RU2704859C1 - Beauveria bassiana fungus strain used to produce a biopreparation for the colorado potato beetle, fungal pathogens and potato growth stimulation during the vegetative period, a biopreparation based on the same, and a potato growth stimulation method during the vegetation period, protecting it from the colorado potato beetle and crater rot - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention represents a strain of entomopathogenic fungus Beauveria bassiana IC 1530-25-1, a method which includes pre-planting treatment of potato tubers with biopreparation and biopreparation. When the potatoes tubers are pre-planted, the liquid biopreparation used is 1–3 % aqueous solution of the spore-mycelial biomass of the Beauveria bassiana IC 1530-25-1 entomopathogenic fungus strain and nutrient medium components with a titre of not less than 10⁵ CFU/ml. Potato tubers are treated with the above biopreparation aqueous solution once with consumption of aqueous solution of biopreparation 10 liters per 1 t of potatoes. When potatoes are sprayed during the vegetation period with the aqueous solution of the biopreparation, a spore-micellar biomass of the strain of the entomopathogenic fungus Beauveria bassiana IC 1530-25-1 and nutrient medium components with a titre of not less than 10⁶ CFU/ml and water solution of biopreparation 300 l per 1 hectare of potato planting area.

EFFECT: invention allows to protect potatoes from Colorado potato beetle, fungal pathogen Thanatephorus cucumeris (imperfect stage of fungus – Rhizoctonia solani), causing crater rot or black potato scab, as well as stimulates growth of potatoes during vegetation period.

3 cl, 12 tbl

Description

The invention relates to the microbiological industry, in particular, to the production of plant protection products from harmful insects and fungal pathogens, and relates to a new strain of Beauveria bassiana fungus for the production of an entomopathogenic preparation and a method for stimulating potato growth during the growing season, protecting it from the Colorado potato beetle and rhizoctonia.

The entomopathogenic fungus Beauveria bassiana is an imperfect fungus (Fungi imperfacti) and a division of Deuteromycotonia. The genus Beauveria Vuille belongs to the class Deuteromycites; and differs from other genera by the presence of conidia, which are kept alone, are not arranged in small chains, and have a fertile part of the conidiophore in the form of a zigzag and elongated upward. The Beauveria bassiana species has spherical, non-ellipsoidal conidia 2-3–2–2.5 μm in size, and with conidophores forming dense bundles.

A known strain of fungi of the species Beauveria bassiana VKPM G-399 for the production of entomopathogenic preparations (author's certificate. USSR No. 1688820, IPC A01N 63/00, publ. 07.11.1991).

The specified strain has insufficient productivity and low thermal resistance.

A known strain of the fungus Beauveria bassiana TC-92 for producing an entomopathogenic preparation (against thrips that is harmful to plants of cucumber), which is obtained by selection of the Beauveria bassiana 124/1 strain on liquid and solid nutrient media containing protein-vitamin concentrate (BVC) hydrolyzate and glycerin with subsequent selection of pure cultures for productivity, biological activity on test insects and thermal resistance (RF patent No. 2034469, IPC A01N 63/04, publ. 05/10/1995, the Strain was deposited in the Central collection of microorganisms of the state concern "Bio Reparata "(TSKMK" B ") under the number CCM F-54TS.

A known strain of the fungus Beauveria bassiana ATCC N 74040 (RF patent No. 2103873, IPC A01N 63/00, C12N 1/14, publ. 02/10/1998), intended to obtain an entomopathogenic preparation against cotton weevil, sweet potato whites and cotton horsefly.

A known strain of Beauveria bassiana, deposited in the collection of microorganisms of the Institute of Biochemistry and Physiology of Microorganisms of the Russian Academy of Sciences in Moscow under the number VKM F-3732 D and designed against locust larvae and eggs in capsules (RF patent No. 2172588, IPC A01N 63/00, C12N 1 / 14, published on August 27, 2001). The strain Beauveria bassiana VKM F-3732 D was obtained as a result of directed variability in the productivity of the most active culture isolated from natural sources in places of mass death of insects in the Siberian region. It has increased productivity compared with the known strain in the conditions of the deep fermentation regime - 1.2-2.0 ⋅ ^{10 9} sp / ml. When grown on solid nutrient medium, its productivity is 2.2-5.1⋅10 ⁹ spores / g. The biological activity of the culture fluid of the strain when introduced with food, determined by the death of locust larvae, is 72-92%, and when introduced into the soil - the death of locust eggs in egg capsules is 69-92%.

The closest analogue (prototype) is a strain of the fungus Beauveria bassiana IMB F-100043, deposited at the Institute of Microbiology and Virology. Zabolotnogo NAS of Ukraine and used for the production of insecticidal biological products (Ukrainian patent No. 84325, IPC A01N 63/00, publ. 10.11.2008). The strain was obtained by selection of the isolate of the fungus Beauveria bassiana, obtained from dead individuals of the Colorado potato beetle. The strain has high insecticidal activity against destructive insects, for example, the Colorado potato beetle, American white moth, omnivorous leaflet, apple moth and can be cultivated on a cheap nutrient medium.

However, this prototype strain has not been studied against pathogens of potato scab, especially the fungal pathogen Thanatephorus cucumeris (A.V. Frank) Donk. (the name of the imperfect stage of the fungus, Rhizoctonia solani J.G. Kuhn, is more widespread), which causes rhizoctonia or black scab of potatoes, and also does not have the property of stimulating potato growth during the growing season.

It is known to use the antimicrobial and fungicidal chemical compound of hydroxyquinoline dicitratoborate as an agent against the fungal pathogen Rhizotonia solani Kuehn, which causes the disease rhizoctonia (black leg) of tomatoes and potatoes (RF patent No. 2200393, IPC A01N 55/08, published on March 20, 2003). The claimed compound has a stimulating effect on the growth of some plants, which helps to increase their disease resistance.

However, this chemical compound does not have an entomopathogenic effect, i.e. It does not protect plants from insect pests, and data on stimulating potato growth in the growing phase are also not provided. In addition, this drug tends to accumulate in the human body if the drug is used improperly during plant treatment (in case of safety violations when using the drug during plant treatment).

