotic index decreased 11.4 (s. Lyubava) and 5.7 (s. Yuna) times. The entomopathogenic fungus B. bassiana positively influenced the decrease (3.2–5.7 times) in the sclerotic stage in these varieties.

Полностью свободными от склероциев были клубни сорта Любава. Снижение распространенности склероциальной стадии болезни на клубнях сорта Юна - в 1,4 (смесь) - 4,0 (гриб) раза, на сортах Хозяюшка и Свитанок киевский колебалось в 1,5-2,7 раза. Очевидно, растения, выросшие из клубней, обработанные микробиологическим агентом были более устойчивы к суховейным явлениям, которые наблюдались в конце июня-начале июля, и попали под двойной стресс.Tubers of the Lyubava variety were completely free from sclerotia. The decrease in the prevalence of the sclerotic stage of the disease on Yuna tubers was 1.4 (mixture) - 4.0 (mushroom) times, on the Khozayushka and Svitanok Kiev varieties it varied 1.5-2.7 times. Obviously, plants grown from tubers treated with a microbiological agent were more resistant to dry wind phenomena, which were observed in late June-early July, and came under double stress.

Результаты, полученные на среднеспелом сорте Хозяюшка, показали, что без применения препаратов на этом сорте более 50% клубней были покрыты склероциями (очевидно, из-за более позднего срока созревания).The results obtained in the mid-season variety Hostess showed that without the use of preparations on this variety, more than 50% of the tubers were covered with sclerotia (apparently, due to the later ripening period).

Помимо оценки зараженности столонов, стеблей и клубней ризоктониозом нами оценено влияние микробиологических агентов на Rh. solani в ризосфере картофеля сорта Любава. Анализ заселенности почвы грибом Rhizoctonia solani проводили в лаборатории методом множественных почвенных таблеток при помощи пробоотборника (табл. 6).In addition to assessing the infection of stolons, stems, and tubers with rhizoctoniosis, we evaluated the effect of microbiological agents on Rh. solani in the rhizosphere of the potato variety Lyubava. An analysis of the soil population by the fungus Rhizoctonia solani was carried out in the laboratory by the method of multiple soil tablets using a sampler (Table 6).

Значительно снизилось количество пропагул Rh. solani в почве (в 9,2 раза) под воздействием В. bassiana.Significantly decreased the number of propaganda Rh. solani in the soil (9.2 times) under the influence of B. bassiana.

Figure 00000010
Figure 00000010

Таким образом, энтомопатогенный гриб Beauveria bassiana не только контролировал возбудителя ризоктониоза на стеблях, столонах и клубнях картофеля, но и снижал численность пропагул Rh. solani в почве, что значительно повлияло на качество и количество клубней.Thus, the entomopathogenic fungus Beauveria bassiana not only controlled the causative agent of rhizoctonia in the stems, stolons, and tubers of potatoes, but also reduced the number of Rh propagules. solani in the soil, which significantly affected the quality and quantity of tubers.

2016 год. Аналогичные учеты проведены в 2016 году на трех сортах. При учете на 4-ю неделю после посадки на сорте Любава не отмечалось проявления заболевания, а на сортах Свитанок киевский и Хозяюшка, хотя и было поражение, но только первым, и частично вторым баллами.2016 year. Similar surveys were carried out in 2016 on three varieties. When counting on the 4th week after planting on the Lyubava cultivar, there was no manifestation of the disease, and on the Svitanok varieties Kiev and Khozayushka, although there was a defeat, it was only the first and partially the second points.

Figure 00000011
Figure 00000011

Применение препаратов снизило распространенность ризоктониоза на стеблях в 1,6-1,7 раза (В. bassiana) по сравнению с контролем. При следующих учетах происходило дальнейшее улучшение состояния стеблей: в 2 раза на 6-ю неделю и в 3,5-6,4 раза - на 10-ю (табл. 7).The use of drugs reduced the prevalence of rhizoctonia in the stems 1.6-1.7 times (B. bassiana) compared with the control. In the following counts, the stems improved further: 2 times at the 6th week and 3.5-6.4 times at the 10th week (Table 7).

