CN107916232B - Recombined broad spectrum green muscardine fungus and its preparation method and application - Google Patents
Recombined broad spectrum green muscardine fungus and its preparation method and application Download PDFInfo
- Publication number
- CN107916232B CN107916232B CN201711031622.0A CN201711031622A CN107916232B CN 107916232 B CN107916232 B CN 107916232B CN 201711031622 A CN201711031622 A CN 201711031622A CN 107916232 B CN107916232 B CN 107916232B
- Authority
- CN
- China
- Prior art keywords
- green muscardine
- muscardine fungus
- broad spectrum
- recombined
- maa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
- C12N9/0014—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
- C12N9/0022—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4) with oxygen as acceptor (1.4.3)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y104/00—Oxidoreductases acting on the CH-NH2 group of donors (1.4)
- C12Y104/03—Oxidoreductases acting on the CH-NH2 group of donors (1.4) with oxygen as acceptor (1.4.3)
- C12Y104/03004—Monoamine oxidase (1.4.3.4)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Mycology (AREA)
- Molecular Biology (AREA)
- Virology (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The present invention provides a kind of recombined broad spectrum green muscardine fungus, its expression for lowering monoamine oxidase or not, or the content of its internal tryptamines is higher than wild type broad spectrum activity green muscardine fungus, the recombined broad spectrum green muscardine fungus is its bacterial strain itself, offspring, its conidium generated or its mycelium generated or any combination between them.Monoamine Oxidases Gene is knocked out in the recombined broad spectrum green muscardine fungus, its concentration that can significantly improve tryptamines in wide spectrum Luo Baici green muscardine fungus, and then insecticide efficiency is significantly improved, shorten to the median lethal time LT50 of wild type wide spectrum green muscardine fungus from 7.33 ± 0.445 days 6.136 ± 0.488 days；And environmental sound, biological safety is good, property non-toxic to humans.
Description
Technical field
The present invention relates to transgenic strains and its preparation method and application, more particularly to can be improved broad spectrum activity green muscardine fungus and kill
Recombined broad spectrum green muscardine fungus of worm efficiency and its preparation method and application.
Background technique
Insect pathogenic fungus, compared to chemical insecticide, with environmental-friendly, resistance is strong, can largely spread, selectivity
The advantages that high is widely applied a kind of biological pesticide.However, current insect pathogenic fungus remains cause as insecticide
Dead time longer disadvantage.By studying fungal attack mechanism, fungi is transformed using genetic engineering means, improves fungus insecticide
Effect be current research an important directions.Such as:
1, the hydrolase gene of high expression fungus secretion.It is overexpressed body wall degrading proteinase such as subtilopeptidase A
(subtilisins) speed that fungi penetrates body wall can be improved in Pr1A, significantly improves the virulence of Metarhizium anisopliae, accelerates
Lethal speed and in haemocoele activate polyphenol oxidase original system, lead to the rapid melanism of polypide, to maduca sexta it is lethal when
Between reduce 25%, the feeding rate of pest also reduces 40%.Chitin hydrolase Bbchitl gene is transferred to white deadlock by Fang etc.
In bacterium genome, overexpression engineered strain is obtained.The virulence of aphid is remarkably reinforced in the engineered strain.Compared with wild strain,
Engineered strain reduces by 50% to the lethal dose of aphid, and lethal time shortens 50%.
2, to the transformation of fungal metabolite gene.Xia etc. is carried by building Fungal Acid trehalase (ATM) overexpression
Body, converts wide spectrum green muscardine fungus, and enhancing fungi promotes wide spectrum green muscardine fungus in insect the metabolic capability of trehalose in host's hemolymph
Tumor growth.
3, foreign gene is introduced.Charybdotoxin (Androctonus australis neurotoxin) AaIT is squama wing
Mesh, dipteral insect specific neurotoxin.Wang et al., can be special in host's haemocoele by after the channel genes green muscardine fungus
Property expression neurotoxin, improved fungi improves 22 times to the toxicity of maduca sexta.
4, expression and immune-related gene.Yang et al. expresses insect congenital immunity identification access Toll in muscardine
The serine of signal path inhibits enzyme Spn43Ac, reduces 24% to the median lethal time of black peach aphid, lethality improves 2 times.
Fan etc. is white by Glucose-Fructose oxidoreducing enzyme (Glucose-frustose oxidoreductase GFOR) channel genes
In stiff bacterium, the transgenic engineered bacteria of building can inhibit host gramnegative bacterium by synthesis of glucose acid lactone (GDL)
The activity of binding protein (Gram-negative bacteria binding proteins GNBPs) inhibits being immunized for host
Reaction, makes the lethal time of fungi reduce 48h, insecticidal effect is improved.
But fungi is transformed by genetic engineering means at present and still has some defects.For example, Chinese invention patent authorization
Notification number is disclosed coding north African scorpion (Androctonus australis) neurotoxin by optimization of CN101755050
The polynucleotide sequence of AaIT is imported in Metarhizium anisopliae (Metarhizium anisopliae) and is expressed, and be can be improved and is killed
Worm efficiency, effective for the control of insect.But the BmKITS imported in fungi is toxic to the mankind, can cause centainly to endanger to the mankind
Danger.
Metarhizium fungi is widely used in control of insect.It can be by Metarrhizium anisopliae preparation control presently more than 200 kinds of agriculture and forestry injurious insects
System harm.Controlling object concentrates on locustamigratoria, Blattaria, the aphid of Homoptera, aleyrodid, leafhopper class and the coleoptera of Orthoptera
Grub etc..The representation type of Metarhizium has Metarhizium anisopliae, Luo Baici green muscardine fungus and locust green muscardine fungus etc., different types of
Insecticidal range is different.Such as Metarhizium anisopliae (Metarhizium anisopliae), Luo Baici green muscardine fungus (Metarhizium
It robertsii) is broad spectrum insecticide fungi.Currently, the wide spectrum green muscardine fungus of wild type is long in the prevalence of lethal time, effect is not
Ideal, and there is potential danger to environment or the mankind for the bacterial strain being transformed by genetic engineering means.
