CN106478789B

CN106478789B - From the effector albumen and its encoding gene of grape ulcer bacterium and application

Info

Publication number: CN106478789B
Application number: CN201611174355.8A
Authority: CN
Inventors: 燕继晔; 邢启凯; 李兴红; 张玮; 刘梅
Original assignee: Beijing Academy of Agriculture and Forestry Sciences
Current assignee: Beijing Academy of Agriculture and Forestry Sciences
Priority date: 2016-12-19
Filing date: 2016-12-19
Publication date: 2019-06-28
Anticipated expiration: 2036-12-19
Also published as: CN106478789A

Abstract

The present invention has been opened from the effector albumen and its encoding gene of grape ulcer bacterium and application.The albumen is the protein with one of following amino acid residue sequences: 1) amino acid residue sequence of the SEQ ID № .1 in sequence table；2) by the SEQ ID № .1 amino acid residue sequence in sequence table by one or several amino acid residues substitution and/or deletion and/or addition and have cause a disease the sub- protein function of correlation effect the protein as derived from SEQ ID №: 1.The albumen shows that the gene has the function of exciting disease-resistant gene in tobacco through transgenic experiments, can cause the hypersensitive necrosis reaction of tobacco, also, can enhance the pathogenic of grape ulcer bacterium after being overexpressed, be the important target for studying disease-resistant gene.

Description

From the effector albumen and its encoding gene of grape ulcer bacterium and application

Technical field

The invention belongs to molecular biology fields, are related to a kind of effector albumen and its volume from grape ulcer bacterium Code gene and application.

Background technique

Grape (Vitis vinifera L.) is always one of most important fruit in the whole world, and economic value is very high, It not only can directly eat raw also to can be processed and be fabricated to raisins, grape wine etc..Whole world grape -growing areas is very big at present, plants Training area at least occupies the 10% of all types of fruits, and by the end of the year 2013, China's vinegrowing area has reached 71.46 ten thousand hm², 11,550,000 tons of vintage.

Grape disease is to influence one of vintage and the most important factor of quality, the generation of grape disease and manager The factors such as the human factors such as formula, variety selection and climatic environment have close relationship.Most of China's grape is planted in temperate zone And subtropical zone, fructescence is mostly temperature high humility also high season, therefore is had when the diseases such as uncinula necator, downy mildew Occur.The disease species are accredited in China's grape production at present there are about more than 50 kinds, wherein disease is more serious also has more than ten Kind, directly contribute 30% economic loss of grape industry.By the germ grape ulcer (Botryosphaeria of grape seat chamber Dieback it is) one of main trunk disease present on grape, seriously affects the yield and quality of grape.Pathogen passes through certainly Right aperture or trimming wound are infected, and are caused withered carpopodium, fruit drying shrinkage or are fallen the symptoms such as grain, limb ulcer, tree vigo(u)r decrease, Serious will lead to keeps the whole strain of plant withered.So far, in China it has been found that Botryosphaeria dothidea, Diplodia seriata、Lasiodiplodia theobromae、Neofusicoccum parvum、Lasiodiplodia Pseudotheobromae and Neofusicoccum mangiferae can cause grape ulcer, and wherein dominant population is L.theobromae, B.dothidea, and it is L.theobromae that pathogenicity is stronger.

During long-term coevolution, plant forms two layers of defense mechanism to resist the infringement of pathogen.First Layer is the immune of pathogen-associated molecular pattern (Pathogen-associated molecular pattern, PAMPs) triggering PTI (PAMP-triggered immunity), the i.e. receptor kinase (PRRs) of plant soma film surface pass through identification pathogen Relevant molecular pattern (PAPMs) carrys out the basic defence system (PTI) of activated plant body.In most cases, basic defense response Infringement of the pathogen to plant can be blocked.Some pathogens can break through PTI to plant cell endocrine effector albumen, this When, plant identifies these effect proteins by ill-resistant protein (R albumen) to activate second layer defense response mechanism, i.e. effect The defense mechanism (ETI) of sub- albumen excitation, activates the expression of Analysis of Defence Genes Involved, is usually expressed as allergic reaction.Effector albumen exists Highly important role is play in pathogen and plant interaction system.On the one hand, effect protein is that phytopathogen is successfully invaded Contaminate the key weapon of host；On the other hand, effect protein is also the target of plant immune system identification pathogen invasion.

Strain separating identification and population structure diversity analysis are for the main research of grape ulcer at present, to Portugal The research especially molecular basis of the pathogenesis of grape canker pathogenesis is also known little about it.And it for a long time, mainly adopts both at home and abroad The prevalence and harm that grape ulcer is controlled with spraying insecticide, all fail to reach ideal control efficiency, have not only aggravated agriculture The burden at family, also creates environmental pollution.The effector albumen that phytopathogen generates is that one kind can cause plant defense anti- The secretory protein answered, the albuminoid pass through the intracorporal grade of activated plant in conjunction with the receptor on surface of Plant callus cell or subcellular surface The defense mechanisms such as the expression of connection signal system and induced defense gene play a role in resistance signal's approach, have chemical agriculture Advantage and characteristic not available for medicine can be used as a kind of novel microbial albumen pesticide to defend the infringement of pest and disease damage.Therefore it opens Exhibition to the functional study of pathogenic relevant effector protein gene, not only can enrich pathogenic grape ulcer bacterium and post The molecular mechanism data information of main interaction, and to the ecological control and measure for formulating effective grape ulcer in production It is of great significance.

Summary of the invention

The object of the present invention is to provide a kind of effector albumen (pathogenesis related protein) of grape ulcer bacterium and its codings Gene and application.