Known drug for protecting plants from pathogens of crops and grapes with a growth-promoting effect, including the culture fluid of microorganism strains, characterized in that as the culture fluid of microorganism strains, it contains culture fluid of the bacterial strain Bacillus subtilis BAG-65 and actinomycete strain Streptomyces sindenensis BAG- 55, as well as auxiliary additives and fillers in the following ratio of components, wt. %: Bacillus subtilis BAG-65 culture fluid - 20.0-50.0; culture liquid Streptomyces sindenensis BAG-55 - 5.0-20.0; auxiliary additives and fillers - the rest (RF patent No. 2313941, IPC A01N 63/02, publ. 10.01.2008). This drug has antagonistic activity against the fungal pathogen Rhizotonia solani Kuehn, which causes the disease of potato rhizoctonia.

However, this drug does not have an entomopathogenic effect, i.e. It does not protect plants from insect pests, and data on stimulating potato growth in the growing phase are also not provided. The production technology of the drug is complex, it requires separate cultivation of each microorganism with their subsequent mixing with the filler to obtain the finished form.

A method of microbiological protection of plants from pests using an agent comprising a mixture of culture fluids Trichoderma viride, Azotobacter chroococcum, Bacillus megaterium, Beauveria bassiana, Metarhizium anisopliae with the required amount of water in the ratio of cultures in the mixture 1: 1: 1: 1: 1 for each culture titer not less than 1 × 10 ⁷ CFU / ml (RF patent No. 2539025, IPC A01N 63/00, publ. 01/10/2015). The method of protection includes 2-3-fold spraying of plants during the growing season at a dosage of 12.5 liters of product per 1 ha of crops, when average air temperatures are at least 15 ° C, with an interval of two to three weeks.

However, this processing method is aimed at protecting wheat from pests. Information on the protection of potatoes from insect pests, fungal pathogens and stimulation of the growth of potato stems during the growing season is not available.

A known method of controlling soil potato pathogens in permafrost soils, including pre-sowing treatment of potato tubers with a preparation based on Bacillus subtilis "TNP-5 - DEPT" at a rate of 300 ml / kg and processing of potato plants during the growing season with "Mizorin" 23 ml / kg ( RF patent No. 2534889, IPC A01N 63/02, publ. 10.12.2014). Mizorin is a bacterial drug based on Arthrobacter mysorens.

However, this method is laborious, it requires first presowing treatment of potato tubers with a preparation based on Bacillus subtilis "TNP-5 - DEPT", and then processing potato plants during the growing season with a bacterial preparation based on Arthrobacter mysorens.

The closest biological product analogue (prototype) is an agent for combating the Colorado potato beetle and increasing potato productivity, containing Usnea lichen extract in an amount of 0.0010-0.0015 g obtained by boiling air-dried raw materials in isopropyl alcohol, and an aqueous suspension of conidia entomopathogenic fungus Beauveria bassiana or Metarhizium anisopliae with a titer of 15 × 10 ⁷ or 75 × 10 ⁶ , respectively, per 100 ml of an aqueous suspension of the agent (RF patent No. 2570548, IPC A01N 65/00, publ. 10.12.2015).

A method of using said biological product against a Colorado potato beetle in the form of a suspension of conidia of an entomopathogenic fungus Beauveria bassiana 15 × 10 ⁷ consists in processing potatoes (by spraying) during the growing season with an aqueous solution of the biological product with a titer of 1.5 × 10 ⁶ CFU / ml. (RF patent No. 2570548).

However, this biological product contains a high titer of 1.5 × 10 ⁶ CFU / ml. entomopathogenic fungus Beauveria bassiana in the working fluid to ensure sufficient insecticidal activity, which requires a large consumption of the drug (15 times more than in the claimed). In addition, there is no information on the use of this drug to protect against fungal pathogens and stimulate the growth of potatoes during the growing season.

The closest analogue of the method of application is the method of biological protection of potato plants from late blight and the Colorado potato beetle, including treating tubers before planting by soaking and spraying potato plants during the growing season with a biological product mixed with adhesive (Russian patent No. 2343667, IPC А01С 1/00, A01N 63 / 00, published on January 20, 2009). Soaking potato tubers by soaking as a biological product, planriz is used at a rate of 1000 ml per ton of tubers, and for spraying 1 hectare of plantings during the growing season, a mixture of biopreparations Planriz in the amount of 0.5 l and bankol in the amount of 0.2 l diluted in 300-350 liters of Zamankul mineral water, with corn paste in the amount of 1-1.5% of the mixture volume as an adhesive.

However, in this method there is no data on the possibility of stimulating the growth and protection of potatoes from rhizoctonia. In addition, the method uses a complex multicomponent mixture of fungicide, insecticide, mineral water and adhesive, which increases the cost of processing, limits the scope of the method, because the multicomponent mixture used is not a single preparative form and requires the presence of all components of the mixture used. For example, mineral water is located in a source in North Ossetia and is difficult to access for other regions.

The technical result of the claimed invention is to obtain a strain of the fungus Beauveria bassiana, which has the property of protecting potatoes from the Colorado potato beetle, the causative agents of scab, especially the fungal pathogen Thanatephorus cucumeris (imperfect stage of the fungus - Rhizoctonia solani), which causes rhizoctonia or black scab of potato, as well as stimulating growth potatoes during the growing season.

The specified technical result is achieved by creating a new strain of entomopathogenic fungus Beauveria bassiana IC 1530-25-1, obtained by selection of the isolate of the fungus Beauveria bassiana, obtained from dead larvae of the Colorado potato beetle, which protects the potato from rhizoctonia (black scab) and stimulates the growth of potato during the growing season and deposited in the Bioresource Center of the All-Russian Collection of Microorganisms (BRC VKPM) SIC “Kurchatov Institute” - State Research Institute of Genetics, registration number VKPM: F-1447 (certificate of deposit w tamma is attached).

The specified technical result is also achieved by the fact that in the biological product against the Colorado potato beetle, fungal pathogens and stimulation of potato growth in the growing season, including a suspension of the culture fluid of the microorganism, according to the invention, it contains a spore-mycelial biomass of the strain of the entomopathogenic fungus Beauveria bassiana IC 1530-25-1 with a titer of at least 10 ⁹ CFU / ml and components of the nutrient medium after culturing the indicated strain of entomopathogenic fungus.