Summary of the invention
The present inventor has found through protracted and unremitting efforts, obligate bacterium locust green muscardine fungus deadlock why greener than broad spectrum of bacteria
The insecticide efficiency of bacterium is high, it may be possible to since obligate bacterium locust green muscardine fungus lacks monoamine oxygen than broad spectrum of bacteria green muscardine fungus in tryptophan metabolism
Change enzyme (EC1.4.3.4), causes tryptamines that can not be metabolized in obligate bacterium.Tryptamines can be by ARH receptor modulators host cell
Transcription factor makes the metabolism of host generate disorder, to improve the insecticidal effect of fungi.
Therefore, the present invention provides a kind of recombined broad spectrum green muscardine fungus, lower the expression of monoamine oxidase or do not express,
Or the content of its internal tryptamines is higher than wild type broad spectrum activity green muscardine fungus, the recombined broad spectrum green muscardine fungus is its bacterial strain itself,
Its offspring, its conidium generated or its mycelium generated or any combination between them.
Illustratively, the expression of monoamine oxidase lowers 50% or more in recombined broad spectrum green muscardine fungus provided by the invention.
Illustratively, in recombined broad spectrum green muscardine fungus monoamine oxidase expression lower 60%, 70%, 80%, 90% or
95% or more or 100%.
Illustratively, recombined broad spectrum green muscardine fungus is recombination broad spectrum of bacteria Luo Baici green muscardine fungus (Metarhizium in the present invention
) or broad spectrum of bacteria Metarhizium anisopliae (Metarhizium anisopliae) robertsii.
Illustratively, the recombined broad spectrum green muscardine fungus in the present invention is recombination broad spectrum of bacteria Luo Baici green muscardine fungus
(Metarhizium robertsii), deposit number are CGMCC NO.14152, classification naming Metarhizium
Robertsii was preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (on August 29th, 2017
Location: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3).
Illustratively, the recombined broad spectrum green muscardine fungus in the present invention is compared to wild type broad spectrum activity green muscardine fungus, the recombination
Broad spectrum activity green muscardine fungus lowers the expression of monoamine oxidase or does not express, and then the concentration of raising tryptamines makes the metabolic disorder of host.
Tryptamines is made the metabolism of host generate disorder, is improved host ROS, make place by the transcription factor in ARH receptor modulators host cell
The main metainfective death rate improves.
In the present invention, the concentration of tryptamines in host can also be directly improved by other methods, produces the metabolism of host
Raw disorder is to improve the death rate after host infection.
Another aspect of the present invention provides insecticide comprising recombined broad spectrum green muscardine fungus of the present invention, Yi Jiren
Selection of land, acceptable carrier in Pesticide Science.Pharmaceutically acceptable carrier can be mica powder, precipitated calcium carbonate, clay, talcum
Powder, kaolin, diatomite, attapulgite, bentonite, sepiolite, urea, potassium chloride, sodium sulphate, ammonium sulfate, sodium nitrate, nitric acid
One of ammonium, ammonium chloride are a variety of.
The recombined broad spectrum green muscardine fungus can be bacterial strain or its offspring or its conidium generated or its bacterium generated
Filament or any combination between them.
In a specific embodiment provided by the invention, the insecticide for prevent and treat one of following pest or
It is several: pine moth, corn borer, grub, locust, colorado potato bug, Monochamus alternatus Hope, ant, tea lesser leafhopper, small heart-eating peach worm,
Aphid, mosquito.
Another aspect of the present invention provides recombined broad spectrum green muscardine fungus or the recombined broad spectrum green muscardine fungus of the invention
Offspring or its conidium generated or its mycelium generated or any combination between them are in preparing insecticide
Purposes.
Preferably, insecticide of the invention is for killing locust.
Optionally, insecticide of the invention can also can kill the active constituent of locust comprising other.Illustratively, such as
Destruxins, pyrethroid, carbamates, class nicotinoids, neuronal sodium channel blocker, desinsection huge cyclic lactone,
One of γ-aminobutyric acid (GABA) antagonist, insecticidal ureas and juvenile hormone mimics are a variety of.
The present invention also provides the preparation methods of recombined broad spectrum green muscardine fungus, including raise and/or to increase recombined broad spectrum green
The step of stiff endobacillary tryptamines.
Illustratively, it by genetic recombination, knocks out or transformation is expressed the relevant nucleotide sequence of monoamine oxidase and lowered
The expression of monoamine oxidase or not.
In the specific embodiment of the present invention, recombined broad spectrum green muscardine fungus is by knocking out expression monoamine oxidase phase
The nucleotide sequence of pass and express that monoamine oxidase not, specifically comprise the following steps: to expand wild type broad spectrum activity respectively green
The upstream sequence and downstream sequence of monoamine oxidase nucleotide sequence in stiff bacterium (MAA) will expand later upstream sequence under
Swim sequence seamless connection, it is preferable that later upstream sequence and downstream sequence will be expanded and be joined seamlessly on Bar gene or Ben
On gene.
In a specific embodiment of the present invention, the type of plasmid is not limited, as long as containing Bar gene (herbicide grass
Ammonium phosphine resistant gene) and/or Ben gene (benomyl resistance gene).
In one particular embodiment of the present invention, selection contains the PDHt-Bar plasmid of the Bar gene, recombined broad spectrum
The preparation method of property green muscardine fungus specifically includes:
Design primer, MAA_03753Fs and MAA_03753Rs, MAA_03753Fx and MAA_03753Rx, with the base of MAA
Because group DNA be template, expand respectively thereon, downstream sequence.After the upstream and downstream sequence digestion of amplification, it is joined seamlessly to respectively
The upstream and downstream of Bar in PDHt-Bar plasmid forms recombinant plasmid.Recombinant plasmid is transferred to by agrobacterium tumefaciens-mediated transformation
In MAA.