The effector albumen (pathogenesis related protein) of grape ulcer bacterium provided by the present invention derives from wild type grape Ulcer bacteria (L.theobromae) bacterial strain CSS-01s, entitled BrCRE1, are following protein 1) or 2):

1) protein that the amino acid sequence shown in sequence 1 in sequence table forms；

2) by the amino acid residue sequence of sequence 1 in sequence table by one or several amino acid residues substitution and/or It is deleted and/or added and there is the identical active protein as derived from 1) with albumen shown in sequence 1.

Sequence 1 in sequence table is made of 214 amino acid residues.

For the ease of the BrCRE1 purifying that sequence 1 encodes, amino acid sequence shown in sequence 1 can be formed in by sequence table Protein amino terminal or carboxyl terminal connect upper label as shown in Table 1.

The sequence of 1 label of table

Label	Residue	Sequence
			Poly-Arg	5-6 (usually 5)	RRRRR
Poly-His	2-10 (usually 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

Above-mentioned BrCRE1 can be artificial synthesized, can also first synthesize its encoding gene, then carries out biological expression and obtain.It is above-mentioned The encoding gene of BrCRE1 can be by lacking sequence 2 in sequence table in the DNA sequence dna shown in the 5 ' end 1-645 bit bases The codon of one or several amino acid residues, and/or carry out the missense mutation of one or several base-pairs, and/or its 5 ' The coded sequence that end and/or 3 ' ends connect label shown in table 1 obtains.

The encoding gene of the effector albumen (BrCRE1) of the grape ulcer bacterium also belongs to protection scope of the present invention.

The cDNA of the effector albumen (BrCRE1) of the grape ulcer bacterium be following 1) or 2) or 3) DNA molecular:

1) DNA molecular shown in sequence 2 in sequence table；

2) hybridize under strict conditions with the DNA sequence dna 1) limited and encode the effector albumen of the grape ulcer bacterium DNA molecular；

3) with sequence table in sequence 2 nucleotide sequence with 90% or more homology and coding albumen to grape have There is the nucleotide sequence of pathogenic function.

2 overall length of sequence is 645 nucleotide in sequence table, and encoding a length is 214 amino acid (sequence in sequence table 1), the albumen that molecular weight is about 23kD, as the effector albumen (BrCRE1) of grape ulcer bacterium, also referred to as grape ulcer bacterium Cause a disease the sub- albumen of correlation effect.

Following 1) of nucleotide sequence of the genomic gene of the effector albumen (BrCRE1) of the grape ulcer bacterium, 2) or it is 3) shown:

1) in sequence table SEQ ID №: 3 nucleotide sequence；

2) under strict conditions can with 1) described in the nucleotide sequence that hybridizes of DNA sequence dna；

3) with sequence table in SEQ ID №: 3 nucleotide sequence with 90% or more homology and coding albumen tool There is the nucleotide sequence of the effector protein function of grape ulcer bacterium.

3 overall length of sequence is 868 nucleotide in sequence table, is first outer from 5 ' the 1-74 nucleotide in end of sequence 3 Aobvious son, 75-190 nucleotide are First Introns, and 191-385 nucleotide are second exon, 386-440 Position nucleotide is second introne, and 441-680 nucleotide are third exons, and 681-735 nucleotide are the Three intrones, 736-868 nucleotide are the 4th exons, protein shown in sequence 1 in polynucleotide.

Above-mentioned stringent condition can be to hybridize at 65 DEG C in 0.1 × SSPE (or 0.1 × SSC), the solution of 0.1%SDS And wash film.

The recombinant expression carrier of the encoding gene of effector albumen (BrCRE1) containing the grape ulcer bacterium, expression Box, transgenic cell line or recombinant bacterium all belong to the scope of protection of the present invention.

The effector albumen (BrCRE1) and its encoding gene of above-mentioned grape ulcer bacterium can be to grape pathogenicities in cultivation Application in enhancing or the transgenic engineered bacteria weakened also belongs to protection scope of the present invention, wherein the cultivation can be to grape The method of pathogenicity enhancing or the transgenic engineering bacteria strain weakened is that above-mentioned gene is transferred in starting strain, and screening obtains To the transgenic engineered bacteria of grape pathogenicity enhancing；Or by starting strain the gene mutation or knockout, screening obtain The transgenic engineered bacteria that grape pathogenicity is weakened；The starting strain is grape ulcer bacterium (L.theobromae) bacterial strain.

The albumen and its encoding gene as effector albumen excitation plant defense, allergic reaction and/or Excitation plant disease resistance genes expression in application, and/or as albumen pesticide come defend pest and disease damage infringement in application, It belongs to the scope of protection of the present invention, the plant is preferably tobacco.

The protein is preventing and/or is treating answering in disease caused by grape ulcer bacterium (L.theobromae) With also belonging to protection scope of the present invention.

The albumen can enhance the pathogenic of grape ulcer bacterium after showing overexpression through transgenic experiments, be that research is disease-resistant The important target of gene.

The gene has the function of disease-resistant gene overexpression in excitation tobacco, and the hypersensitive necrosis of tobacco can be caused anti- It answers, therefore, which is that grape ulcer bacterium is caused a disease relevant effector albumen.The effector egg generated as phytopathogen White, it can cause plant defense, pass through the activated plant body in conjunction with the receptor on surface of Plant callus cell or subcellular surface The defense mechanisms such as the interior expression of cascade signal system and induced defense gene play a role in resistance signal's approach, have Advantage and characteristic not available for chemical pesticide can be used as a kind of novel microbial albumen pesticide to defend the infringement of pest and disease damage.

Detailed description of the invention

Fig. 1 is the relative expression quantity of BrCRE1 gene after the inoculation of grape ulcer bacterium in embodiment 2.