Ростостимулирующее действие выражалось в ускорении развития растений, увеличения массы, высоты и количества стеблей и столонов. Через месяц поле посадки статистически достоверное увеличение массы растений под воздействием микробного агента (в вариантах с обработкой клубней перед посадкой) наблюдали только на раннеспелом сорте Любава - в 1,5-1,7 раз больше по сравнению с контролем (табл. 8).The growth-promoting effect was expressed in accelerating the development of plants, increasing the mass, height and number of stems and stolons. After a month, the planting field, a statistically significant increase in plant mass under the influence of a microbial agent (in variants with the treatment of tubers before planting) was observed only in the early ripening Lyubava variety - 1.5-1.7 times more compared to the control (Table 8).

Figure 00000012
Figure 00000012

Однако, в этот период достоверных различий по высоте, количеству стеблей и столонов не получено, т.к. стояла сухая погода (осадков выпало в 1,5 раза меньше нормы). Тем не менее, на сортах среднеранней (Свитанок киевский) и среднеспелой (Хозяюшка) групп спелости, препарат оказал положительное действие на увеличение стеблей и столонов - в 1,3 раза (на сорте Хозяюшка) больше стеблей и в 2 раза - столонов при применении В. bassiana. На этих же сортах стабильно шло увеличение показателей на 6-ю неделю. На 10-ю неделю все препараты и на всех сортах достоверно увеличили массу растений в 1,4 раза (сорта Любава и Свитанок киевский) и в 1,6-2 раза - на сорте Хозяюшка, количество стеблей - в 1,1 раза и, особенно - столонов в 1,8-2,7 раз в зависимости от сорта.However, during this period no significant differences in height, number of stems and stolons were obtained, because the weather was dry (precipitation was 1.5 times less than normal). Nevertheless, in the varieties of medium early (Svitanok Kiev) and mid-ripening (Hostess) ripeness groups, the drug had a positive effect on the increase in stems and stolons - 1.3 times (on the Hostess variety) more stems and 2 times - stolons when applying B bassiana In the same varieties, the indices continued to increase steadily for the 6th week. By the 10th week, all preparations and in all varieties significantly increased the mass of plants 1.4 times (varieties Lyubava and Svitanok Kiev) and 1.6-2 times - on the variety Hostess, the number of stems - 1.1 times and, especially - stolons 1.8-2.7 times depending on the variety.

Figure 00000013
Figure 00000013

На клубнях нового урожая, на сортах Свитанок киевский и Хозяюшка развитие склероциальной стадии было ниже, чем в контрольном варианте в 2,8-3,3 раза - при предпосадочной обработке В. bassiana. На сорте Любава в опытных вариантах все клубни были, практически, свободны от черной парши (табл. 9). Выход здоровых клубней увеличился, в 5,5 раза на сорте Хозяюшка и в 5,2 раза на сорте Любава. Пораженность опасной склероциальной формой ризоктониоза на клубнях нового урожая резко снизилась.In the tubers of the new crop, in the Svitanok Kiev and Khozayushka varieties, the development of the sclerocial stage was lower than in the control variant by 2.8-3.3 times - with preplanting treatment of B. bassiana. In the Lyubava cultivar in experimental variants, all tubers were practically free of black scab (Table 9). The yield of healthy tubers increased 5.5 times in the Hostess variety and 5.2 times in the Lyubava variety. The prevalence of the dangerous sclerotic form of rhizoctonia in the tubers of the new crop sharply decreased.

Склероциальный индекс (S.i.) снизился в 6,0 (сорт Любава), в 3,6 (сорт Свитанок киевский) и в 2,2 раза (сорт Хозяюшка).The sclerocial index (S.i.) decreased by 6.0 (cultivar Lyubava), by 3.6 (cultivar Svitanok Kiev) and 2.2 times (cultivar Khozyayushka).

Клубни всех сортов, обработанные экспериментальным препаратом перед посадкой, были поражены, в основном, только единичными склероциями, занимающие 1/10 поверхности (20,0-39,0%) и незначительно - 1/4 поверхности (0-8,3%).Tubers of all varieties treated with the experimental preparation before planting were mainly affected by single sclerotia, occupying 1/10 of the surface (20.0-39.0%) and slightly - 1/4 of the surface (0-8.3%) .

Снижение распространенности склероциальной стадии болезни на клубнях сорта Любава - в 3,5 (В. bassiana) раза, на сортах Хозяюшка и Свитанок киевский колебалось в 1,5-3,0 раза.A decrease in the prevalence of the sclerotic stage of the disease in tubers of the Lyubava variety was 3.5 times (B. bassiana) times, on the Host and the Svitanok Kiev varieties 1.5-3.0 times.

Пример. 4. Способ обработки картофеля в вегетационный период для защиты от колорадского жука.Example. 4. A method of processing potatoes during the growing season to protect against the Colorado potato beetle.

4.1. Заявляемый способ включает опрыскивание картофеля в вегетационный период водным раствором биопрепарата распылением. В качестве водного раствора биопрепарата используют спорово-мицелиальную биомассу штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды с титром не менее 106 КОЕ/мл и расходом водного раствора биопрепарата 300 л на 1 гектар площади посадки картофеля.4.1. The inventive method includes spraying potatoes during the growing season with an aqueous solution of a biological product by spraying. As an aqueous solution of a biological product, spore-mycelial biomass of a strain of the entomopathogenic fungus Beauveria bassiana IC 1530-25-1 and components of a nutrient medium with a titer of at least 10 6 CFU / ml and an aqueous solution of a biological product of 300 l per 1 hectare of potato planting area are used.

4.2. Оценка эффективных концентраций препарата на основе В. bassiana в отношении колорадского жука в лабораторном опыте4.2. Evaluation of effective concentrations of the drug based on B. bassiana in relation to the Colorado potato beetle in a laboratory experiment

Эффективность биологического агента - Beauveria bassiana (B.b) в лабораторных условиях зависела от возраста личинок и времени, прошедшего от заражения. Личинки первого и второго возрастов более восприимчивы к действию В.b (1×106 КОЕ/мл), их гибель хотя и начиналась на вторые-третьи сутки (БЭ=23,3%), на седьмые сутки достигала 50%-й гибели, а на 15-е сутки - 100% (L1) (табл. 10). Личинки 3-4 возрастов более устойчивы к действию: на 3-5 сутки эффективность составила около 17%, а на 20-е сутки - 50%. Имаго колорадского жука еще более устойчиво к действию энтомопатогена: биологическая эффективность на 20-е сутки была на уровне 21,4%.The effectiveness of the biological agent - Beauveria bassiana (Bb) in the laboratory depends on the age of the larvae and the time elapsed from infection. Larvae of the first and second ages are more susceptible to the action of B. b (1 × 10 6 CFU / ml), although their death began on the second or third day (BE = 23.3%), on the seventh day it reached 50% death and on the 15th day - 100% (L 1 ) (table. 10). Larvae of 3-4 ages are more resistant to action: on day 3-5, the efficiency was about 17%, and on day 20 - 50%. The imago of the Colorado potato beetle is even more resistant to the action of an entomopathogen: biological efficiency on the 20th day was at the level of 21.4%.

Figure 00000014
Figure 00000014

В. bassiana (титр 1×107 КОЕ/мл) на личинок 1-2 возрастов оказывала несколько меньший эффект, чем 1×106, однако, на 15% больше вызывала гибель личинок 3-го возраста, и, практически на одном уровне - в отношении личинок 4-г возраста и в 2 раза более эффективна против имаго.B. bassiana (titer 1 × 10 7 CFU / ml) on larvae of 1-2 ages had a slightly smaller effect than 1 × 10 6 , however, 15% more caused the death of larvae of the 3rd age, and, almost at the same level - in relation to larvae of 4 g age and 2 times more effective against adults.

Таким образом, спорово-мицелиальная биомасса энтомопатогенного гриба Beauveria bassiana с титром водной суспензии (1×106 КОЕ/мл) более эффективно воздействовала на личинок 1-2 возрастов, а с титром 1×107 КОЕ/мл - на личинок 3-4 возрастов и имаго.Thus, the spore-mycelial biomass of the entomopathogenic fungus Beauveria bassiana with the titer of an aqueous suspension (1 × 10 6 CFU / ml) more effectively affected larvae of 1-2 ages, and with a titer of 1 × 10 7 CFU / ml - 3-4 ages and adults.

4.3. Влияние заявляемого энтомопатогенного препарата на основе штамма Beauveria bassiana на колорадского жука в полевых условиях4.3. The effect of the inventive entomopathogenic preparation based on a Beauveria bassiana strain on a Colorado potato beetle in the field

В модельном полевом опыте, проведенном в «Саду Мичуринцев» Новосибирского ГАУ на участке, где преобладали личинки младших возрастов, эффективность испытуемого препарата составила 56,7%, а всех возрастов - только 24,6-31,2% (табл. 11).In a model field experiment conducted in the “Michurintsev Garden” of the Novosibirsk State Agrarian University on a site dominated by larvae of younger ages, the effectiveness of the test drug was 56.7%, and of all ages - only 24.6-31.2% (Table 11).

Figure 00000015
Figure 00000015

Таким образом, в полевых опытах для обеспечения высокой эффективности биопрепаратов необходимо своевременно проводить обработки в начале отрождения и появления личинок первых 2-х возрастов.Thus, in field experiments, to ensure the high efficiency of biological products, it is necessary to conduct timely processing at the beginning of hatching and the appearance of larvae of the first 2 ages.

Инсектицидное действие биоагентов на посадках картофеля в полевых условиях на сортах разных групп спелостиInsecticidal effect of bioagents on planting potatoes in the field on varieties of different ripeness groups

На стационарном участке «Сада Мичуринцев» Новосибирского ГАУ была оценена эффективность заявляемого энтомопатогенного препарата в отношении колорадского жука на трех сортах картофеля разных групп спелости.On the stationary site "Garden Michurintsev" Novosibirsk GAU was evaluated the effectiveness of the claimed entomopathogenic drug against Colorado potato beetle on three varieties of potatoes of different ripeness groups.

В результате более ранней теплой погоды вегетационного периода 2016 г. колорадский жук на посадках картофеля появился раньше, чем в 2015 году и был более многочислен (на момент опрыскивания (29 июня) - по 30-50 экз./куст и более). Осадки, выпавшие в июле (126% от нормы), помешали сделать своевременные обработки посадок. Опрыскивание посадок картофеля препаратом Фитоп 22.78 против колорадского жука показало их более низкую по сравнению с 2015 г. инсектицидную активность (табл. 12) (благоприятные погодные условия способствовали быстрому развитию колорадского жука, а обильные последующие дожди снизили эффективность препаратов).As a result of the earlier warm weather of the growing season of 2016, the Colorado potato beetle on potato plantations appeared earlier than in 2015 and was more numerous (at the time of spraying (June 29) - 30-50 specimens / bush or more). Precipitation in July (126% of the norm) prevented timely processing of landings. Spraying potato plantings with Fitop 22.78 against the Colorado potato beetle showed their lower insecticidal activity compared to 2015 (Table 12) (favorable weather conditions contributed to the rapid development of the Colorado potato beetle, and heavy subsequent rains reduced the effectiveness of the preparations).

Figure 00000016
Figure 00000016

На среднераннем (Свитанок киевский) и среднеспелом (Хозяюшка) сортах эффективность биопрепарата была, практически, на одном уровне (66-68%), а на раннеспелом сорте Любава эффективность в разные годы была нестабильной и колебалась от 52,7% до 80%.On the middle early (Svitanok Kiev) and mid-season (Hostess) varieties, the effectiveness of the biological product was practically at the same level (66-68%), and on the early ripening Lyubava variety, the efficiency was unstable in different years and ranged from 52.7% to 80%.

Пример. 5. Способ обработки клубней картофеля для защиты от грибных патогенов и стимуляции роста картофеля в вегетационный период, а также обработки ботвы картофеля в вегетационный период для защиты от колорадского жука.Example. 5. A method of processing potato tubers to protect against fungal pathogens and stimulate potato growth during the growing season, as well as treating potato tops during the growing season to protect against Colorado potato beetle.

Заявляемый способ включает предпосадочную обработку клубней картофеля биопрепаратом в жидкой форме путем полного погружения в него клубней картофеля или смачивания всей поверхности. В качестве жидкой формы биопрепарата используют 1-3%-ный рабочую суспензию спорово-мицелиальной биомассы штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды с титром не менее 105 КОЕ/мл. Обработку клубней картофеля указанным рабочим составом биопрепарата производят однократно перед посадкой с расходом рабочей суспензии биопрепарата 10 литров на 1 тонну картофеля.The inventive method includes pre-planting treatment of potato tubers with a biological product in liquid form by completely immersing potato tubers in it or wetting the entire surface. As a liquid form of the biological product, a 1-3% working suspension of spore-mycelial biomass of the strain of the entomopathogenic fungus Beauveria bassiana IC 1530-25-1 and nutrient components with a titer of at least 10 5 CFU / ml is used. Processing potato tubers with the specified working composition of a biological product is carried out once before planting with a flow rate of a working suspension of a biological product of 10 liters per 1 ton of potato.

Предпосадочная обработка клубней картофеля обеспечивает защиту от грибных патогенов и стимуляцию роста картофеля в вегетационный период, что подтверждается, результататами полевых испытаний по стимуляции роста картофеля в вегетационный период и защиты его от ризоктониоза (см. пункт 3.2 примера 3).The pre-planting treatment of potato tubers provides protection against fungal pathogens and stimulates the growth of potatoes during the growing season, which is confirmed by the results of field tests to stimulate the growth of potatoes during the growing season and protect it from rhizoctonia (see paragraph 3.2 of Example 3).

Далее заявляемый способ включает опрыскивание картофеля в вегетационный период водным раствором биопрепарата распылением. В качестве водного раствора биопрепарата используют спорово-мицелиальную биомассу штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды с титром не менее 106 КОЕ/мл и расходом водного раствора биопрепарата 300 л на 1 гектар площади посадки картофеля.Further, the claimed method includes spraying potatoes during the growing season with an aqueous solution of a biological product by spraying. As an aqueous solution of a biological product, spore-mycelial biomass of a strain of the entomopathogenic fungus Beauveria bassiana IC 1530-25-1 and components of a nutrient medium with a titer of at least 10 6 CFU / ml and an aqueous solution of a biological product of 300 l per 1 hectare of potato planting area are used.

Для защиты от колорадского жука посадки картофеля в вегетационный период опрыскивают водной суспензией В. bassiana IC 1530-25-1 с титром 1×106 КОЕ/мл (при преобладании личинок 1-2 возрастов) или 1×107 - разных личиночных возрастов и имаго. Способ нанесения биоагента - наземное механизированное опрыскивание (ОП-2000-М, агрегатируемый с МТ3-82). Расход рабочей жидкости из расчета 300 л/га (300 мл исходной концентрации В. bassiana IC 1530-25-1 с титром 1×109 КОЕ/мл).To protect against the Colorado potato beetle, potato plantings during the growing season are sprayed with an aqueous suspension of B. bassiana IC 1530-25-1 with a titer of 1 × 10 6 CFU / ml (with prevalence of larvae of 1-2 instars) or 1 × 10 7 of different larval ages and imago. The method of applying the bioagent is ground mechanized spraying (OP-2000-M, aggregated with MT3-82). The flow rate of the working fluid at the rate of 300 l / ha (300 ml of the initial concentration of B. bassiana IC 1530-25-1 with a titer of 1 × 10 9 CFU / ml).

Для защиты небольших площадей посадок картофеля в частном секторе в период отрождения личинок колорадского жука препарат применяется в виде водной суспензии (3 мл маточного состава - 1×109 КОЕ/мл) в объеме 3 л/100 м2 (на 1 сотку), используя ручной опрыскиватель с мелким распылом (например - марки «Квазар»).To protect small areas of potato planting in the private sector during the hatching period of Colorado potato beetle larvae, the drug is used in the form of an aqueous suspension (3 ml of the mother stock - 1 × 10 9 CFU / ml) in a volume of 3 l / 100 m 2 (per 1 acre), fine sprayer (for example, “Quasar” brand).

В результате проведенной серии экспериментов (лабораторных, полевых, модельных, производственных) выявилась общая картина эффектов от применения грибного штамма на картофеле, который обладал не только инсектицидной активностью (при опрыскивании посадок картофеля), но и антифунгальным и ростосимулирующее действием (при обработке клубней перед посадкой), что способствовала получению здорового, качественного и более высокого урожая (см. лабораторные данные и результаты полевых испытаний п.п. 4.2 и 4.3 примера 4).As a result of a series of experiments (laboratory, field, model, production), a general picture of the effects of the use of the mushroom strain on potatoes was revealed, which possessed not only insecticidal activity (when spraying potato plantings), but also antifungal and growth-stimulating effect (when processing tubers before planting ), which contributed to a healthy, high-quality and higher yield (see laboratory data and field test results in paragraphs 4.2 and 4.3 of example 4).

Таким образом, из описания изобретения видно достижение заявляемого технического результата, а именно: получен штамм гриба Beauveria bassiana, обладающего свойством защиты картофеля от колорадского жука, возбудителей парши, особенно - грибного патогена Thanatephorus cucumeris (несовершенная стадия гриба - Rhizoctonia solani), вызывающего ризоктониоз или черную паршу картофеля, а также обладающий свойством стимулирования роста картофеля в вегетационный период.Thus, from the description of the invention, the achievement of the claimed technical result is visible, namely: a strain of the fungus Beauveria bassiana is obtained, which has the property of protecting potatoes from the Colorado potato beetle, the causative agents of scab, especially the fungal pathogen Thanatephorus cucumeris (imperfect stage of the fungus - Rhizoctonia solani), causing rhizoctonia or black scab of potatoes, as well as having the property of stimulating the growth of potatoes in the growing season.

Claims (3)

1. Штамм гриба Beauveria bassiana IC 1530-25-1, для производства биопрепарата против колорадского жука, грибных патогенов и стимуляции роста картофеля в вегитационный период, депонированного в Биоресурсном Центре Всероссийской Коллекции Микроорганизмов (БРЦ ВКПМ) НИЦ «Курчатовский институт» - ГосНИИ генетика, регистрационный номер ВКПМ: F-1447.1. The strain of the fungus Beauveria bassiana IC 1530-25-1, for the production of a biological product against the Colorado potato beetle, mushroom pathogens and stimulation of potato growth during the growing season, deposited at the Bioresource Center of the All-Russian Collection of Microorganisms (BRC VKPM) SIC “Kurchatov Institute” - State Research Institute of Genetics, VKPM registration number: F-1447. 2. Биопрепарат против колорадского жука, грибных патогенов и стимуляции роста картофеля в вегетационный период, включающий суспензию культуральной жидкости микроорганизма, отличающийся тем, что в качестве суспензии культуральной жидкости микроорганизма он содержит спорово-мицелиальную биомассу штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 по п. 1 формулы с титром не менее 109 КОЕ/мл и компоненты питательной среды после культивирования указанного штамма энтомопатогенного гриба.2. Biological product against Colorado potato beetle, fungal pathogens and stimulation of potato growth during the growing season, including a suspension of the culture fluid of the microorganism, characterized in that as a suspension of the culture fluid of the microorganism it contains spore-mycelial biomass of the strain of the entomopathogenic fungus Beauveria bassiana IC 1530-25-1 according to claim 1 of the formula with a titer of at least 10 9 CFU / ml and components of the nutrient medium after culturing the indicated strain of an entomopathogenic fungus. 3. Способ стимуляции роста картофеля в вегетационный период, защиты его от колорадского жука и грибных патогенов, включающий предпосадочную обработку клубней картофеля биопрепаратом в жидкой форме путем погружения в него клубней картофеля и/или опрыскивание картофеля в вегетационный период водным раствором биопрепарата распылением, отличающийся тем, что при предпосадочной обработке клубней картофеля в качестве жидкой формы биопрепарата используют 1-3%-ный водный раствор спорово-мицелиальной биомассы штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды по пп. 1, 2 формулы с титром не менее 105 КОЕ/мл, обработку клубней картофеля указанным водным раствором биопрепарата производят однократно с расходом водного раствора биопрепарата 10 литров на 1 тонну картофеля, а при опрыскивании картофеля в вегетационный период водным раствором биопрепарата в качестве него используют спорово-мицелиальную биомассу штамма энтомопатогенного гриба Beauveria bassiana IC 1530-25-1 и компонентов питательной среды по пп. 1, 2 формулы с титром не менее 106 КОЕ/мл и расходом водного раствора биопрепарата 300 л на 1 гектар площади посадки картофеля.3. A method of stimulating the growth of potatoes in the growing season, protecting it from the Colorado potato beetle and fungal pathogens, including pre-planting treatment of potato tubers with a biological product in liquid form by immersing potato tubers in it and / or spraying the potatoes with a water solution of a biological product during the growing season, characterized in that that during the pre-planting treatment of potato tubers, a 1-3% aqueous solution of spore-mycelial biomass of a strain of entomopathogenic fungus Beau is used as a liquid form of a biological product veria bassiana IC 1530-25-1 and nutrient components according to claims 1, 2 formulas with a titer of at least 10 5 CFU / ml, potato tubers are treated with the specified aqueous solution of a biological product once with a flow rate of an aqueous solution of a biological product of 10 liters per 1 ton of potato, and when spraying potatoes with a water solution of a biological product during the growing season, a spore is used as it -mycelial biomass of a strain of the entomopathogenic fungus Beauveria bassiana IC 1530-25-1 and nutrient components according to claims 1, 2 formulas with a titer of at least 10 6 CFU / ml and a flow rate of an aqueous solution of a biological product of 300 l per 1 hectare of potato planting area.
RU2019122943A 2019-07-16 2019-07-16 Beauveria bassiana fungus strain used to produce a biopreparation for the colorado potato beetle, fungal pathogens and potato growth stimulation during the vegetative period, a biopreparation based on the same, and a potato growth stimulation method during the vegetation period, protecting it from the colorado potato beetle and crater rot RU2704859C1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
RU2019122943A RU2704859C1 (en) 2019-07-16 2019-07-16 Beauveria bassiana fungus strain used to produce a biopreparation for the colorado potato beetle, fungal pathogens and potato growth stimulation during the vegetative period, a biopreparation based on the same, and a potato growth stimulation method during the vegetation period, protecting it from the colorado potato beetle and crater rot

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
RU2019122943A RU2704859C1 (en) 2019-07-16 2019-07-16 Beauveria bassiana fungus strain used to produce a biopreparation for the colorado potato beetle, fungal pathogens and potato growth stimulation during the vegetative period, a biopreparation based on the same, and a potato growth stimulation method during the vegetation period, protecting it from the colorado potato beetle and crater rot

Publications (1)

Publication Number Publication Date
RU2704859C1 true RU2704859C1 (en) 2019-10-31

Family

ID=68500627

Family Applications (1)

Application Number Title Priority Date Filing Date
RU2019122943A RU2704859C1 (en) 2019-07-16 2019-07-16 Beauveria bassiana fungus strain used to produce a biopreparation for the colorado potato beetle, fungal pathogens and potato growth stimulation during the vegetative period, a biopreparation based on the same, and a potato growth stimulation method during the vegetation period, protecting it from the colorado potato beetle and crater rot

Country Status (1)

Country Link
RU (1) RU2704859C1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2751916C1 (en) * 2020-09-21 2021-07-20 Общество с ограниченной ответственностью "Органик парк" Strain of entomopathogenic fungus beauveria bassiana for protection of agricultural plants from insects and mites, plant pests
CN113373067A (en) * 2021-07-28 2021-09-10 贵州省烟草公司遵义市公司 Compound microbial agent capable of promoting plant growth and application thereof
CN115161214A (en) * 2021-12-30 2022-10-11 云南云叶化肥股份有限公司 Biological organic fertilizer for preventing and controlling soil insects, preparation method and application

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
UA84325C2 (en) * 2006-10-27 2008-10-10 ДНЕПРОПЕТРОВСКИЙ НАЦИОНАЛЬНЫЙ УНИВЕРСИТЕТ імені ОЛЕСЯ ГОНЧАРА Strain of the fungus beauveria bassiana, applied for the production of insecticidial biopreparation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
UA84325C2 (en) * 2006-10-27 2008-10-10 ДНЕПРОПЕТРОВСКИЙ НАЦИОНАЛЬНЫЙ УНИВЕРСИТЕТ імені ОЛЕСЯ ГОНЧАРА Strain of the fungus beauveria bassiana, applied for the production of insecticidial biopreparation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ЦВЕТКОВА В.П. и др. Инновационные технологии в растениеводстве. Биотехнологический подход к решению проблем, Экология, окружающая среда и здоровье человека: XXI век, Сборник статей по материалам II международной научно-практической конференции, 2016, с.306-311. *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2751916C1 (en) * 2020-09-21 2021-07-20 Общество с ограниченной ответственностью "Органик парк" Strain of entomopathogenic fungus beauveria bassiana for protection of agricultural plants from insects and mites, plant pests
WO2022060252A1 (en) * 2020-09-21 2022-03-24 Общество с ограниченной ответственностью "Органик парк" Strain of the entomopathogenic fungus beauveria bassiana for protecting agricultural crops against crop-destroying insects and ticks
CN113373067A (en) * 2021-07-28 2021-09-10 贵州省烟草公司遵义市公司 Compound microbial agent capable of promoting plant growth and application thereof
CN115161214A (en) * 2021-12-30 2022-10-11 云南云叶化肥股份有限公司 Biological organic fertilizer for preventing and controlling soil insects, preparation method and application

Similar Documents

Publication Publication Date Title
You et al. Multiple criteria-based screening of Trichoderma isolates for biological control of Botrytis cinerea on tomato
AU2017366699A1 (en) Modulated nutritional quality traits in seeds
RU2724464C1 (en) Strains, biopreparation, biopreparation production method and method for biological protection of crops against fusariosis
RU2704859C1 (en) Beauveria bassiana fungus strain used to produce a biopreparation for the colorado potato beetle, fungal pathogens and potato growth stimulation during the vegetative period, a biopreparation based on the same, and a potato growth stimulation method during the vegetation period, protecting it from the colorado potato beetle and crater rot
CN101654658B (en) Pesticidal metarhizium anisopliae strain
Keppanan et al. Isolation and characterization of Metarhizium anisopliae TK29 and its mycoinsecticide effects against subterranean termite Coptotermes formosanus
CN107365710B (en) Metarhizium strain with strong pathogenicity on hazelnut weevil and application thereof
AU2005252465A1 (en) Pochonia chlamydosporia strain PcMR and method to use it in biological control of the root-knot-nematode (meloidogyne spp.)
CN111040976A (en) Bacillus amyloliquefaciens and application thereof
Elshahawy et al. Field application of sclerotial mycoparasites as biocontrol agents to Stromatinia cepivora, the cause of onion white rot
CN109749953B (en) Bacillus cereus, microbial inoculum and preparation method and application thereof
CN110343621A (en) A kind of Trichoderma asperellum strain and its application
JPH09508789A (en) Ancient organism
CN105441332A (en) Beauveria bassiana separated from tussah and application of beauveria bassiana
Türkölmez et al. Clonostachys rosea Strain ST1140: An endophytic plant-growth-promoting fungus, and its potential use in seedbeds with wheat-grain substrate
CN116410867B (en) Aspergillus flavus strain and application thereof
CN108441443B (en) Strain for preventing and treating plant nematodes and application thereof
CN108102992B (en) Microbacterium aurantiacus and application thereof in prevention and treatment of tomato root-knot nematodes
CN107325973B (en) Beauveria bassiana strain with strong pathogenicity on corylus avenae sinensis and application thereof
Cheng et al. Biological control of Qinghai plateau terrestrial weeds with the A. alternata HL-1
EP1570048A2 (en) Biological control agent and formulations
Manjunatha et al. Morphological and molecular identification of stem rot pathogen in berseem (Trifolium alexandrinum L.)
US20140271560A1 (en) Methods for Using Cryptococcus Flavescens Strains for Biological Control of Fusarium Head Blight
KR100347388B1 (en) Microorganism having predacious ability for soil nematoda parasitic on plant from soil, and method for incubating the same
CN117987281B (en) Beauveria bassiana Bbzy230628 strain and application thereof