The present invention also provides a kind of methods for killing locust comprising apply recombined broad spectrum green muscardine fungus of the invention or
The step of recombined broad spectrum green muscardine fungus that person is prepared by above-mentioned preparation method.
Wherein, recombined broad spectrum green muscardine fungus includes that recombined broad spectrum Metarhizium Strains itself or the recombined broad spectrum are green
The offspring of stiff bacterium or its conidium generated or its mycelium generated or any combination between them.
Preferably, the application include will be sprayed to crops with recombined broad spectrum green muscardine fungus of the invention, such as corn,
Wheat etc..
Illustratively or preferably, the present invention one of has the advantage that:
Recombined broad spectrum green muscardine fungus of the invention can significantly improve the concentration of tryptamines in wide spectrum Luo Baici green muscardine fungus, in turn
Significantly improve insecticide efficiency.Such as recombined broad spectrum green muscardine fungus of the invention can make the median lethal time of wide spectrum Luo Baici green muscardine fungus
LT50 was shortened to 6.136 ± 0.488 days from 7.33 ± 0.445 days；And environmental sound, biological safety is good, non-toxic to humans
Property.
Detailed description of the invention
Fig. 1 is the structural schematic diagram of recombinant plasmid in the embodiment of the present invention；
Fig. 2 is the agarose gel electrophoresis figure of recombined broad spectrum Luo Baici green muscardine fungus in the embodiment of the present invention；
Fig. 3 A is the content of tryptamines in recombined broad spectrum Luo Baici green muscardine fungus mycelia in the embodiment of the present invention；
Fig. 3 B is in the embodiment of the present invention after recombined broad spectrum Luo Baici green muscardine fungus infection migratory locusts, and tryptamines contains in migratory locusts body
Amount；
The experimental result picture that Fig. 4 is ROS in flow cytomery migratory locusts hemolymph in the embodiment of the present invention；
Fig. 5 is recombined broad spectrum Luo Baici green muscardine fungus in the embodiment of the present invention to the experimental result picture of migratory locusts median lethal time.
Specific embodiment
The following is a clear and complete description of the technical scheme in the embodiments of the invention, it is clear that described embodiment
It is only a part of the embodiment of the present invention, instead of all the embodiments.Based on the embodiments of the present invention, ordinary skill
Personnel's every other embodiment obtained without creative efforts, shall fall within the protection scope of the present invention.
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
The present invention is described in detail combined with specific embodiments below, these embodiments are for understanding rather than limit the present invention.
The preparation of the Luo Baici green muscardine fungus of 1 recombined broad spectrum of embodiment
(MAA_ is denoted as in the present embodiment to knock out the Monoamine Oxidases Gene in wide spectrum Luo Baici green muscardine fungus (being denoted as MAA)
03753) it is illustrated for, the gene bank accession number of MAA_03753 is NW_011942171.1, monoamine
Oxidase [EC:1.4.3.4], particular sequence is as shown in SEQ ID NO:1.It is green that wide spectrum Luo Baici is not limited in the present embodiment
Stiff bacterium can also be other wide spectrum green muscardine fungus with monoamine oxidase, such as Metarhizium anisopliae.It is also and unlimited in the present embodiment
The type of plasmid is determined, as long as containing Bar gene and/or Ben gene.For example, can be pDHt-Bar plasmid, it is also possible to
PDHt-Ben plasmid.It is illustrated by taking pDHt-Bar plasmid as an example below.
The knockout plasmid construction of 1.MAA_03753
Design primer, MAA_03753Fs and MAA_03753Rs, MAA_03753Fx and MAA_03753Rx, with wild type
The genomic DNA of MAA be template, expand respectively thereon, downstream sequence.The enzyme of SmaI, SpeI are added respectively in the end of product
Enzyme site.Specific primer sequence is as follows:
MAA_03753Fs (as shown in SEQ ID NO:2):
ATTCCTGCAGCCCGGGATGGCGACAACCCAAATC
MAA_03753Rs (as shown in SEQ ID NO:3):
CGACGGATCCCCCGGGGTGTCAACCCTCGTTCTATT
MAA_03753Fx (as shown in SEQ ID NO:4):
GATCTGATGA3ACTAGTGTTTCGGAACATTCACTTTG
MAA_03753Rx (as shown in SEQ ID NO:5):
CCGCTCTAGAACTAGTCGGGCAAGATTCCGTTCGT
With the upstream sequence of MAA_03753Fs and MAA_03753Rs primer pair amplifies monoamine oxidase, 880bp is amplified
Segment (is denoted as MAO-S).By the way that MAO-S is joined seamlessly to the upstream of Bar in PDHt-Bar plasmid (as schemed after SmaI single endonuclease digestion
Shown in 1).
With the downstream sequence of MAA_03753Fx and MAA_03753Rx primer pair amplifies monoamine oxidase, 646bp is amplified
Segment (is denoted as MAO-X).After SpeI single endonuclease digestion, MAO-X is joined seamlessly to PDHt-Bar plasmid (by Shanghai plant physiology
Biochemical Research is provided, and is specifically seen: Yixiong Chen, Zhibing Duan, Peilin Chen, Yanfang
Shang&Chengshu Wang,The Bax inhibitor MrBI-1regulates heat tolerance,
apoptotic-like cell death,and virulence in Metarhizium robertsii,Scientific
Reports 5, Article number:10625 (2015) and Wei Huang, Yanfang Shang, Peilin Chen, Kai
Cen and Chengshu Wang,Basic Leucine Zipper(bZIP)Domain Transcription Factor
MBZ1Regulates Cell Wall Integrity,Spore Adherence,and Virulence in
Metarhizium robertsii*, Journal of Biological Chemistry290 (13): 8218-8231.) in
The downstream (as shown in Figure 1) of Bar.In this way, the 580bp segment among MAA-03753 is replaced by length by the Bar sequence of 938bp
Generation.