Fig. 2 is toxicity test of the BrCRE1 albumen on tobacco leaf in embodiment 3.

Fig. 3 is the structural schematic diagram of pET-BrCRE1 carrier in embodiment 4.

Fig. 4 is the SDS-PAGE protein adhesive figure of His-BrCRE1 fusion protein in embodiment 4.

Fig. 5 is that His-BrCRE1 fusion protein HR on tobacco leaf reacts in embodiment 5.

Fig. 6 is the relative expression that His-BrCRE1 fusion protein injects tobacco resistance related gene after tobacco in embodiment 5 Amount.

Fig. 7 is the relative expression quantity that BrCRE1 gene in transformant is overexpressed in embodiment 6.In figure, WT is wild type pair According to OV1, OV2, OV3, OV4, OV5, OV6 are six overexpression transformants.

Fig. 8 is the phenotype photo that overexpression transformant is inoculated with grape branch in embodiment 6.In figure, WT is wild type control, OV1, OV2, OV3, OV4, OV5, OV6 are six overexpression transformants.

Fig. 9 is the scab length statistics that overexpression transformant is inoculated with grape branch in embodiment 6.In figure, WT is wild type Control, OV1, OV2, OV3, OV4, OV5, OV6 are six overexpression transformants.

Specific embodiment

Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly What routine biochemistry reagent shop was commercially available.Quantitative test in following embodiment is respectively provided with three repeated experiments, as a result makes even Mean value.

Polysaccharide polyphenol type plant total RNA extraction reagent box: Aurion wins company, article No. ALBRE-003-100.DNase Ⅰ,M- MLV, SYBR Premix Ex Taq (Tli RNaseH Plus), pMD18-T, restriction enzyme and ligase are purchased TaKaRa company.

Wild type grape ulcer bacterium (L.theobromae) bacterial strain CSS-01s, by the preservation of this laboratory, (Liu Aifen opens Prosperous, Zhang Wei waits foundation [J] plant protection of grape ulcer bacterium transformant pathogenicity Fast Evaluation system, and 2013,2: 021)。

Glume blight of rice plant bacterium (Burkholderia glumae) and pEDV carrier: China Agricultural University, bibliography: Zhang Y,Zhang K,Fang A,et al.Specific adaptation of Ustilaginoidea virens in occupying host florets revealed by comparative and functional genomics[J] .Nature communications,2014,5.The pEDV carrier plasmid that sets out is pBBR 1MCS-5.With plasmid pBBR 1MCS-5 For the plasmid that sets out, by oligonucleotides P1 (5 '-GAAGCTTATCGATGAATTCCAGCT-3 ') and P2 (5 '- GGAATTCATCGATAAGCTTCGTAC-3 ') it is inserted between I site Kpn I and Sst of pBBR 1MCS-5 name plasmid, it obtains To recombinant vector be named as mpBBR 1MCS.Using plasmid pV316-1A as template, with primer KS_96 (5 '-CCCAAGCTTTT TCCCCGAAGATTAGGAACTGTC-3 ') and KS_107 (5 '-GGAATTCTTATGCGTAGTCTGGTACGTCGTACGGATAG GATCCGTCGACTCGTTTACCTCCACCCAATAGG-3 ') it is expanded, obtained product I pair of enzyme of Hind III and EcoR It cuts, the segment of recycling is inserted respectively between the identical restriction enzyme site of mpBBR 1MCS, and obtained recombinant vector is named as pEDV.

PKN carrier is constructed by laboratory, and building process is as follows: being used BamH I and Xba I double digestion pUCATPH carrier, is obtained To small fragment be inserted into the identical restriction enzyme site of pBluescript KS carrier between, obtained recombinant vector is named as pKS1； With Kpn I and Cla I double digestion pUCATPH carrier, obtained small fragment is inserted between the identical restriction enzyme site of pKS1 carrier, obtains To recombinant vector be named as pKS2；Using pEGFP-C1 as template, with Neo-XF (5 '- AGTCTAGACTGAGGCGGAAAGAACCAGC-3 ') and Neo-XF (5 '-CGTCTAGATCAGAAGAACTCGTCAAGAAG-3 ') Primer carries out pairing and carries out PCR amplification, distinguishes single endonuclease digestion PCR product and pKS2 carrier with XbaI, reaction is attached after recycling, Obtained recombinant vector is named as pKN.

Neomycin (NEOMYCIN): Sigma company, article No. N6386-5G.Glusulase (Snailase): Sigma company, Article No. is SL103-5G.Driselase (Driselase): Sigma company, article No. D9515-5G.

The clone of embodiment 1, BrCRE1 albumen and its encoding gene

The BrCRE1 gene studied herein is the base infected by grape ulcer bacterium CSS-01s bacterial strain to ' summer is black ' grape Because of the effector protein gene that can induce plant and generate host resistance filtered out in expression modal data.With grape ulcer bacterium The total serum IgE that CSS-01s bacterial strain extracts is template, designs special primer BrCRE1-F and BrCRE1-R, is expanded using RT-PCR technology Increase the full-length cDNA segment for obtaining BrCRE1 gene.Primer sequence is as follows:

BrCRE1-F:5 '-ATGAAGGCTTCCGGTCTC-3 ' (sequence 5 in sequence table)；

BrCRE1-R:5 '-GAAGTACTGCAGCAACTG-3 ' (sequence 5 in sequence table).