The specified technical result is also achieved by the fact that in the method of stimulating the growth of potatoes in the growing season, protecting it from the Colorado potato beetle and fungal pathogens, including pre-planting treatment of potato tubers with a biological product in liquid form by immersing potato tubers in it and / or spraying the potatoes with water in the growing season by spraying a biological product according to the invention, when preplanting potato tubers, a 1-3% aqueous solution is used as a liquid form of a biological product ovo mycelial biomass strain entomopathogenic fungus Beauveria bassiana IC 1530-25-1 and culture medium components pp 1, 2 formulas with a titer of at least 10 ⁵ CFU / ml, potato tubers are treated with the specified aqueous solution of a biological product once with a flow rate of an aqueous solution of a biological product of 10 liters per 1 ton of potato, and when spraying potatoes with a water solution of a biological product during the growing season, a spore is used as it - mycelial biomass of a strain of an entomopathogenic fungus Beauveria bassiana IC 1530-25-1 and nutrient components according to claims 1, 2 formulas with a titer of at least 10 ⁶ CFU / ml and a flow rate of an aqueous solution of a biological product of 300 l per 1 hectare of potato planting area.

Characterization of the inventive strain of the fungus Beauveria bassiana IC-1530-25-1. The parent strain of the fungus Beauveria bassiana IC-1530-25-1 was isolated from the larvae of the Colorado potato beetle in the Novosibirsk region. The inventive strain of the fungus Beauveria bassiana IC-1530-25-1 obtained by selection and identified on the basis of the sequenced DNA fragment of the deposited strain of the fungus Beauveria bassiana IC-1530-25-1.

Identification of strain IC 1530-25-1 based on analysis of the sequence of ribosomal genes (extract from the report of the Bioresource Center of the All-Russian Collection of Microorganisms (BRC VKPM) SIC “Kurchatov Institute” - State Research Institute of Genetics from 09.25.2018).

1. Sieving the customer culture to individual colonies and obtaining biomass for analysis of 18S RNA.

2. Isolation of DNA. (Genomic DNA Purification Kit)

3. Identification of the strain according to the sequence of 18S rDNA.

3.1. Selection of primers and PCR modes

Conservative primers for generating the sequence of a gene encoding 18S rRNA (Michael A. Innis, David N. Gelfand, John J. Sninsky, Thomas J. White. PCR protocols. A guide to methods and applications. Academic press, INC. 1990.) [ one]:

NS1 - gtagtcatatgcttgtctc

NS4 - cttccgtcaattcctttaag

PCR reaction mode:

- 95 ° C - 3 min.

- 35 cycles:

95 ° C - 30 sec.

57 ° C - 30 sec.

72 ° C - 30 sec.

- 72 ° C - 5 min

Conservative primers for generating the sequence of a gene encoding 5.8S rRNA and internal transcribed spacers ITS1 and ITS2 (Biochemistry, 2007, 72, 12, 1659-1667) [2]:

ITS1 - TCCGTAGGTGAACCTGCG

ITS4 - TCCTCCGCTTATTGATATGC

PCR reaction mode:

- 95 ° C - 3 min.

- 35 cycles:

95 ° C - 30 sec.

57 ° C - 30 sec.

72 ° C - 30 sec.

- 72 ° C - 5 min.

Conservative primers for amplification of the D1 / D2 domain of the 26S rRNA gene:

NL-1 GCATATCAATAAGCGGAGGAAAG

NL-4 GGTCCGTGTTTCAAGACGG

PCR reaction mode:

- 95 ° C - 3 min.

- 35 cycles:

95 ° C - 30 sec.

52 ° C - 30 sec.

72 ° C - 30 sec.

- 72 ° C - 5 min

3.2. Sequencing of 18S rRNA and 5.8S rRNA genes, comparing sequencing and building related trees.

Sequencing was carried out on an automatic sequencer AE3000.

For sequencing analysis, the specialized BLAST computer program [http://www.ncbi.nlm.nih.gov/blast] was used.

The reliability of the results. Sequences have been determined that are sufficient to classify a strain as a specific taxonomic group of microorganisms.

4. Conditions for PCR electrophoresis of the studied samples. 1.0% agarose gel, electrophoresis with an electric field strength of 5 V / cm.

Stages of analysis.

a) Sequencing of portions of the sequence encoding the 18S rRNA gene.

When sequencing a portion of DNA encoding the 18S rDNA gene of the studied strain, the following sequence was obtained:

b) Sequence analysis of the gene encoding 18S rRNA.

The analysis of the similarity of the nucleotide sequence of the gene encoding the 18S rDNA of the studied strain was carried out using the BLAST server [http://www.ncbi.nlm.nih.gov/blast].

Results. The criterion for classifying a microorganism to a particular species is considered to be at least 97% homology [2].

Initial screening using the GenBank database showed that the studied strain belongs to the following systematic group: Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Sordariomycetes; Hypocreomycetidae; Hypocreales; Cordycipitaceae; Beauveria.

To establish the phylogenetic kinship of closely related species, we also used the method of comparing nucleotide sequences encoding the 5.8 S rRNA gene and internal transcribed spacers ITS1 and ITS2 [2].

When sequencing a portion of DNA encoding the 5.8 S rRNA gene and the internal transcribed spacers ITS1 and ITS2, the following sequence was obtained:

In addition, a method for comparing nucleotide sequences encoding the D1 / D2 domain of the 26S rRNA gene was also used to establish the phylogenetic relationship of closely related species.

When sequencing a portion of DNA encoding the D1 / D2 domain of the 26S rRNA gene, the following sequence was obtained:

An analysis of phylogenetic kinship, constructed using strains of closely related microorganisms, showed that the species Beauveria bassiana is the closest to the studied strain.

Conclusion According to the results of the analysis of the nucleotide sequence encoding part of the rRNA genes, it was found that the studied strain is closest to Beauveria bassiana (99%).

The strain of the fungus Beauveria bassiana IC-1530-25-1 is characterized by the following cultural and morphological characteristics.

When growing the strain on a solid Chapek medium at 26-27 ° C for 6 days, a whitish colony with a dot in the center, with smooth edges. Branched, septated aerial mycelium, mycelial hyphae in diameter 3.0–5.0 μm, conidiophores bottle-shaped are formed singly, in pairs or whorls. The size of the conidia is 2.8-3.5 μm unicellular, mononuclear on the Saburo medium under the same conditions for growing colonies with even edges, white fluffy felt colonies above and below, growing into agar, after sporulation - powdery.

Character of growth: the colony is fluffy over the entire area, the edge is even.

Colony size (at a certain incubation time): on the 14-15th day of growth, the diameter of the colony is 35-40 mm.