The mixture of PCR reaction are as follows: 10 × Ex Taq Buffer polymerase buffer of 2.5 μ L, the 2.5mM of 2 μ L
DNTP, each 1 μ L of 10 μM of upstream and downstream primer, the template of 1 μ L, the Takara Ex Taq archaeal dna polymerase of 0.25 μ L add ultrapure water
It is 25 μ L to total volume；
PCR reaction condition: 95 DEG C of initial denaturations 5min, 94 DEG C of 30sec, 54 DEG C of 30sec, 72 DEG C of 1min (35 circulations)；Most
72 DEG C of extension 10min afterwards.After the agarose gel electrophoresis that PCR reaction product mass fraction is 1.0%, plastic recovery kit is used
Recovery product.
Digestion system: 10 × cutsmart buffer of 5 μ L, the Plasmid DNA of 1 μ g, the restriction endonuclease (NEB) of 1 μ L are supplied
ddH2O to 50 μ L.
Seamless connection: CloneIIOne Step Cloning Kit(Vazyme)
5 × buffer of 4 μ L, the ExnaseII of 2 μ L, carrier amount are 0.02 × carrier base number ng, and Insert Fragment amount is
0.04 × Insert Fragment base number ng, residue H2O is converted after being supplemented to 20 μ L, 37 DEG C of incubation 30min.
2. the building of engineered strain:
The upstream sequence of amplification and downstream sequence are inserted into carrier PDHt-Bar respectively, are confirmed as after sequence verification
The knockout carrier (as shown in Figure 1) that success constructs.It is transferred in MAA with agrobacterium tumefaciens-mediated transformation by plasmid is knocked out later.
Agrobacterium tumefaciens-mediated transformation (Agrobacterium tumefaciens mediated transformation,
ATMT it) constructs genetic of fungi transformation system: resulting vehicle being converted to Agrobacterium AGL-1, positive Agrobacterium is chosen after PCR identification
AGL-1 converts bacterial strain, and YEB culture medium (Carb containing 50mg/mL and 50mg/mL Kan) expands culture.Thallus is collected, with appropriate
IM fluid nutrient medium be resuspended OD660It is 0.15,28 DEG C and is protected from light culture to bacterial concentration OD660For 0.5-0.8.
Wild type wide spectrum Luo Baici green muscardine fungus (being denoted as MAA) conidium spore suspension is prepared simultaneously.Wild type MAA is inoculated with
In being cultivated on PDA plate.When cultivating 14 days, it is mitogenetic that suitable wild type wide spectrum Luo Baici green muscardine fungus MAA is scraped from PDA plate
Spore is filtered to remove mycelia with glass silk flosssilk wadding after the concussion that is vortexed, collects filter into the sterile water containing 0.05%Tween-20 of 1mL
Liquid.12000rpm is centrifuged after 3min with the sterile washing of Tween-20 2 times, is counted after resuspension with blood counting chamber, and by wild type
Obligate bacterium locust green muscardine fungus MAA spore suspension, which is transferred in every mL suspension, contains about 1.0 × 106Conidium, it is spare.
By the mitogenetic spore of AGL-1 bacterium solution and wild type wide spectrum Luo Baici green muscardine fungus MAA of the above-mentioned culture in IM culture medium
Sub- each 100 μ L of suspension, which is mixed evenly, to be coated on IM culture medium flat plate.After co-culturing 48h, with sterile water washing coculture, use
M-100 culture medium containing cephalothin and phosphine oxamate is protected from light culture 7-10 days to be occurred to resistant clones, and after dividing monospore, preservation has
The fungal tissue of resistance is spare.It extracts resistant fungal tissue genome and verifies transformant with specific primer PCR.
3. fungal gene group is verified
Use the genome of full formula gold Plant Tissue PCR Kit (AD301) kit verifying transformant.
The above-mentioned resistant fungal tissue of picking, vortex is mixed or is blown with pipettor after 40 μ L PD1Buffer are added
It beats.It is incubated for 10min (preheated equipment in advance) in 95 DEG C of metal baths, 40 μ L PD2Buffer are added later, it can be direct after mixing
PCR verifying is carried out as template.It is confirmed as successfully being transferred to the fungal tissue for knocking out plasmid after sequence verification.
It will successfully be transferred to and knock out the fungal tissue of plasmid and be inoculated into PDA culture medium, culture is to growing conidium.By spore
Son is linked into SDB culture medium, and 28 DEG C, 180rpm, after being protected from light culture 3 days, after collected by suction mycelia, with liquid nitrogen grinding mycelia
Trizol is added in body later, extracts RNA, and reverse transcription is progress PCR after cDNA template.Made in this experiment with the expression of Tublin
For reference, specific the primer is as follows:
MAA_03753-ORF-F:CAAGCTGGGCTACTACTCA (as shown in SEQ ID NO:6)；
MAA_03753-ORF-R:AAGCATCAATAACCTCCCTC (as shown in SEQ ID NO:7)；
Tublin-F:GATCTTGAACCTGGCACCAT (as shown in SEQ ID NO:8)；
Tublin-R:CCATGAAGAAGTGCAGACGA (as shown in SEQ ID NO:9)；
PCR system is as follows:
1% agarose gel electrophoresis of gained PCR product, experimental result are as shown in Figure 2.In Fig. 2, the first swimming lane is
Marker, the tublin that the second swimming lane is wild type MAA are expressed, the tublin for the knockout plasmid that third swimming lane is MAA_03753
Expression, the 4th swimming lane are the expression of the monoamine oxidase of wild type MAA_03753, and the 5th swimming lane is the MAA_ for knocking out plasmid
The expression of 03753 monoamine oxidase.As shown in Figure 2, the MAA_03753 for knocking out plasmid does not express monoamine oxidase, instruction sheet
The gene order of amine oxidase has been knocked, and above-mentioned resistant fungi is that recombined broad spectrum Luo Baici green muscardine fungus MAA (is denoted as
MAA-KO writes a Chinese character in simplified form KO).It is passed to China Committee for Culture Collection of Microorganisms's common micro-organisms center and carries out preservation, protect
Hiding number is CGMCC No.14152.