7 days grape ulcer bacterium CSS-01s are grown in PDA culture medium, extract total serum IgE and reverse transcription after collecting mycelia Obtain cDNA.Using cDNA as template, carrying out PCR amplification with the primer pair that BrCRE1-F and BrCRE1-R is formed, (target sequence is about 642bp).PCR amplification system are as follows: 10 × PCR buffer (Mg of 2.5 μ L²⁺Free), 1.8 μ LMgCl₂(25mM), 0.5 μ L's DNTPs (10mM), 0.2 μ LTaq enzyme (5U/ μ L), 1.0 μ L template cDNA, forward primer and reverse primer (10mM) respectively add 0.5 μ L adds ddH2O to supply 25 μ L.Response procedures are as follows: after 94 DEG C of initial denaturation 5min, into 94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 30s, 32 circulations, finally extend 10min at 72 DEG C.Pcr amplification product is recycled into connection pMD18-T carrier (TaKaRa), conversion Bacillus coli DH 5 α, plasmid identify that correctly clone is sent to Beijing Bo Maide gene technology Co., Ltd and is surveyed through digestion Sequence, sequencing result is as shown in the sequence 2 of sequence table, protein shown in the sequence 1 of polynucleotide.It will show external source through sequencing Insert Fragment is that the recombinant plasmid of sequence 2 is named as pMD18-T/BrCRE1.

3 days grape ulcer bacterium CSS-01s are grown in PDA culture medium, extract genomic DNA after collecting mycelia.With Genomic DNA is template, carries out PCR amplification (target sequence about 868bp) with the primer pair that BrCRE1-F and BrCRE1-R is formed. PCR amplification system are as follows: 10 × PCR buffer (Mg of 2.5 μ L²⁺Free), 1.8 μ LMgCl₂(25mM), the dNTPs of 0.5 μ L (10mM), 0.2 μ LTaq enzyme (5U/ μ L), 1.0 μ L templet gene group DNA, forward primer and reverse primer (10mM) respectively add 0.5 μ L adds ddH2O to supply 25 μ L.Response procedures are as follows: after 94 DEG C of initial denaturation 5min, into 94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 50s, 32 circulations, finally extend 10min at 72 DEG C.Pcr amplification product is recycled into connection pMD18-T carrier (TaKaRa), conversion Bacillus coli DH 5 alpha, plasmid identify that correctly clone is sent to Beijing Bo Maide gene technology Co., Ltd and is sequenced through digestion, Sequencing result transcribes cDNA amplified fragments shown in the sequence 2 of formation sequence table as shown in the sequence 3 of sequence table.

Protein shown in sequence 1 by sequence table is named as BrCRE1 albumen.The gene life of BrCRE1 albumen will be encoded Entitled BrCRE1 gene, open reading frame is as shown in the sequence 2 of sequence table.

Embodiment 2, BrCRE1 gene expression pattern analysis during grape ulcer bacterium infects grape host

One, grape ulcer bacterium is inoculated with grape branch

The CSS-01s mycelia block saved in 4 DEG C of refrigerators is placed on PDA solid medium and is activated, 28 DEG C of culture 24-36h. Choose annual ' summer is black ' grape semi-lignified green branch item, 70% ethyl alcohol surface sterilization.It is beaten in the middle part of branch internode with punch CSS-01s mycelia block is placed in hole by hole, and sealed membrane is fixed.Branch after inoculation is placed in culturing room's flowerpot and is cultivated, humidity >=80%, temperature at 26-28 DEG C, in inoculation 0h, 12h, for 24 hours, 36h and 48h take grape branch epidermis, in -80 after liquid nitrogen cryopreservation It saves in DEG C refrigerator, is extracted for RNA.

Two, inoculation sample RNA is extracted and expression is verified

Grape branch RNA is extracted using polysaccharide polyphenol type plant total RNA extraction reagent box (Aurion is rich), through DNase I (Takara) after 37 DEG C of digestion 30min, cDNA is synthesized using M-MLV (Takara) reverse transcription, -20 DEG C of preservations after 10 times of dilutions It is spare, it is used for quantitative fluorescence analysis.BrCRE1 gene is detected using the primer pair that BrCRE1-qF and BrCRE1-qR is formed, is used BrActin gene is as reference gene (the primer pair amplifies BrActin formed with BrActin-qF and BrActin-qR).Using 3 repetitions are arranged referring to TaKaRa specification, each sample in SYBR fluorescent dye determination, reaction system.Reaction system are as follows: 0.5 μ L Reverse transcription product, 3.5 μ L of primer (0.5 μM), 7 μ L 2 × SYBR Premix Ex Taq II, moisturizing to 14 μ L of total volume.Institute It is ABI 7500 with instrument.Amplification program are as follows: 94 DEG C of initial denaturation 2min, into 94 DEG C of denaturation 15sec, 60 DEG C of denaturation 15sec, 68 DEG C extend 30sec totally 40 circulation, last 65-95 DEG C prepares solubility curve.The primer sequence is as follows:

BrCRE1qF:5 '-CAACAGTGGCAAGGACTA-3 '；

BrCRE1qR:5 '-GATGGTGGTGGTCTTCTT-3 '.

BrActin-qF:5 '-GAAGGACCTGTACGGCAACA-3 '；

BrActin-qR:5 '-AGGGCGGTGATTTCCTTCTG-3 '.

The result is shown in Figure 1, it can be seen from the figure that BrCEP1 gene expression dose is reached when grape ulcer bacterium infects 12h To highest, then it is gradually reduced.

Embodiment 3, BrCRE1 albumen tobacco toxicity test

One, vector construction

It is matched with primer BrCRE1-SIF and BrCRE1-BIR, using plasmid pMD18-T/BrCRE1 as template, amplification Obtained segment is connected in carrier T, is named as pMD18-T/BrCRE1t；With I double digestion pMD18-T/ of BamH I and Sal BrCRE1t, recycling small fragment are inserted between the identical restriction enzyme site of pEDV, and obtained recombinant vector is named as pEDV/BrCRE1. Bacterium colony PCR and digestion qualification result, which are shown, successfully constructs expression vector pEDV/BrCRE1.The primer sequence is as follows:

BrCRE1-SIF:5 '-TGTCGACCGTTCCCATGCTTAAC-3 '；

BrCRE1-BIR:5 '-TGGATCCGAAGTACTGCAGC-3 '.