Aerial mycelium: white, sporulation white, slightly powdery;

The color of the back of the colony is white.

Morphological characteristics of the strain when cultured in a liquid nutrient medium Saburo at 24-26 ° C for 72 hours:

- after 24 hours of cultivation, the mycelium is thinned and accounts for 15-20%, and 80-85% are non-germinated spores;

- after 48 hours of cultivation, the mycelium is scarce, the culture is poorly developed; the mycelium has an average thickness; free spores 5-10%;

- after 72 hours of cultivation, the mycelium is 50-60%; the rest of the mycelium is thickened, with clear partitions.

Physiological and biochemical characteristics of the strain.

It grows at 18-32 ° C, optimally 25-27 °, the pH of the medium is 5.35-7.2, optimally 5.8-6.8.

Attitude to carbon sources: assimilates sucrose, glucose, lactose, glycerin.

Attitude to nitrogen sources: utilizes peptone, casein, fish and bone meal, meat broth, yeast and their hydrolysates.

During the deep cultivation of the strain on different compositions of the media, the pH of the culture fluid changes differently depending on the composition of the medium.

The percentage of biomass of the strain Beauveria bassiana IC-1530-25-1 on the dry residue after filtering the culture fluid is 15-17%.

The thermal resistance of the proposed Beauveria bassiana IC-1530-25-1 strain and the initial strain at 80 ° C for 1-2 minutes was studied.

The inventive strain is more stable by 20%.

The inventive strain of the fungus Beauveria bassiana IC-1530-25-1 is stored:

- on potato-glucose agar at a temperature of 6-8 ° C;

- in 10-20% glycerol at -70 ° C;

The method, conditions and composition of the media for the propagation of the strain:

- optimal agar medium Saburo;

- pH 4.6;

- incubation time of 20 days;

- there is no need for coverage;

- other media used for cultivation: апapek agar, potato-glucose agar;

Fermentation medium: Saburo broth.

The strain of the inventive fungus Beauveria bassiana IC-1530-25-1 is entomopathogenic. Not pathogenic to bees.

Methods for the selection of the initial fungus B. bassiana upon receipt of the inventive strain Beauveria bassiana IC-1530-25-1.

For the selection of the fungus, the phenomenon of spontaneous variability was used. When studying the spontaneous variability of strains in culture, a set of culture media was used, with the help of which the heterogeneity of monoconidial isolates was evaluated by morphology and cultural properties. In addition, indicators of the enzymatic activity of the obtained morphological variants and their virulence were studied as indicators of variability.

To isolate monospore isolates, the suspension of the conidia of the fungus washed off the surface of the agarized nutrient medium was screened, the grown colonies were selected, they were sieved in Petri dishes, and their morphology was evaluated in comparison with the parental strains. Colonies similar in morphology were combined into morphological groups. To assess the stability of morphovars, they were cultured for five vegetative passages on a set of nutrient media. According to the methodology, all selected variants in all passages were transferred from each medium to the same medium from the set used. In identifying stable groups of morphovars, their biochemical properties and virulence were compared. The morphology of the newly obtained isolates was evaluated by the color and shape of the colonies, the size of the colonies and the growth rate of mycelium on different artificial nutrient media.

The study of the enzymatic activity of the inventive fungus B. bassiana. Method for determination of enzymatic activity

The determination of enzymatic activity was carried out on agarized nutrient media, esterase activity was determined by spectrophotometric method.

Protease activity was evaluated by casein hydrolysis on a medium of the following composition (in%): agar-agar - 2, skimmed milk powder - 0.5, glucose - 1, distilled water - 1000 ml, pH after sterilization (6.5 ± 0.1 ) The activity of exoproteases was determined by the width of the clarification zone of the agar medium around the colony on the 10th day of growth (minus the diameter of the colony from the diameter of the lysis zone).

Amylase activity was evaluated by hydrolysis of water-soluble starch on the medium of the following composition (in%): agar-agar - 2, starch - 0.2, glucose - 1, distilled water - 1000 ml, pH after sterilization (6.5 ± 0.1) . Exoamylase activity was determined by the width of the lysis zone of the medium around the colony on the 10th day of growth (minus the diameter of the colony from the diameter of the lysis zone), which appeared after staining the agar plate in a Petri dish using a Lugol solution.

Two media were used to determine lipase activity: with tween-80 and olive oil. Composition (in%): agar-agar - 2.0; tween-80 - 1.0 (or olive oil - 2.0); peptone - 1.0; yeast extract - 0.2; distilled water - 1000 ml, pH after sterilization (6.5 ± 0.1). Lipase activity was determined by the width of the clarification zone of the agar medium around the colony on the 10th day of growth (minus the diameter of the colony from the diameter of the lysis zone).

Chitinase activity was evaluated on a medium with colloidal chitin obtained by hydrolytic cleavage of chitin of king crab shells with acetic acid. Lipase activity was determined by the width of the clarification zone of the agar medium around the colony on the 10th day of growth (minus the diameter of the colony from the diameter of the lysis zone).

To determine the esterase activity, B. bassiana strains were seeded in penflasks with 10 ml of Saburo liquid medium (yeast extract - 0.2%, peptone - 1%, glucose - 4%, agar-agar - 2%, distilled water - 1000 ml) and incubated at (27 ± 0.5) ° C for 10 days. After the end of the incubation time, 1 ml of culture liquid was taken from the vials into Eppendorf tubes, the samples were centrifuged at 5000 rpm for 10 min. The substrate was prepared as follows: 1 ml of 0.5M Tris-HCl buffer with a pH of 7.0 was adjusted to a volume of 10 ml with distilled water. At the same time, a weighed sample of the substrate, p-nitrophenyl acetate, was prepared at the rate of 1 mg of substrate per 10 ml of diluted buffer. A weighed portion was previously dissolved in 1 ml of acetone, then transferred into a container with buffer.

100, 150 or 200 μl of culture fluid (QL) and 1 ml of buffer with substrate were poured into the cuvette of the spectrophotometer. The optical density of the reaction product of the substrate with QOL was determined at a wavelength of 410 nm. The results of the study are shown in table 1.

Methods for determining the virulence of the inventive strain of the fungus B. bassiana

The virulence of the obtained Beauveria bassiana strain IC-1530-25-1 and the initial strain was determined in laboratory conditions on the larvae of the Colorado potato beetle Leptinotarsa decemlineata Say. Insects were kept at a temperature of (35 ± 1) ° С without illumination. Weizer nutrient medium was used as feed. The work was carried out with larvae of 1-2 age.

Infection was carried out by applying a suspension of fungal spores of the studied concentrations to the larvae using a brush. Accounting for the death of insects was carried out visually, starting from the first day after inoculation. To conduct passages of strains through a living organism, the Colorado potato beetle Leptinotarsa decemlineata was used. The larvae were infected by immersion in a suspension of conidia of the fungus.

After the appearance of signs of infection (multiple dark spots on the cuticle), dead insects were transferred to the surface of Saburo's nutrient medium in Petri dishes and incubated at room temperature until there was an abundant growth of mycelium and the development of sporulation.

Spores were collected in a sterile tube and used to further infect the next generation of larvae. The virulence of the obtained variants was determined as described above under laboratory conditions. Accounting for the death of insects was carried out visually, starting from the first day after inoculation. The results are shown in table. 2.

The biological effectiveness of the claimed strain of Beauveria bassiana IC-1530-25-1 and a drug based on it on the larvae of the Colorado potato beetle is 98% on the 5th day, and the initial parent strain, respectively, 90%.

Thus, the proposed strain is superior to the parent strain in productivity and biological effectiveness.

The test of the inventive fungal strain on phytopathogens

The experiment was carried out using agar block technique. The suspension of the drug in a concentration with a titer of 10 ⁵ spores / ml was introduced into the nutrient medium with a temperature of 36-37 ° C. For the cultivation of fungal plant pathogens, potato-glucose agar was taken as a nutrient medium. The inoculated medium was poured into Petri dishes and a block 10 mm in diameter, cut from a phytopathogen colony, was placed on the frozen surface in the center.

Accounting was carried out on the 3rd, 5th, 7th, 10th day. The activity of the drug was taken into account by changing the diameter of the fungus colony in comparison with the control (medium without biologics). Based on the obtained data, the inhibitory activity was determined (Table 3).

Example 1. The use of the inventive strain to obtain an entomopathogenic drug. The cultivation of an entomopathogenic strain of the fungus B. bassiana IC-1530-25-1. The cultivation scheme of the entomopathogenic fungus B. bassiana was chosen according to the guidelines (Yevlakhova, Velitskaya, 1961) and included the following stages:

1. Obtaining the initial culture of strains from museum tubes;

2. The production of seed material of strains;

3. Obtaining biomass strains;

4. Quality control of the obtained biomass according to the selected criteria.

In the process of cultivation used the following processing equipment and materials:

1. Autoclave VK-75.

2. A water bath with a temperature regulator, which allows maintaining a temperature of 30 ° С-100 ° С with a deviation of up to 1 ° С from a given value.

3. General-purpose laboratory scales with a maximum weighing limit of 200 g and a margin of error of ± 2 mg for weighing reagents.

4. Drying cabinet.

5. Electric thermostats for growing mushroom cultures with an automatic temperature controller up to a temperature of 35 ° C and with a division price of 0.2 ° C.

6. The refrigerator is household electric in accordance with GOST 26678.

7. Centrifuge.

8. Laboratory shaker for 6 flasks.

9. Electric stove in accordance with GOST 14919.

10. Biological light microscope with a magnification of 900 ^x - 1000 ^x times.

11. pH meter with a margin of error of not more than 0.05 units. pH

12. The distiller.

13. Liquid-in-glass thermometers with a temperature range of 0 ° С-50 ° С and 50 ° С-100 ° С according to GOST 28498 with a margin of error ± 0.5 ° С with a scale division value of 0.5 ° С.

The museum culture of B. bassiana was stored on a Saburo slanted agar medium of the following composition (per 1 dm ^{3 of} distilled water): meat enzymatic peptone - 10 g, glucose crystalline monohydrate - 40 g, yeast extract - 0.5 g, microbiological agar - 20 g pH 6.5 before sterilization.

At the first stage of the technological process, cultivation was carried out by propagation of museum cultures by phased reseeding of spore-mycelial mass into a series of consecutive test tubes with Saburo's beveled dense nutrient medium.

At the second stage, seed was obtained by washing the spore-mycelial mass from the fallopian tubes with sterile saline into flasks with a capacity of 50 cm ³ . Thus obtained suspension, with a titer of 10 ⁶ CFU / ml, was used to inoculate growth flasks with a capacity of 500 cm ³ containing 250 cm ^{3 of} liquid potato-glucose medium of the following composition (per 1 dm ^{3 of} distilled water): chopped potatoes - 500 g, glucose crystalline monohydrate - 20 g, yeast extract - 0.5 g, pH 6.5 before sterilization. The flasks were incubated on a thermostatic shaker at a temperature of (23 ± 1) ° C for 7 days. At the end of cultivation, the contents of the flasks were poured into sterile glass vials, sealed with rubber stoppers and rolled with aluminum caps. The obtained liquid biomass of the fungus Beauveria bassiana IC-1530-25-1 with a titer of 10 ⁹ CFU / ml serves as a finished formulation, which was stored in the refrigerator at a temperature of (6 ± 1) ° С for further use. The production process took 15 days, including the stage of cultivating the seed crop on an agarized nutrient medium.

Example 2. The composition of the claimed biological product. A biological product against the Colorado potato beetle, fungal pathogens, and potato growth stimulation during the growing season contains spore-mycelial biomass of the Beauveria bassiana IC 1530-25-1 strain of entomopathogenic fungus with a titer of at least 10 ⁹ CFU / ml and nutrient medium components after cultivation of the said entomopathogenic fungus strain.

Store the drug in the refrigerator at a temperature of 0 to 10 ° C. The shelf life of the biological product is 6 months from the date of manufacture. 1 cm ^{3 of the} preparation contains at least 1 × 10 ⁹ CFU (colony forming units) of live microbial cells of the strain of the fungus Beauveria bassiana.

Example. 3. A method of processing potato tubers to protect against fungal pathogens and stimulate the growth of potatoes during the growing season.

3.1. The inventive method includes pre-planting treatment of potato tubers with a biological product in liquid form by completely immersing potato tubers in it or wetting the entire surface. As a liquid form of the biological product, a 1-3% working suspension of spore-mycelial biomass of the strain of the entomopathogenic fungus Beauveria bassiana IC 1530-25-1 and nutrient components with a titer of at least 10 ⁵ CFU / ml is used. Processing potato tubers with the specified working composition of a biological product is carried out once before planting with a flow rate of a working suspension of a biological product of 10 liters per 1 ton of potato.

3.2. The results of field trials to stimulate the growth of potatoes in the growing season and protect it from rhizoctonia

The causative agent of the disease is the fungus-basidiomycete Thanatephorus cucumeris (A.V. Frank) Donk. (the name of the imperfect stage of the fungus - Rhizoctonia solani J.G. Kuhn is more widespread). The basidial stage is not necessary in the pathogen development cycle: basidiospores are formed at high humidity on the mycelium located on the stem near the surface of the earth.

Symptoms and life cycle of the causative agent of the disease. Mushroom Rhizoctonia solani J.G. Kuhn is able to infect potatoes at all stages of ontogenesis. Currently, there are several forms of manifestation of rhizoctonia. The disease manifests itself in the form of black scab, deep (pitted) spotting and net necrosis of tubers, decay of eyes and sprouts, death of stolons and roots, and also in the form of dry rot of the underground part of the stem in the form of brown ulcers of various sizes “rotting wood” and “white leg” "stems.

The fungus can overwinter in the form of mycelium or sclerotia on tubers or in the soil for 3-4 years. In addition to potatoes, R. solani can affect vegetables (tomatoes, pumpkin, beets) and many wild weeds (thistle, horsetail, quinoa, etc.).

Important conditions determining the development of rhizoctonia in potatoes are the temperature and humidity of the soil and air. The optimum soil temperature for the development of the disease is about 17 ° C, humidity - 60-70% of the total moisture capacity. Optimal conditions for plant infection are created on heavy (loamy) soils. Acidity in the pH range from 4.5 to 8 is not significant.

Maliciousness manifests itself in all forms of the development of the disease. Especially dangerous is the defeat of shoots and sprouted plants, leading to severe thinning of seedlings (up to 15-20%) and a decrease in plant productivity. Harvest steadily decreases by 10-15%, and in some years - up to 30-40%.

To protect potatoes from rhizoctoniosis and stimulate the growth of potatoes during the growing season, their tubers were treated with the drug in accordance with the method of example 3.1. before planting in the soil.

2015 year. During the growing season, 3 counts were performed (4, 6, 10 weeks after planting) to assess the effect of the bioagent on the affection of potato stems and stolons of four varieties of different ripeness groups: early varieties Lyubava and Yuna, mid-early - Svitanok Kiev and mid-season - Hostess.

Accounting after 6 weeks showed that under the influence of the claimed biological product, the biomass of plants increased in all varieties, especially in the early Lyubava cultivar (3.8 times), and in mid-season (Hostess) - only 1.1 times. The same trend persists in plant height and the number of stems.

A suspension of the entomopathogenic fungus Beauveria bassiana (Bb) statistically significantly exerted a growth-promoting effect on potatoes. Plant height increased, especially in the initial growth period and after 6 weeks on the Lyubava and Svitanok Kiev cultivars, 1.3 (Bb) times higher than control plants.

In the control variants (without the use of biological products), the prevalence of the disease on the stems was the highest on the Yuna and Khozayushka varieties, which reached 82.4-85.7%. In the experimental samples, the stems were practically not affected by rhizoctoniosis (single strokes and small sores were observed - the lesion was the first point, and in the control - 1, 2 and 3 points, i.e. ulcers were present on the stalk with a length of 50 mm or more). The prevalence of the disease on the stems decreased significantly in all varieties, regardless of the microbial agent, 2.1-14.1 times. However, the best results were obtained using B. bassiana, especially on early ripening varieties Lyubava and Yuna (a decrease of 5.3-6.2 times compared with the control). Accordingly, the development of the disease on the stems decreased: B. bassiana better healed the early varieties - Lubava and Yuna, on which the development of the disease decreased to 2.1-2.7%, i.e. - 7.3-10.6 times.

After 10 weeks in the experimental variants, plants of all varieties were significantly higher than the control ones, on average 1.2-1.6 times (Table 4). According to the increase in the number of stems in the bush, significant differences were obtained on the Svitanok Kievsky and Yuna varieties. Under the influence of bioagents, the total biomass of plants (Hostess and Yuna) was statistically significantly increased compared with the control (p <0.05) by 2.0–2.3 times when treated with B. bassiana.

To a greater extent, the stems of the Svitanok Kiev and Khozayushka varieties were affected by the rhizoctonia in the control: the average lesion score was 0.6-0.8 points (a lesion of 3 and 4 points was noted, i.e. ulcers on the stem were 50 mm or more in length) . On varieties Lyubava and Yuna, the average defeat score was 0.4. Under the influence of the preparation, a significant improvement of the stems occurred in all varieties (singular strokes and small sores - defeat with the first mark).

Microbial agents positively influenced the increase in the total number of stolons (2.8-2.2-1.3-1.7 times), respectively, in the varieties: Lyubava, Svitanok Kiev, Khozayushka and Yuna, while reducing the number of affected and fallen.

The prevalence of the disease on the stems in the control (without the use of the drug) was the highest on the Svitanok Kiev variety and reached 94.4%, the smaller on the Hostess variety (but not statistically proven).

Thus, the use of drugs has significantly reduced (p <0.05) the prevalence of the disease in all varieties. When B. bassiana was used, the prevalence of rhizoctonia in the stems decreased (p <0.05) in 4.5 (Lyubava) - 3.5 (Svitanok Kiev) - 7.2 (Hostess) - 3.5 (Yuna).

The drug based on the biomass of the entomopathogenic fungus B. bassiana was highly effective. In the early varieties: Lyubava and Yuna, the biological effectiveness of B. bassiana reached 84.8-88.5%, and in the mid-season variety Hostess - 94.0%.

When digging potatoes (September 3, 2015), tuber damage was determined by assessing the development of the sclerotic index (S.i.) and the prevalence of rhizoctonia (Table 5). The drug had a positive effect on the healing of tubers. The fungus B. bassiana reduced the incidence and increased the yield of healthy tubers, on average, 1.5-2.7 times. The prevalence of the dangerous sclerotic form of rhizoctonia has sharply decreased.

The sclerotic index decreased 11.4 (s. Lyubava) and 5.7 (s. Yuna) times. The entomopathogenic fungus B. bassiana positively influenced the decrease (3.2–5.7 times) in the sclerotic stage in these varieties.

Tubers of the Lyubava variety were completely free from sclerotia. The decrease in the prevalence of the sclerotic stage of the disease on Yuna tubers was 1.4 (mixture) - 4.0 (mushroom) times, on the Khozayushka and Svitanok Kiev varieties it varied 1.5-2.7 times. Obviously, plants grown from tubers treated with a microbiological agent were more resistant to dry wind phenomena, which were observed in late June-early July, and came under double stress.

The results obtained in the mid-season variety Hostess showed that without the use of preparations on this variety, more than 50% of the tubers were covered with sclerotia (apparently, due to the later ripening period).

In addition to assessing the infection of stolons, stems, and tubers with rhizoctoniosis, we evaluated the effect of microbiological agents on Rh. solani in the rhizosphere of the potato variety Lyubava. An analysis of the soil population by the fungus Rhizoctonia solani was carried out in the laboratory by the method of multiple soil tablets using a sampler (Table 6).

Significantly decreased the number of propaganda Rh. solani in the soil (9.2 times) under the influence of B. bassiana.

Thus, the entomopathogenic fungus Beauveria bassiana not only controlled the causative agent of rhizoctonia in the stems, stolons, and tubers of potatoes, but also reduced the number of Rh propagules. solani in the soil, which significantly affected the quality and quantity of tubers.

2016 year. Similar surveys were carried out in 2016 on three varieties. When counting on the 4th week after planting on the Lyubava cultivar, there was no manifestation of the disease, and on the Svitanok varieties Kiev and Khozayushka, although there was a defeat, it was only the first and partially the second points.

The use of drugs reduced the prevalence of rhizoctonia in the stems 1.6-1.7 times (B. bassiana) compared with the control. In the following counts, the stems improved further: 2 times at the 6th week and 3.5-6.4 times at the 10th week (Table 7).

The growth-promoting effect was expressed in accelerating the development of plants, increasing the mass, height and number of stems and stolons. After a month, the planting field, a statistically significant increase in plant mass under the influence of a microbial agent (in variants with the treatment of tubers before planting) was observed only in the early ripening Lyubava variety - 1.5-1.7 times more compared to the control (Table 8).

However, during this period no significant differences in height, number of stems and stolons were obtained, because the weather was dry (precipitation was 1.5 times less than normal). Nevertheless, in the varieties of medium early (Svitanok Kiev) and mid-ripening (Hostess) ripeness groups, the drug had a positive effect on the increase in stems and stolons - 1.3 times (on the Hostess variety) more stems and 2 times - stolons when applying B bassiana In the same varieties, the indices continued to increase steadily for the 6th week. By the 10th week, all preparations and in all varieties significantly increased the mass of plants 1.4 times (varieties Lyubava and Svitanok Kiev) and 1.6-2 times - on the variety Hostess, the number of stems - 1.1 times and, especially - stolons 1.8-2.7 times depending on the variety.

In the tubers of the new crop, in the Svitanok Kiev and Khozayushka varieties, the development of the sclerocial stage was lower than in the control variant by 2.8-3.3 times - with preplanting treatment of B. bassiana. In the Lyubava cultivar in experimental variants, all tubers were practically free of black scab (Table 9). The yield of healthy tubers increased 5.5 times in the Hostess variety and 5.2 times in the Lyubava variety. The prevalence of the dangerous sclerotic form of rhizoctonia in the tubers of the new crop sharply decreased.

The sclerocial index (S.i.) decreased by 6.0 (cultivar Lyubava), by 3.6 (cultivar Svitanok Kiev) and 2.2 times (cultivar Khozyayushka).

Tubers of all varieties treated with the experimental preparation before planting were mainly affected by single sclerotia, occupying 1/10 of the surface (20.0-39.0%) and slightly - 1/4 of the surface (0-8.3%) .

A decrease in the prevalence of the sclerotic stage of the disease in tubers of the Lyubava variety was 3.5 times (B. bassiana) times, on the Host and the Svitanok Kiev varieties 1.5-3.0 times.

Example. 4. A method of processing potatoes during the growing season to protect against the Colorado potato beetle.

4.1. The inventive method includes spraying potatoes during the growing season with an aqueous solution of a biological product by spraying. As an aqueous solution of a biological product, spore-mycelial biomass of a strain of the entomopathogenic fungus Beauveria bassiana IC 1530-25-1 and components of a nutrient medium with a titer of at least 10 ⁶ CFU / ml and an aqueous solution of a biological product of 300 l per 1 hectare of potato planting area are used.

4.2. Evaluation of effective concentrations of the drug based on B. bassiana in relation to the Colorado potato beetle in a laboratory experiment

The effectiveness of the biological agent - Beauveria bassiana (Bb) in the laboratory depends on the age of the larvae and the time elapsed from infection. Larvae of the first and second ages are more susceptible to the action of B. b (1 × 10 ⁶ CFU / ml), although their death began on the second or third day (BE = 23.3%), on the seventh day it reached 50% death and on the 15th day - 100% (L ₁ ) (table. 10). Larvae of 3-4 ages are more resistant to action: on day 3-5, the efficiency was about 17%, and on day 20 - 50%. The imago of the Colorado potato beetle is even more resistant to the action of an entomopathogen: biological efficiency on the 20th day was at the level of 21.4%.

B. bassiana (titer 1 × 10 ⁷ CFU / ml) on larvae of 1-2 ages had a slightly smaller effect than 1 × 10 ⁶ , however, 15% more caused the death of larvae of the 3rd age, and, almost at the same level - in relation to larvae of 4 g age and 2 times more effective against adults.

Thus, the spore-mycelial biomass of the entomopathogenic fungus Beauveria bassiana with the titer of an aqueous suspension (1 × 10 ⁶ CFU / ml) more effectively affected larvae of 1-2 ages, and with a titer of 1 × 10 ⁷ CFU / ml - 3-4 ages and adults.

4.3. The effect of the inventive entomopathogenic preparation based on a Beauveria bassiana strain on a Colorado potato beetle in the field

In a model field experiment conducted in the “Michurintsev Garden” of the Novosibirsk State Agrarian University on a site dominated by larvae of younger ages, the effectiveness of the test drug was 56.7%, and of all ages - only 24.6-31.2% (Table 11).

Thus, in field experiments, to ensure the high efficiency of biological products, it is necessary to conduct timely processing at the beginning of hatching and the appearance of larvae of the first 2 ages.

Insecticidal effect of bioagents on planting potatoes in the field on varieties of different ripeness groups

On the stationary site "Garden Michurintsev" Novosibirsk GAU was evaluated the effectiveness of the claimed entomopathogenic drug against Colorado potato beetle on three varieties of potatoes of different ripeness groups.

As a result of the earlier warm weather of the growing season of 2016, the Colorado potato beetle on potato plantations appeared earlier than in 2015 and was more numerous (at the time of spraying (June 29) - 30-50 specimens / bush or more). Precipitation in July (126% of the norm) prevented timely processing of landings. Spraying potato plantings with Fitop 22.78 against the Colorado potato beetle showed their lower insecticidal activity compared to 2015 (Table 12) (favorable weather conditions contributed to the rapid development of the Colorado potato beetle, and heavy subsequent rains reduced the effectiveness of the preparations).

On the middle early (Svitanok Kiev) and mid-season (Hostess) varieties, the effectiveness of the biological product was practically at the same level (66-68%), and on the early ripening Lyubava variety, the efficiency was unstable in different years and ranged from 52.7% to 80%.

Example. 5. A method of processing potato tubers to protect against fungal pathogens and stimulate potato growth during the growing season, as well as treating potato tops during the growing season to protect against Colorado potato beetle.

The inventive method includes pre-planting treatment of potato tubers with a biological product in liquid form by completely immersing potato tubers in it or wetting the entire surface. As a liquid form of the biological product, a 1-3% working suspension of spore-mycelial biomass of the strain of the entomopathogenic fungus Beauveria bassiana IC 1530-25-1 and nutrient components with a titer of at least 10 ⁵ CFU / ml is used. Processing potato tubers with the specified working composition of a biological product is carried out once before planting with a flow rate of a working suspension of a biological product of 10 liters per 1 ton of potato.

The pre-planting treatment of potato tubers provides protection against fungal pathogens and stimulates the growth of potatoes during the growing season, which is confirmed by the results of field tests to stimulate the growth of potatoes during the growing season and protect it from rhizoctonia (see paragraph 3.2 of Example 3).

Further, the claimed method includes spraying potatoes during the growing season with an aqueous solution of a biological product by spraying. As an aqueous solution of a biological product, spore-mycelial biomass of a strain of the entomopathogenic fungus Beauveria bassiana IC 1530-25-1 and components of a nutrient medium with a titer of at least 10 ⁶ CFU / ml and an aqueous solution of a biological product of 300 l per 1 hectare of potato planting area are used.

To protect against the Colorado potato beetle, potato plantings during the growing season are sprayed with an aqueous suspension of B. bassiana IC 1530-25-1 with a titer of 1 × 10 ⁶ CFU / ml (with prevalence of larvae of 1-2 instars) or 1 × 10 ^{7 of} different larval ages and imago. The method of applying the bioagent is ground mechanized spraying (OP-2000-M, aggregated with MT3-82). The flow rate of the working fluid at the rate of 300 l / ha (300 ml of the initial concentration of B. bassiana IC 1530-25-1 with a titer of 1 × 10 ⁹ CFU / ml).

To protect small areas of potato planting in the private sector during the hatching period of Colorado potato beetle larvae, the drug is used in the form of an aqueous suspension (3 ml of the mother stock - 1 × 10 ⁹ CFU / ml) in a volume of 3 l / 100 m ² (per 1 acre), fine sprayer (for example, “Quasar” brand).

As a result of a series of experiments (laboratory, field, model, production), a general picture of the effects of the use of the mushroom strain on potatoes was revealed, which possessed not only insecticidal activity (when spraying potato plantings), but also antifungal and growth-stimulating effect (when processing tubers before planting ), which contributed to a healthy, high-quality and higher yield (see laboratory data and field test results in paragraphs 4.2 and 4.3 of example 4).

Thus, from the description of the invention, the achievement of the claimed technical result is visible, namely: a strain of the fungus Beauveria bassiana is obtained, which has the property of protecting potatoes from the Colorado potato beetle, the causative agents of scab, especially the fungal pathogen Thanatephorus cucumeris (imperfect stage of the fungus - Rhizoctonia solani), causing rhizoctonia or black scab of potatoes, as well as having the property of stimulating the growth of potatoes in the growing season.

Claims (3)

1. The strain of the fungus Beauveria bassiana IC 1530-25-1, for the production of a biological product against the Colorado potato beetle, mushroom pathogens and stimulation of potato growth during the growing season, deposited at the Bioresource Center of the All-Russian Collection of Microorganisms (BRC VKPM) SIC “Kurchatov Institute” - State Research Institute of Genetics, VKPM registration number: F-1447. 2. Biological product against Colorado potato beetle, fungal pathogens and stimulation of potato growth during the growing season, including a suspension of the culture fluid of the microorganism, characterized in that as a suspension of the culture fluid of the microorganism it contains spore-mycelial biomass of the strain of the entomopathogenic fungus Beauveria bassiana IC 1530-25-1 according to claim 1 of the formula with a titer of at least 10 ⁹ CFU / ml and components of the nutrient medium after culturing the indicated strain of an entomopathogenic fungus. 3. A method of stimulating the growth of potatoes in the growing season, protecting it from the Colorado potato beetle and fungal pathogens, including pre-planting treatment of potato tubers with a biological product in liquid form by immersing potato tubers in it and / or spraying the potatoes with a water solution of a biological product during the growing season, characterized in that that during the pre-planting treatment of potato tubers, a 1-3% aqueous solution of spore-mycelial biomass of a strain of entomopathogenic fungus Beau is used as a liquid form of a biological product veria bassiana IC 1530-25-1 and nutrient components according to claims 1, 2 formulas with a titer of at least 10 ⁵ CFU / ml, potato tubers are treated with the specified aqueous solution of a biological product once with a flow rate of an aqueous solution of a biological product of 10 liters per 1 ton of potato, and when spraying potatoes with a water solution of a biological product during the growing season, a spore is used as it -mycelial biomass of a strain of the entomopathogenic fungus Beauveria bassiana IC 1530-25-1 and nutrient components according to claims 1, 2 formulas with a titer of at least 10 ⁶ CFU / ml and a flow rate of an aqueous solution of a biological product of 300 l per 1 hectare of potato planting area.