The measurement of tryptamines content in 2 recombined broad spectrum Luo Baici green muscardine fungus of embodiment
The obligate bacterium locust green muscardine fungus (being denoted as MAC) of recombination MAA-KO and wild type that will be screened in wild type MAA, embodiment 1
It cultivates on PDA plate respectively.After culture 15 days, by wild type MAA, recombinate MAA-KO and MAC spore point be inoculated into containing
It (preparation of the liquid of haemolymph of migratory locusts: is added in the L15 culture medium of every 1mL fresh in the L15 culture medium of the liquid of haemolymph of migratory locusts
200 μ L of liquid of haemolymph, with 0.22 μm of membrane filtration.Above-mentioned prepare is added in every milliliter of L15 culture medium when cultivating mycelia
100 μ L of liquid of haemolymph), be protected from light in incubator and cultivate 6 days at 28 DEG C, collect mycelia later, and use ddH2O washes away culture medium two
It is secondary, -20 DEG C of freeze-dryings later.Mycelia after weighing the drying of 1mg is cracked, grinding with the perchloric acid of 100 μ L 0.1M,
5200g, takes supernatant after being centrifuged 30min, and use Na by 4 DEG C2CO3It neutralizes, makes pH value 6 or so, supernatant is taken to be filtered with 0.22 μm of micropore
Film filtering, it is spare.HPLC detects the content of tryptamines in supernatant.
HPLC detection:
Agilent 1100, G1315A fluorescence detector (FLD), chromatographic column are C18 column；
Mobile phase A: [0.05M acetic acid solution/tetrahydrofuran (96/4)]: methanol (V:V) is 60:40.Mobile phase B is first
Alcohol.
Injection procedure:
A (in%): 75.00 (0min), 75.00 (8min), 66.67 (12min), 50.00 (25min), 0 (30min),
66.67 (35min), 75.00 (40min)；
B (in%): 25.00 (0min), 25.00 (8min), 33.33 (12min), 50.00 (25min), 100 (30min),
33.33 (35min), 25.00 (40min).
The preparation of sample:
Configure the borate buffer (pH 10.2) of 0.4N；
Derivatization reagent o-phthalaldehyde (OPA) 1mg is dissolved in the methanol of 100 μ L, 900 μ L are added until completely dissolved
0.4N borate buffer, be then added 10 μ L 3- mercaptopropionic acid (3-MPA) prepare mixed liquor H.
Mixed liquor H is uniformly mixed sample introduction with wild type MAA, recombination MAA-KO and MAC supernatant respectively.Sample volume is
0.5μL.Experimental result is as shown in Figure 3A.
From in Fig. 3 A as can be seen that the concentration of the tryptamines in wild type MAA is 34.47ng/mg, the tryptamines in MAC it is dense
Degree be 85.07ng/mg, recombinate MAA-KO in tryptamines concentration be 84.53ng/mg, recombinate MAA-KO in the tryptamines in MAC
Concentration there was no significant difference (being a), and there are significant difference (respectively a and b) with wild type MAA, it is seen that embodiment 1
Monoamine Oxidases Gene in the recombination MAA-KO of screening has been knocked, and can significantly improve the concentration of tryptamines.
The obligate bacterium locust green muscardine fungus (being denoted as MAC) of recombination MAA-KO and wild type that will be screened in wild type MAA, embodiment 1
Spore infect migratory locusts respectively, migratory locusts liquid of haemolymph is taken after 4 days, tryptamines content therein is measured, is denoted as MAA-4d, MAC- respectively
4d, KO-4d.Using no infected normal migratory locusts liquid of haemolymph as control, it is denoted as CK.Its experimental result such as Fig. 3 B institute
Show.
It is 32.11pg/ul from the concentration that can be seen that tryptamines in control group CK in Fig. 3 B, the tryptamines in the MAA of wild type
Concentration be 152.67pg/ul, the concentration of the tryptamines in MAC is 266.89pg/ul, and the concentration for recombinating the tryptamines in MAA-KO is
247.02pg/ul.Recombinate in MAA-KO that there was no significant difference (being a) with the concentration of the tryptamines in MAC, and with wild type MAA
There are significant difference (respectively a and b), and there is also significant difference (respectively a and c) with control group, it is seen that embodiment 1
After the recombination MAA-KO infection migratory locusts for being knocked Monoamine Oxidases Gene of screening, the intracorporal tryptamines content of migratory locusts can be made
It dramatically increases, reaches the level equivalent with obligate bacterium MAC, be significantly higher than the metainfective content of wild type MAA and control group
Tryptamines content.
3 tryptamines of embodiment influences the detection that ROS is generated
By three days after the emergence migratory locusts male worms that live scattered it is random be equally divided into three groups, be respectively labeled as control group Ck-4d, open country
Raw type group MAA-4d and recombinant type mutation group KO-4d, control group are infected without processing, wild type group with wild type MAA,
Mutation group is infected with the MAA-KO screened in embodiment 1, takes migratory locusts liquid of haemolymph in the L15 culture medium of 500 μ L after 4 days
In, Quick spin, 300rpm, 4 DEG C, supernatant is outwelled in centrifugation after ten minutes, and addition is (red glimmering containing 0.1 μM of Mitosox Red
Light probe) L15 culture medium 500 μ L, after 37 DEG C are protected from light and are incubated for 10min, supernatant is removed in centrifugation, after having hanged cell with L15 culture medium
Upper machine.
Detector: Beckman CytoFLEX；
Sense channel: PE；
8000 cells are collected, fluorecyte proportion is counted.Experimental result is as shown in Figure 4.
Figure 4, it is seen that blank control Ck-4d fluorescence labeled cell quantity is fluorescence mark in 52.02%, MAA-4d
Remember that cell quantity is 68.38%, recombinating fluorescence labeled cell quantity in KO-4d is 78.99%, knocks out the recombination of monoamine oxidase
The intracorporal ROS cell of migratory locusts of MAA-KO infection is significantly higher than the intracorporal ROS cell of the migratory locusts infected by wild type MAA.