Two, recombinant plasmid transformed glume blight of rice plant bacterium (Burkholderia glumae)

1, the preparation and conversion of glume blight of rice plant bacterium competence

10 μ L glume blight of rice plant bacterium are transferred in 50mL fluid nutrient medium, 28 DEG C of 180rpm shaken cultivations are stayed overnight, and are expanded It cultivates to OD₆₀₀=1.0, bacterium solution is transferred to sterile centrifugation tube, 800g is centrifuged 5min and collects thallus at 4 DEG C, abandons supernatant；Use 40mL The 10% glycerite gently suspension cell of pre-cooling, 800g is centrifuged 5min at 4 DEG C, abandons supernatant；10% glycerol being pre-chilled with 40mL Solution suspension cell again, 800g is centrifuged 5min at 4 DEG C, abandons supernatant；Gently with 10% glycerite being pre-chilled with 200 μ L finally It suspends, is finally distributed into 50 μ L aliquots in 1.5mL centrifuge tube, liquid nitrogen flash freezer is placed on -80 DEG C of refrigerators.It is incited somebody to action by electroporated In pEDV/BrCRE1 recombinant plasmid glume blight of rice plant bacterium competence, 100 μ L bacterium solutions are taken, the solid of gentamicin containing 25mg/L is applied to On LB culture medium flat plate, 28 DEG C of inversion dark cultures, PCR positive colony pEDV/BrCRE1 is stored in -80 DEG C of refrigerators.

2, tobacco instantaneous conversion

The 10 μ L glume blight of rice plant bacterium of recombinant plasmid containing pEDV/BrCRE1 is transferred to (25mg/ in 3mL LB liquid medium L gentamicin), 28 DEG C of 180rpm overnight incubations.Thalline were collected by centrifugation uses 10mM MgCl₂Colony density is adjusted to by solution OD₆₀₀=0.1.After being stored at room temperature 3h, bacterium solution is injected into growth period three weeks tobacco leaf following tables with 1mL needleless injector Skin.The glume blight of rice plant bacterium for having converted pEDV empty carrier is used as control.

As a result Fig. 2 is seen, it can be seen from the figure that having injected recombination pEDV/BrCRE1 rice millet straw bacillus and control bacterium solution The tobacco leaf of pEDV generates xanthelasma in 48h rear blade, and subsequent scab is gradually weighed out to blade necrosis, but recombinates pEDV/ Necrotic plaque caused by BrCRE1 rice millet straw bacillus is smaller than compareing.It is microbial to illustrate that BrCRE1 albumen can inhibit glume blight of rice plant Allergic reaction, therefore, BrCRE1 albumen play a part of virulence factor in infection processs, are the relevant effector eggs that causes a disease It is white.

Embodiment 4, the prokaryotic expression of BrCRE1 gene and purifying

One, Prokaryotic expression vector construction

It is matched with primer BrCRE1-BIF and BrCRE1-BIR, using plasmid pMD18-T/BrCRE1 as template, amplification Obtained segment is connected in carrier T, is named as pMD18-T/BrCRE1e；With I double digestion pMD18-T/ of BamH I and Sma BrCRE1e, recycling small fragment are inserted between the identical restriction enzyme site of pET-32a, and obtained recombinant vector is named as pET- BrCRE1, carrier figure are shown in Fig. 3.Bacterium colony PCR and digestion qualification result, which are shown, successfully constructs expression vector pET-BrCRE1.Primer Sequence is as follows:

BrCRE1-BIF:5 '-AGGATCCATGAAGGCTTCCGGTCTC-3 '；

BrCRE1-SmR:5 '-TCCCGGGGAAGTACTGCAGCAACTG-3 '.

Two, the prokaryotic expression and protein purification of BrCRE1 gene

By prokaryotic expression carrier pET-BrCRE1 Transformed E .coli BL21 (DE3) competent cell.Picking individual colonies are in LB It is incubated overnight in (Amp containing 100mg/L) fluid nutrient medium in 37 DEG C of 180rpm, 1mL bacterium solution is forwarded to 100mL LB and (is contained 100mg/L Amp) in fluid nutrient medium, 37 DEG C of 180rpm shake training 2h to OD₆₀₀=0.4-0.6；Before taking 1mL bacterium solution to be used as induction Sample；100 μ L IPTG to final concentration of 0.1mM are added, 16 DEG C of 100rpm shake training overnight；1mL bacterium solution is taken out as sample after induction Then product collect bacterium solution with 4 DEG C of 10 000g centrifugation 5min of 50mL centrifuge tube；10mL Lysis Buffer solution (50mM is added NaH₂PO₄, 0.3M NaCl, 10mM imidazoles, pH=8.0) thallus is suspended, ultrasonic treatment cell (power 250W, working time 10s is spaced 10s, works 10 times)；After 4 DEG C of 12 000g centrifugation 10min, supernatant is moved on to new 50mL centrifuge tube, precipitating is used 10mL Lysis Buffer suspends.60 μ 5 × SDS of L loading are added in supernatant and precipitating after respectively taking 240 μ L to induce Buffer boils sample, carries out SDS-PAGE electrophoresis together with the total protein sample of induction front and back, analyzes protein induced situation and lure Albumen is led in supernatant or inclusion body；500 μ l Ni-NTA suspension are added into BioRad protein purification column, first with three times The Lysis Buffer of pillar volume is rinsed pillar 3-5 times；The supernatant protein solution of ultrasonic disruption, 4 DEG C of mixing 1h are added；Add Enter 4mL Wash Buffer (50mM NaH₂PO₄, 0.3M NaCl, 20mM imidazoles, pH=8.0), it washes pillar 3 times, is eventually adding 500μL Elution Buffer(50mM NaH₂PO₄, 0.3M NaCl, 250mM imidazoles, pH=8.0) and carry out His-BrCRE1 egg White elution.