The measurement of 4 recombined broad spectrum Luo Baici green muscardine fungus insecticide efficiency of embodiment
The obligate locust green muscardine fungus MAA of wild type and recombined broad spectrum bacterium Luo Baici green muscardine fungus (MAA-KO) are inoculated in PDA respectively
It is cultivated on culture medium, scrapes the spore of MAA and MAA-KO respectively, be separately added into suitable peanut oil suspension spore, be vortexed concussion,
Spore is collected after being filtered with glass silk floss, is resuspended with peanut oil.It is counted under the microscope using cell counting board, by repeatedly weighing
Outstanding and counting, makes final concentration of 1 × 106Spore/ml.The spore suspension drop of 2 μ L is drawn after emergence 3 days Asiatic migrotory locusts that live scattered
Under the carapace plate of male worm, infected using peanut oil processing and wild type broad spectrum of bacteria Luo Baici green muscardine fungus (MAA) spore as control.Often
12 hour record death borer populations.Median lethal time (LT50) finally is obtained with 20.0 software statistics of SPSS, compares wild type and is turned
Change the insecticidal toxicity of bacterial strain.Its experimental result is specifically shown in Fig. 5.
As shown in figure 5, wild type wide spectrum Luo Baici green muscardine fungus (MAA) to the median lethal times of migratory locusts be 7.33 ±
0.445d, the recombined broad spectrum bacterium locust green muscardine fungus (MAA-KO) after knocking out Monoamine Oxidases Gene are to the median lethal time of migratory locusts
6.136±0.488d.Illustrate to knock out the virulence that Monoamine Oxidases Gene improves wide spectrum Luo Baici green muscardine fungus.
Tryptamines can regulate and control the behavior and metabolism of the insects such as migratory locusts.The present embodiment knocks out wide spectrum by changing metabolic gene
Monoamine metabolic enzyme gene in bacterium Luo Baici green muscardine fungus destroys the metabolic pathway of tryptamines, tryptamines is made to exist to reduce the expression of the enzyme
It is accumulated in thallus, to significantly improve the insecticide efficiency of wide spectrum Luo Baici green muscardine fungus.
The median lethal time LT50 of recombined broad spectrum Luo Baici green muscardine fungus was shortened to from 7.33 ± 0.445 days in the present embodiment
6.136 ± 0.488 days, significantly improve the insecticide efficiency of wide spectrum Luo Baici green muscardine fungus.Without the extraneous gene of introducing, the wide spectrum of recombination
Luo Baici green muscardine fungus environmental sound, biological safety are good.
To improve fungi (such as wide in the embodiment of the present invention by knocking out the Monoamine Oxidases Gene of tryptamines metabolism by the present invention
Spectrum Luo Baici green muscardine fungus) in vivo the concentration of tryptamines and enhance the method for fungal farm chemicals insecticide efficiency.According to the principle, can also pass through
Other approach improve insect (such as migratory locusts) itself internal tryptamines concentration to improve insecticide efficiency.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all in essence of the invention
Within mind and principle, made any modification, equivalent replacement etc. be should all be included in the protection scope of the present invention.
<110>Institute of Zoology, Academia Sinica
<120>recombined broad spectrum green muscardine fungus and its preparation method and application
<130> 2017
<160> 9
<170> PatentIn version 3.3
<210> 1
<211> 1419
<212> DNA
<213> Metarhizium robertsii MAA
<400> 1
atggcgacaa cccaaatcga caacttggac gttgtaatag ttggagctgg cctaagcggt 60
ctccgagcag caagagaaat acacgccgca ggcctgaaat atgttgtcct ggaagctatg 120
gaccgcgtgg gcggcaagac gctctcggtt cctgcatcat ccaagggcac tggcgttgta 180
gacctgggcg cggcttggat caacgataca aaccagtctg aaatgtattc gttagcccaa 240
gaattcagct ttgatctcgt caagcaacga gatgaagggg actcagtggt cagagcccca 300
gatggcaaaa ttgacaaggt tccctacgga atgctggcaa aattggagcc agaacaactc 360
gagcggctca tgcatcttct acaaaagatc ggagagcttg ccgagaaaag caataccagc 420
gatcctagcc tcacacccaa cgcagagaca ctcgactcgg tgtcgctgca cgattttgtg 480
gcagacaagt tcaaaaacga ggatgcaaac actctcgtga acgagctggt caaggcactt 540
gtggggttgg aaagcagcta tcccagcgca ttgtactttc tggacaccat caagcgcgca 600
gccggacttg caaacatgat ttctgatggg aagaacgggg ggcagtacct acgaaaccgc 660
caaggaaacc agggtttcag cgttgaaata gaacgagggt tgacacccgg tgccgtcaaa 720
ctctccagcc cagtcacgag cattacccag tccgccacag gatgcgtcgt cgaatccaaa 780
accggggaca aatacacggc caagaaagtc atcatgtccc ttccaagctg tctcctcccc 840
actgtccaat tctcccccgg gctgccacag cccaagcggc ttctcagcca atccaccaag 900
ctgggctact actcaaagac aattcttgta tttgcagaac cgtggtggct tgccgccgac 960