As a result see Fig. 4, through SDS-PAGE electrophoresis, obtain the His-BrCRE1 amalgamation and expression egg that a molecular weight is about 43kD It is white, it is in the same size with prediction.And His-BrCRE1 fusion protein is enriched in supernatant, protein band list after purification One, without miscellaneous band.Fig. 4 note: M: protein Marker；B: the bacterium solution before induction；A: bacterium solution after induction；S: the supernatant after induction； P: the albumen after induction；His-BrCRE1:His-BrCRE1 purifying protein.

Embodiment 5, His-BrCRE1 the fusion protein caused defense reaction on tobacco

One, His-BrCRE1 fusion protein caused HR reaction on tobacco

With 1mL needleless injector, 30 μ g/mL His-BrCRE1 fusion protein of about 20 μ L is injected into from the leaf back side Growth period three weeks tobacco leaf epidermals.Albumen is expressed as compareing using the pET-32a empty plasmid of same concentrations, is observed after 48h Reaction on blade.

As a result as shown in figure 5, His-BrCRE1 fusion protein can cause tobacco leaf to generate HR reaction, with embodiment 3 Caused symptom is almost the same.

Two, His-BrCRE1 fusion protein improves the transcriptional level of tobacco resistance related gene

With 1mL needleless injector, 30 μ g/mL His-BrCRE1 fusion protein of about 20 μ L is injected into from the leaf back side Growth period three weeks tobacco leaf epidermals take tobacco leaf, liquid nitrogen flash freezer in injection 0h, 6h and 12h.To have injected same concentrations PET-32a empty plasmid expression albumen tobacco as control.Tobacco leaf RNA is extracted, reverse transcription reaction and qPCR verifying step Rapid reference embodiment 2.Successively use NtPR1a-qF/NtPR1a-qR, NtPR2a-qF/NtPR2a-qR, NtPAD3-qF/NtPAD3- QR and NtLOX-qF/NtLOX-qR pairing detection NtPR1a, NtPR2a, NtPAD3 and NtLOX gene, is made using NtEF1 α gene For reference gene.Primer sequence is shown in Table 1.

1. research the primers of table

Primer	Primer sequence (5 ' -3 ')
		NtPR1a-qF	GTGCCCAAAATTCTCAACAAG
NtPR1a-qR	TTCTACACCTACATCTGCACGAG
		NtPR2a-qF	TCCAGATACAAATGTCTTCAACG
NtPR2a-qR	TGGGACGTCGAGAATGATCT
		NtPAD3-qF	AGGTTCTGTACCGACTGTGGTT
NtPAD3-qR	GTTCTAAAGATCTCTCGGGCAAT
		NtLOX-qF	AGAAATGGATGTCCACCTTGA
NtLOX-qR	GGACTCATCCCAGTCAAATGTC
		NtEF1α-qF	TGAGAAGGAGCCCAAGTTCT
NtEF1α-qR	TGGTGGGAATCATCTTAACCA

As a result as shown in fig. 6, related resistance can be activated related after His-BrCRE1 fusion protein processing tobacco leaf 6h The expression of gene.

The Pathogenic Tests of embodiment 6, grape ulcer bacterium BrCRE1 gene overexpression transformant

One, vector construction

It is matched with primer BrCRE1-HF and BrCRE1-EvR, using plasmid pMD18-T/BrCRE1 as template, is expanded To segment be connected in carrier T, be named as pMD18-T/BrCRE1ov；With V double digestion pMD18-T/ of Hind III and EcoR BrCRE1ov, recycling small fragment are inserted between the identical restriction enzyme site of pKN, and obtained recombinant vector is named as pKN/BrCRE1. Bacterium colony PCR and digestion qualification result, which are shown, successfully constructs expression vector pKN/BrCRE1.Primer sequence is as follows:

BrCRE1-HF:5 '-CAAGCTTATGAAGGCTTCCGGTCTC-3 '；

BrCRE1-EvR:5 '-TGATATCGAAGTACTGCAGCAACTG-3 '.

Two, recombinant plasmid transformed grape ulcer bacterium

1, prepared by protoplast

The grape ulcer bacterial strain CSS-01s that 4 DEG C save is transferred on PDA solid medium, it will after 28 DEG C of culture 36h Mycelia, which applies to break, is transferred to CM fluid nutrient medium (6g/L Yeast extract, 3g/L Casein enzymatic Hydrolysate, 3g/L Casein acid hydrolysate, 10g/L Sucrose) in, 28 DEG C of 120rpm shake training for 24 hours； 8000g is centrifuged 5min and collects mycelia, is resuspended with 0.7M NaCl solution, and 4000g is centrifuged 15min and collects mycelia；Mycelia weighing, is pressed Enzymolysis liquid is added according to 1g:2mL:2mL (mycelium: 20mg/mL glusulase: 20mg/mL driselase) ratio, 28 DEG C of 120rpm shake training 4h is digested, it is whether thorough with blood counting chamber observation protoplast enzymatic hydrolysis；Three layers of lens wiping paper filter enzymolysis liquid, and pre-cooling is added 0.7M NaCl solution 4000rpm is centrifuged 15min and washs protoplast, discards supernatant liquid；5mL STC solution (1.2M sorb is added Alcohol, 10mM TrisHCl, 50mM CaCl₂) be resuspended, 4000rpm is centrifuged 15min, abandons supernatant；It is eventually adding the STC of 1-3mL Solution simultaneously modulates protoplast concentration to 1x10⁷A/mL.