ctatcggggg tatacacgtc tactggtact gcgatttcct tcacgcggga tacttgtgtc 1020
cctgaagatg gccaatacag cattacgtgc tttcacacgg gagagacggg gcgctcctgg 1080
tctcgtttgt ccgcggagga gaggcggacc gccgtgctcg cggaattcaa gacggcgttt 1140
gaaaccgcga tgggggaggg gattcccgat cccgtcaacg tcatcgagaa ggagtggaca 1200
aaagacccct ggacattggg tgcgcctagt cccgtgatgc ctcctgggct gcttacaagc 1260
gaggcgggca aggcactgta tgagccgttt cggaacattc actttgttgg gacggagacg 1320
gcggatgtgt ggagggggta tatggagggc gcggttcgtt ctggacttcg gggcgcgagg 1380
gaggttattg atgctttggg gggctcgtcc acacgttag 1419
<210> 2
<211> 34
<212> DNA
<213> Artificial
<220>
<223> MAA_03753Fs
<400> 2
attcctgcag cccgggatgg cgacaaccca aatc 34
<210> 3
<211> 36
<212> DNA
<213> Artificial
<220>
<223> MAA_03753Rs
<400> 3
cgacggatcc cccggggtgt caaccctcgt tctatt 36
<210> 4
<211> 36
<212> DNA
<213> Artificial
<220>
<223> MAA_03753Fx
<400> 4
gatctgatga actagtgttt cggaacattc actttg 36
<210> 5
<211> 35
<212> DNA
<213> Artificial
<220>
<223> MAA_03753Rx
<400> 5
ccgctctaga actagtcggg caagattccg ttcgt 35
<210> 6
<211> 19
<212> DNA
<213> Artificial
<220>
<223> MAA_03753-ORF-F
<400> 6
caagctgggc tactactca 19
<210> 7
<211> 20
<212> DNA
<213> Artificial
<220>
<223> MAA_03753-ORF-R
<400> 7
aagcatcaat aacctccctc 20
<210> 8
<211> 20
<212> DNA
<213> Artificial
<220>
<223> Tublin-F
<400> 8
gatcttgaac ctggcaccat 20
<210> 9
<211> 20
<212> DNA
<213> Artificial
<220>
<223> Tublin-R
<400> 9
ccatgaagaa gtgcagacga 20
Claims (14)
1. recombined broad spectrum green muscardine fungus, lowers the expression of monoamine oxidase or do not express or the content of its internal tryptamines is high
In wild type broad spectrum activity green muscardine fungus, the recombined broad spectrum green muscardine fungus is its bacterial strain itself, offspring, its conidium generated
Or its generate mycelium or any combination between them.
2. recombined broad spectrum green muscardine fungus as described in claim 1, for recombination broad spectrum of bacteria Luo Baici green muscardine fungus
(Metarhizium robertsii) or broad spectrum of bacteria Metarhizium anisopliae (Metarhizium anisopliae).
3. recombined broad spectrum green muscardine fungus as claimed in claim 1 or 2, for recombination broad spectrum of bacteria Luo Baici green muscardine fungus
(Metarhizium robertsii), deposit number are CGMCC NO.14152.
4. a kind of insecticide comprising recombined broad spectrum green muscardine fungus of any of claims 1-3 or the recombination are wide
The offspring of spectrality green muscardine fungus or its conidium generated or its mycelium generated or any combination between them, and
Optionally, acceptable carrier in Pesticide Science.
5. insecticide as claimed in claim 4, be used to prevent and treat one or more of following pest: pine moth, corn borer,
Grub, locust, colorado potato bug, Monochamus alternatus Hope, ant, tea lesser leafhopper, small heart-eating peach worm, mosquito, aphid.
6. the offspring of recombined broad spectrum green muscardine fungus of any of claims 1-3 or the recombined broad spectrum green muscardine fungus,
Its generate conidium or its generate mycelium or any combination between them preparing the purposes in insecticide.
7. purposes as claimed in claim 6, the purposes is to prepare the purposes in the insecticide for killing locust.
8. purposes as claimed in claims 6 or 7, the insecticide also includes the other active components for killing locust.
9. purposes as claimed in claim 8, the other active components are selected from destruxins, pyrethroid, amidocarbonic acid
Ester, anabasine acid, neuronal sodium channel blockers agent, the huge cyclic lactone of insecticidal, gaba GABA antagonist, diflubenzuron and
Group composed by d ichlorbenzuron.
10. the preparation method of recombined broad spectrum green muscardine fungus, including raising and/or increasing the intracorporal tryptamines of recombined broad spectrum green muscardine fungus
Step.
11. preparation method as claimed in claim 10, including by genetic recombination, knock out or monoamine oxidase phase is expressed in transformation
The nucleotide sequence of pass and lower the expression of monoamine oxidase or do not express.
12. preparation method as claimed in claim 11, recombined broad spectrum green muscardine fungus is related by knocking out expression monoamine oxidase
Nucleotide sequence and express that monoamine oxidase not comprising following steps:
The upstream sequence and downstream sequence for expanding monoamine oxidase nucleotide sequence in wild type broad spectrum activity green muscardine fungus respectively, will expand
Increase later upstream sequence and downstream sequence seamless connection.
13. the amplification later upstream sequence and downstream sequence are seamlessly connected by preparation method as claimed in claim 12
Onto Bar gene.