2, the protoplast transformation of recombinant plasmid

The protoplast that 150 μ L are prepared, the pKN/BrCRE1 plasmid of linearisation are separately added into the centrifuge tube of 50mL (NotI digestion), STC solution are mended to 300 μ L, stand 20min on ice；Be added dropwise 2mL PTC solution (180mM PEG3300, 10mM TrisHCl, 50mM CaCl₂), 20min is stood on ice；The STC solution of 25mL pre-cooling is added, mixes well, 4000rpm is centrifuged 15min, abandons supernatant, and 3mL LR fluid nutrient medium (1g/L Yeast extract, 1g/L Casein is added Enzymatic hydrolysate, 1M Sucrose), 28 DEG C of culture 12-18h；15mL SR solid medium (1g/ is added LYeast extract, 1g/L Casein enzymatic hydrolysate, 1M Sucrose, 1.5g/L agar powder, temperature At 50 DEG C or so), bed board is mixed well, covers the water agar of about 10mL1.5% after waiting SR culture medium to solidify on its surface (1.5g/L agar powder contains 1100 μ g/mL neomycins)；Picking water agar surface is grown after cultivating in 28 DEG C of incubators for 24 hours Single colonie, in CM solid medium (6g/L Yeast extract, 3g/L Casein acid hydrolysate, 3g/L Casein enzymatic hydrolysate, 10g/L Sucrose, 1.5g/L agar powder, contains the new mould of 1100 μ g/mL Element) it screens again, obtain pKN/BrCRE1 recombinant plasmid transformed, 4 DEG C of preservations.The bacterial strain conduct pair of pKN empty carrier is converted According to.

3, transformant RNA extraction and BrCRE1 gene expression analysis

The transformant that 4 DEG C save is transferred on PDA solid medium, mycelia painting is broken after 28 DEG C of culture 36h and is transferred to CM Fluid nutrient medium (6g/L Yeast extract, 3g/L Casein acid hydrolysate, 3g/L Casein Enzymatic hydrolysate, 10g/L Sucrose) in, 28 DEG C of 120rpm shake training for 24 hours, and 8000g is centrifuged 5min and collects bacterium Silk；Transformant RNA is extracted using Trizol (Qiagen), after 37 DEG C of digestion 30min of DNase I (Takara), using M-MLV (Takara) reverse transcription synthesizes cDNA, saves backup for -20 DEG C after 10 times of dilutions, is used for quantitative fluorescence analysis.The primer sequence Column, reaction system, amplification program are the same as embodiment 2.

4, transformant grape branch inoculation experiments

Control strain, transformant bacterial strain are transferred on PDA solid medium, 28 DEG C of culture 48h cover with training to mycelia After supporting ware, bacteria cake (0.5cm) is taken with punch, with the punch of same diameter in annual ' summer is black ' the grape green branch trimmed It is punched on item, removes exocuticle, bacteria cake is placed at green branch item punching, sealed with sealed membrane package, branch is inserted into matrix 28 DEG C of alternation of light and darkness cultures are observed after being inoculated with 72h and count incidence.

As a result as shown, the conversion mediated by PEG, obtains positive transformant 6 (being named as OV1-OV6), Expression quantity of the BrCRE1 gene in OV1-OV6 is 1.5-4 times (Fig. 7) of control strain (WT).Also, it is inoculated with grape branch branch After item, OV1-OV6 transformant scab length relatively compares length, illustrates that the overexpression of BrCRE1 gene can enhance grape ulcer bacterium Pathogenicity (Fig. 8, Fig. 9).

Described above to be merely exemplary for the purpose of the present invention, and not restrictive, those of ordinary skill in the art understand, In the case where not departing from spirit and scope as defined in the appended claims, many modifications, variation or equivalent can be made, but all It will fall within the scope of protection of the present invention.

Sequence table

<110>Beijing City Agriculture and Forestry Institute

<120>from the effector albumen of grape ulcer bacterium and its encoding gene and application

<130> WHOI160081

<160>5

<210> 1

<211> 214

<212> PRT

<213>grape ulcer bacterium (L. theobromae)

<400> 1

Met Lys Ala Ser Gly Leu Phe Leu Ala Ser Leu Val Ser Ala Val Met

1 5 10 15

Ala Ser Pro Ile Ala Asn Leu Ala Gln Gln Cys Ser Gly Gln Ala Val

20 25 30

Asn Gly Ala Thr Thr Gln Pro Ser Asp Pro Ser Ala Arg Met Trp Leu

35 40 45

Ala Leu His Asn Ala His Arg Ala Asn His Thr Gln Thr Cys Ser Val

50 55 60

Ala Trp Asp Gln Gln Leu Ala Asn Glu Ala Met Ala Ser Ala Gln Ala

65 70 75 80

Cys Gln Phe Gln His Thr Asn Ser Gly Lys Asp Tyr Gly Gln Asn Met

85 90 95

Gly Glu Thr Ser Gln Gly Ser Ala Glu His Ala Val Thr Ala Met Phe

100 105 110

Tyr Asn Glu Ile Ser Glu Phe Gly Pro Tyr Trp His Gln Pro Asp Val

115 120 125

Pro Ile Gly Asn Pro Met Ile Leu His Phe Thr Gln Ala Val Trp Lys

130 135 140

Lys Thr Thr Thr Ile Gly Cys Ala Thr Trp Asn Cys Gly Gln Trp Leu

145 150 155 160

Leu Ser Tyr Cys Asn Tyr Arg Gly Pro Gly Asn Tyr Ala Gly Glu Tyr

165 170 175

Gly Asp Asn Val Ala Asp Leu Ile Pro Asn Pro Leu Pro Pro Ile Cys

180 185 190

Ser Glu Ile Gly Ser Ser Ala Gln Asp Gly Ser Cys Ile Thr Asp Gln

195 200 205

Gln Leu Leu Gln Tyr Phe

210

<210> 2

<211> 645

<212> DNA

<213>grape ulcer bacterium (L. theobromae)

<400> 2

atgaaggctt ccggtctctt cctcgcctcg ctggtctccg ccgtcatggc gtcgccaatt 60

gccaacctcg cacagcaatg ctctggtcag gctgtcaacg gtgccaccac ccagcccagt 120

gatccctcgg ccaggatgtg gcttgcactc cacaacgcgc accgcgccaa ccacacccag 180

acctgctccg tcgcctggga ccagcagctc gcaaacgaag ccatggcctc cgcccaagca 240

tgccagttcc agcacaccaa cagtggcaag gactacggcc aaaacatggg cgagaccagc 300

caaggctcgg ccgagcacgc cgttaccgcc atgttctaca acgaaatcag cgaattcggc 360

ccgtactggc accagccgga cgtcccgatc ggcaacccga tgatcctcca ctttactcaa 420

gccgtctgga agaagaccac caccatcggt tgcgccacct ggaactgtgg tcaatggctg 480

ctgtcctact gcaactaccg cggacctggc aactatgccg gcgagtacgg tgacaacgtc 540

gctgatctga tccccaaccc gctccccccg atttgctctg agatcggttc gagcgcacag 600

gacggaagct gcatcactga ccagcagttg ctgcagtact tctaa 645

<210> 3

<211> 868

<212> DNA

<213>grape ulcer bacterium (L. theobromae)

<400> 3

atgaaggctt ccggtctctt cctcgcctcg ctggtctccg ccgtcatggc gtcgccaatt 60

gccaacctcg cacagttagt ctccacccac caaccaggaa gatgcctttg actccactcg 120

agggccacaa agcacactgc tcccgcctcc tttatggcaa ttcttcaatc ttactcacaa 180

ctgaaactag gcaatgctct ggtcaggctg tcaacggtgc caccacccag cccagtgatc 240

cctcggccag gatgtggctt gcactccaca acgcgcaccg cgccaaccac acccagacct 300

gctccgtcgc ctgggaccag cagctcgcaa acgaagccat ggcctccgcc caagcatgcc 360

agttccagca caccaacagt ggcaagtacg ttttgcctct ccacccttta cctttttaaa 420

tctttaacac gccaatgcag ggactacggc caaaacatgg gcgagaccag ccaaggctcg 480

gccgagcacg ccgttaccgc catgttctac aacgaaatca gcgaattcgg cccgtactgg 540

caccagccgg acgtcccgat cggcaacccg atgatcctcc actttactca agccgtctgg 600

aagaagacca ccaccatcgg ttgcgccacc tggaactgtg gtcaatggct gctgtcctac 660

tgcaactacc gcggacctgg tacgtgcaac ccgtatgaag acaaattttg actatactga 720

ctttctgcga ttaggcaact atgccggcga gtacggtgac aacgtcgctg atctgatccc 780

caacccgctc cccccgattt gctctgagat cggttcgagc gcacaggacg gaagctgcat 840

cactgaccag cagttgctgc agtacttc 868

<210> 4

<211> 18

<212> DNA

<213>artificial sequence

<400> 4

atgaaggctt ccggtctc 18

<210> 5

<211> 18

<212> DNA

<213>artificial sequence

<400> 5

gaagtactgc agcaactg 18

Claims

1. a kind of protein, the protein being made of the amino acid residue sequence of the SEQ ID № .1 in sequence table.

2. protein according to claim 1, it is characterised in that: the protein is the effector egg of grape ulcer bacterium It is white, it is with the pathogenic protein for causing grape ulcer.

3. the encoding gene of albumen described in claim 1.

4. encoding gene according to claim 3, it is characterised in that: the cDNA nucleotides sequence of the encoding gene is classified as sequence The nucleotide sequence of SEQ ID №: 2 in list.

5. encoding gene according to claim 3, it is characterised in that: the nucleotide of the genomic gene of the encoding gene Sequence is the nucleotide sequence of SEQ ID №: 3 in sequence table.

6. the recombinant expression carrier containing encoding gene described in claim 3 or 4 or 5.

7. the transgenic cell line containing encoding gene described in claim 3 or 4 or 5.

8. the transgenosis recombinant bacterium containing encoding gene described in claim 3 or 4 or 5.

9. albumen described in claim 1 and its encoding gene are cultivating the transgenosis work for enhancing grape pathogenicity or weakening Application in journey bacterium.

10. application according to claim 9, it is characterised in that: what the cultivation enhanced grape pathogenicity or weakened The method of transgenic strain is that gene described in claim 3,4 or 5 is transferred in starting strain, and screening obtains causing a disease to grape The transgenic engineered bacteria of power enhancing；Or it by the claim 3,4 or 5 gene mutations or knockout in starting strain, screens Obtain the transgenic engineered bacteria weakened to grape pathogenicity；The starting strain is grape ulcer bacterium (L.theobromae) bacterium Strain.

11. albumen described in claim 1 and its encoding gene are anti-as effector albumen excitation plant defense, allergy Answer and/or excite the application in plant disease resistance genes expression.

12. albumen described in claim 1 and its encoding gene as albumen pesticide come defend pest and disease damage infringement in Using.

13. protein described in claim 1 is preventing and/or is treating disease caused by grape ulcer bacterium (L.theobromae) Application in evil.