14. a kind of method for killing locust, including recombined broad spectrum green muscardine fungus described in any one of using claim 1-3 or
The offspring of the recombined broad spectrum green muscardine fungus or its conidium generated or its mycelium generated or claim 4 or 5
Described in insecticide the step of.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711031622.0A CN107916232B (en) | 2017-10-27 | 2017-10-27 | Recombined broad spectrum green muscardine fungus and its preparation method and application |
| PCT/CN2017/109850 WO2019080167A1 (en) | 2017-10-27 | 2017-11-08 | Recombinant broad-spectrum metarhizium anisopliae, preparation method therefor and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711031622.0A CN107916232B (en) | 2017-10-27 | 2017-10-27 | Recombined broad spectrum green muscardine fungus and its preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107916232A CN107916232A (en) | 2018-04-17 |
| CN107916232B true CN107916232B (en) | 2019-07-02 |
Family
ID=61895802
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711031622.0A Active CN107916232B (en) | 2017-10-27 | 2017-10-27 | Recombined broad spectrum green muscardine fungus and its preparation method and application |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN107916232B (en) |
| WO (1) | WO2019080167A1 (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109913378B (en) * | 2019-03-19 | 2021-06-15 | 中国科学院动物研究所 | Recombinant broad-spectrum metarhizium anisopliae and application thereof in promoting plant root growth |
| CN112410346B (en) * | 2020-11-30 | 2023-07-25 | 中国计量大学 | Method for improving biocontrol fungus insecticidal toxicity |
| CN114480436B (en) * | 2022-01-26 | 2023-11-03 | 苏州科技大学 | Method, strain and application for improving insecticidal toxicity of destruxins of Metarrhizium anisopliae |
| CN115152797B (en) * | 2022-08-03 | 2024-06-21 | 广州毅田生物技术有限公司 | Tea longicorn prevention and treatment medicament and application method thereof |
| CN117209574B (en) * | 2023-07-28 | 2024-03-29 | 中国科学院动物研究所 | High-toxicity destruxin for transformation of locust pests, and preparation method and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101755050B (en) * | 2007-05-18 | 2013-11-20 | 中国科学院上海生命科学研究院 | Polynucleotide sequences encoding scorpion toxin and transformed insecticidal fungi |
| CN104073441A (en) * | 2013-12-06 | 2014-10-01 | 江西天人生态股份有限公司 | Metarhizium acridum and application thereof |
| CN104357475A (en) * | 2014-10-14 | 2015-02-18 | 山东师范大学 | Metarhizium anisopliae transgenic strain as well as preparation method and application thereof |
| CN105176993A (en) * | 2015-10-20 | 2015-12-23 | 夏玉先 | Nucleic acid molecule, carrier and applications of nucleic acid molecule and carrier in improvement of sporulation ratio, sporulation quantity and anti-ultraviolet capability of metarhizium anisopliae |
| CN106367356A (en) * | 2016-09-22 | 2017-02-01 | 江西天祥通用航空股份有限公司 | Fermentation production method of locust green muscardine fungus, and green muscardine fungus solid culture medium |
-
2017
- 2017-10-27 CN CN201711031622.0A patent/CN107916232B/en active Active
- 2017-11-08 WO PCT/CN2017/109850 patent/WO2019080167A1/en active Application Filing
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101755050B (en) * | 2007-05-18 | 2013-11-20 | 中国科学院上海生命科学研究院 | Polynucleotide sequences encoding scorpion toxin and transformed insecticidal fungi |
| CN104073441A (en) * | 2013-12-06 | 2014-10-01 | 江西天人生态股份有限公司 | Metarhizium acridum and application thereof |
| CN104357475A (en) * | 2014-10-14 | 2015-02-18 | 山东师范大学 | Metarhizium anisopliae transgenic strain as well as preparation method and application thereof |
| CN105176993A (en) * | 2015-10-20 | 2015-12-23 | 夏玉先 | Nucleic acid molecule, carrier and applications of nucleic acid molecule and carrier in improvement of sporulation ratio, sporulation quantity and anti-ultraviolet capability of metarhizium anisopliae |
| CN106367356A (en) * | 2016-09-22 | 2017-02-01 | 江西天祥通用航空股份有限公司 | Fermentation production method of locust green muscardine fungus, and green muscardine fungus solid culture medium |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2019080167A1 (en) | 2019-05-02 |
| CN107916232A (en) | 2018-04-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107916232B (en) | Recombined broad spectrum green muscardine fungus and its preparation method and application | |
| CN109825457B (en) | Salt-tolerant bacillus E40207a2 and application thereof | |
| CN109777743B (en) | Entomogenous fungus strain SB009 with high pathogenic capability to bemisia tabaci and application thereof | |
| CN107873052B (en) | Compositions and methods for pest control management | |
| CN107299105A (en) | Watermelon blight bacteria pathogenic FonAGL3 genes, its missing DNA fragmentation, deletion mutant and its application | |
| CN105838642B (en) | A kind of actinomyces of cure plant disease of peanut and its application | |
| CN112438277B (en) | Xylariaceae fungus sj18 and application thereof in prevention and treatment of pine wood nematodes | |
| CN105670938B (en) | It is a kind of kill holotrichia oblita beauveria bassiana and its application | |
| Kulshrestha et al. | Biology and control of Rosellinia necatrix causing white root rot disease: a review | |
| Yang et al. | Effects of the entomopathogenic fungus Clonostachys rosea on mortality rates and gene expression profiles in Diaphorina citri adults | |
| CN104651319A (en) | Fusarium graminearum low-toxicity virus FgHV2/JS16 and application thereof | |
| CN109136101B (en) | Fungus strain and application thereof | |
| KR101185843B1 (en) | Formulation for controlling vegetable soft rot containing bacteriophage PPP1 | |
| Yan et al. | Identification of the interacting proteins of Bambusa pervariabilis× Dendrocalamopsis grandis in response to the transcription factor ApCtf1β in Arthrinium phaeospermum | |
| AU2020100601A4 (en) | Recombinant broad-spectrum Metarhizium and production method and application thereof | |
| CN110759983A (en) | Recombinant fungus expressed by targeted silent pest pattern recognition protein GNBP3 gene and application thereof in pest control | |
| CN108239620A (en) | The mdck cell strain of 1 encoding gene of IFN-β missing and its construction method and application | |
| CN105713857A (en) | Atrazine degrading bacterium and application thereof | |
| CN109971654A (en) | Common big thrips biocontrol microorganisms gradually narrow Lecanicillium lecanii SCAUDCL-53 and its application | |
| Gao et al. | Molecular and physiological characterization of Arabidopsis–Colletotrichum gloeosporioides pathosystem | |
| CN107502562A (en) | Recombinate locust green muscardine fungus and its preparation method and application | |
| CN104109637A (en) | Genetic recombinant Isaria fumosorosea If01 GM and application thereof | |
| CN110055182B (en) | Entomogenous fungus strain SP433 with high pathogenic capability to bemisia tabaci and application thereof | |
| CN113621620A (en) | Gene with function of regulating and controlling immunity of plutella xylostella and preparation method and application thereof | |
| KR101377808B1 (en) | Fungi for biological control by transmission of Fusarium graminearum virus 1-DK21 and method for biological control using thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |