CN109913378B

CN109913378B - Recombinant broad-spectrum metarhizium anisopliae and application thereof in promoting plant root growth

Info

Publication number: CN109913378B
Application number: CN201910205553.3A
Authority: CN
Inventors: 王云丹; 童希文; 康乐
Original assignee: Institute of Zoology of CAS
Current assignee: Institute of Zoology of CAS
Priority date: 2019-03-19
Filing date: 2019-03-19
Publication date: 2021-06-15
Anticipated expiration: 2039-03-19
Also published as: CN109913378A; WO2020186817A1

Abstract

The invention relates to a recombinant broad-spectrum metarhizium anisopliae and application thereof in promoting plant root growth, belonging to the technical field of agricultural biology. The recombinant broad-spectrum metarhizium anisopliae expresses the monoamine oxidase which is down-regulated or does not express the monoamine oxidase, and can promote the growth of plant roots.

Description

Recombinant broad-spectrum metarhizium anisopliae and application thereof in promoting plant root growth

Technical Field

The invention relates to a recombinant fungus, a preparation method and application thereof, in particular to a recombinant broad-spectrum metarhizium anisopliae capable of improving the production of tryptamine and application thereof in promoting the growth of plant roots.

Background

The chemical fertilizer is used in farmland in large quantity to provide nutrients needed by crops in the early stage, but can cause soil acidification, uneven fertility and underground water source pollution. The microbial fertilizer can replace part of chemical fertilizer to solve the problem of soil degradation caused by long-term application of chemical fertilizer. Microbial fertilizers can be divided into five major categories according to the microbial species: bacterial fertilizers (such as rhizobium fertilizer, azotobacter fertilizer, phosphate solubilizing bacterial fertilizer, potassium solubilizing bacterial fertilizer and photosynthetic bacterial fertilizer); ② actinomycete fertilizer (such as antibiotic fertilizer); thirdly, fungus fertilizer (mycorrhizal fungus fertilizer, including ectomycorrhizal fungus agent and endophytic fungus agent); algae fertilizer (such as nitrogen-fixing blue algae bacterial fertilizer); compound microbial fertilizer, i.e. the fertilizer is formed by combining more than two microbes according to a certain proportion. Non-limiting examples of microbial isolates that can directly promote plant growth and/or yield include the azotobacteria (Rhizobium) and the Bradyrhizobium (Bradyrhizobium) species, which, through symbiotic nitrogen fixation, can form nodules in the roots of legumes where they can bind atmospheric N₂Conversion to ammonia, with atmospheric N₂Instead, ammonia can be used by plants as a nitrogen source. Other examples include the Azospirillum species, which is an independently living azotobacter, that can fertilize and increase the yield of grain crops such as wheat, sorghum, and corn. Despite the nitrogen-fixing capacity of azospirillum, the increased yield resulting from the inoculation of azospirillum is often still due to an increased development of the root system and thus to an increased rate of water and mineral uptake. In this regard, several rhizobacteria such as Azotobacter spp) have been reported to be capable of producing various plant hormones (e.g., auxins, cytokinins) and enzymes (e.g., pectinases). Many of these plant hormones and enzymes have been shown to be intimately involved in bacterial-plant co-involvement with regulatory effects on nodulation by rhizobiaThe infectious process of raw combinations.

Metarhizium fungi are widely applied biological insecticides, and compared with chemical insecticides, the metarhizium fungi have the advantages of environmental friendliness, strong stress resistance, capability of large-scale diffusion, high selectivity and the like. At present, more than 200 agricultural and forestry pests can be harmed by the metarhizium anisopliae preparation. The use thereof for promoting the growth of plant roots has not been reported in the art.

Disclosure of Invention

The inventor surprisingly found that the recombinant broad-spectrum Metarrhizium anisopliae with the expression of the monoamine oxidase or without the expression of the monoamine oxidase which is down-regulated can promote the growth of plant roots. Thus, the present invention has been accomplished

In one embodiment, the present invention provides the use of a recombinant broad spectrum metarhizium anisopliae for promoting plant root growth, wherein the recombinant broad spectrum metarhizium anisopliae does not express or expresses a down-regulated monoamine oxidase. The recombinant broad-spectrum metarhizium anisopliae is the strain per se, descendants thereof, conidia generated by the strain, or mycelia generated by the strain, or any combination of the descendants and the conidia.

In one embodiment, the expression of monoamine oxidase in the recombinant broad-spectrum Metarrhizium anisopliae provided by the invention is reduced by more than 50%. Preferably, the expression of monoamine oxidase in said recombinant broad spectrum Metarrhizium anisopliae is down-regulated by more than 60%, 70%, 80%, 90% or 95%, most preferably the expression of monoamine oxidase in said recombinant broad spectrum Metarrhizium anisopliae is down-regulated by 100%, i.e. no monoamine oxidase is expressed. The recombinant broad spectrum metarhizium anisopliae of the invention has increased in vivo tryptamine production relative to wild-type broad spectrum metarhizium robertz.

In one embodiment, the recombinant broad spectrum Metarhizium anisopliae of the present invention is a recombinant broad spectrum bacterium, Metarhizium robustsii (Metarhizium robertsii) or a recombinant broad spectrum bacterium, Metarhizium anisopliae (Metarhizium anisopliae). In a specific embodiment, the recombinant broad-spectrum Metarhizium anisopliae of the present invention is a recombinant broad-spectrum bacterium, i.e., Metarhizium robertsii (Metarhizium robertsii), which has a collection number of CGMCC NO.14152 and is classified and named as Metarhizium robertsii, and is deposited in the general microbiological center of China Committee for culture Collection of microorganisms (address: Beijing, Inward, Kyowa, No.1 Hosth, No. 3) at 29.8.2017, as disclosed in China invention patent CN 107916232.

In another aspect, the invention provides a microbial fertilizer, which comprises the recombinant broad-spectrum metarhizium anisopliae and an agricultural carrier. The agricultural carrier may be soil or a plant growth medium. Other agricultural carriers that may be used include water, fertilizers, vegetable oils, humectants, or combinations thereof. Alternatively, the agricultural carrier may be a solid, such as diatomaceous earth, loam, silica, alginate, clay, bentonite, vermiculite, pericarp, other plant and animal products or combinations, including granules, pellets or suspensions.

In one embodiment, the expression of monoamine oxidase is downregulated or made non-expressed by gene recombination, knock-out or alteration of the nucleotide sequence associated with the expression of monoamine oxidase.

In one embodiment of the present invention, the recombinant broad spectrum Metarrhizium anisopliae is prepared by knocking out a nucleotide sequence related to the expression of monoamine oxidase so as to make the monoamine oxidase not be expressed, and specifically comprises the following steps: respectively amplifying the upstream sequence and the downstream sequence of the monoamine oxidase nucleotide sequence in wild type broad spectrum Robertsonia (MAA), and seamlessly connecting the amplified upstream sequence and the amplified downstream sequence, preferably, seamlessly connecting the amplified upstream sequence and the amplified downstream sequence to the Bar gene or the Ben gene.

In the specific embodiment of the present invention, the type of plasmid is not limited as long as it contains the Bar gene (herbicide glufosinate resistance gene) and/or the Ben gene (benomyl resistance gene).

In a specific embodiment of the invention, a PDHt-Bar plasmid containing the Bar gene is selected, and the preparation method of the recombinant broad-spectrum Metarrhizium anisopliae specifically comprises the following steps:

primers, MAA _03753Fs and MAA _03753Rs, MAA _03753Fx and MAA _03753Rx, were designed to amplify their upstream and downstream sequences, respectively, using the genomic DNA of MAA as a template. After the amplified upstream and downstream sequences are cut by enzyme, the upstream and downstream sequences are respectively connected to the upstream and downstream of Bar in the PDHt-Bar plasmid in a seamless mode to form a recombinant plasmid. The recombinant plasmid is transferred into MAA by Agrobacterium tumefaciens mediated method.

In another aspect, provided herein is a method for increasing growth and/or yield of a plant. In some embodiments, such methods comprise applying an effective amount of a recombinant broad-spectrum metarhizium strain according to the invention or a culture thereof to the plant or to the surrounding environment of the plant. In some other embodiments, the method comprises growing the recombinant broad spectrum metarhizium strain or culture thereof according to the invention in a growth medium or soil of the host plant, followed or concurrent with host plant growth in said growth medium or soil. In a preferred embodiment, the plant is a crucifer. In a specific embodiment, the plant is selected from the group consisting of canola, arabidopsis, potato, red, ginger, onion, garlic, radish, carrot, leek, soybean.

The invention has the following advantages:

the recombinant broad-spectrum metarhizium anisopliae can obviously improve the concentration of tryptamine in spores of the metarhizium anisopliae and can promote the growth of plant roots. As a microbial fertilizer, the recombinant broad-spectrum metarhizium anisopliae is harmless to the environment, good in biological safety and nontoxic to human beings.

Drawings

FIG. 1 is a schematic structural diagram of a recombinant plasmid in an embodiment of the present invention;

FIG. 2 is an agarose gel electrophoresis of recombinant broad spectrum Metarhizium robustum according to an embodiment of the present invention;

FIG. 3 shows the tryptamine content in the hyphae of the recombinant broad-spectrum Robert Metarrhizium anisopliae and the tryptamine content in the migratory locust after the recombinant broad-spectrum Robert Metarrhizium anisopliae is infected with the migratory locust in the example of the present invention.

FIG. 4 shows the results of the growth of Arabidopsis thaliana root system by the recombinant broad-spectrum Metarrhizium robustum in the examples of the present invention.

Detailed Description

The technical solutions in the embodiments of the present invention are clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention. The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The invention is described in detail below with reference to specific examples, which are intended to be illustrative, but not limiting, of the invention.

Example 1 preparation of recombinant broad-spectrum Metarhizium robustum

In this embodiment, the monoamine oxidase gene (MAA _03753) in broad spectrum beauveria bassiana (MAA) is knocked out, the gene bank accession number of MAA _03753 is NW _011942171.1, and the monoamine oxidase [ EC:1.4.3.4], and the specific sequence is as shown in SEQ ID NO: 1 is shown. In this embodiment, the broad-spectrum Metarhizium robustum is not limited, and other broad-spectrum Metarhizium anisopliae having monoamine oxidase, such as Metarhizium anisopliae, may be used. The type of plasmid is not limited in this example, as long as it contains the Bar gene and/or the Ben gene. For example, the plasmid may be pDHt-Bar, or pDHt-Ben. The plasmid pDHt-Bar will be described below as an example.

Knockout plasmid construction of MAA _03753

Primers, MAA _03753Fs and MAA _03753Rs, MAA _03753Fx and MAA _03753Rx, were designed to amplify their upstream and downstream sequences, respectively, using genomic DNA of wild-type MAA as a template. SmaI and SpeI cleavage sites were added to the ends of the product, respectively. The specific primer sequences are as follows:

MAA _03753Fs (shown in SEQ ID NO: 2):

ATTCCTGCAGCCCGGGATGGCGACAACCCAAATC

MAA _03753Rs (shown in SEQ ID NO: 3):

CGACGGATCCCCCGGGGTGTCAACCCTCGTTCTATT

MAA-03753 Fx (shown in SEQ ID NO: 4):

GATCTGATGA3ACTAGTGTTTCGGAACATTCACTTTG

MAA-03753 Rx (shown in SEQ ID NO: 5):

CCGCTCTAGAACTAGTCGGGCAAGATTCCGTTCGT

the primer pair MAA _03753Fs and MAA _03753Rs were used to amplify the upstream sequence of monoamine oxidase to obtain 880bp fragment (labeled MAO-S). MAO-S was seamlessly ligated upstream of Bar in the PDHt-Bar plasmid after a single cleavage with SmaI (as shown in FIG. 1).

The downstream sequence of monoamine oxidase was amplified with the pair of primers MAA-03753 Fx and MAA-03753 Rx to amplify a 646bp fragment (labeled MAO-X). MAO-X was seamlessly ligated to The PDH-Bar plasmid (provided by Shanghai institute for Biochemical and physiological sciences, see in particular, Yixiong Chen, Zhibin Duan, Beilin Chen, Yanfang Shang & Chengshu Wang, The Bax inhibitor MrBI-1 regulation of The fat company, adaptive-like Cell death, and viral in Metarrhizium roberts, Scientific ports 5, particle number:10625(2015), and Wei Huang, Yanfang Shang Shanlin, Beilin, Kai Cen and Xiangshu Wang, Basic Leuche Zipper (bZIP) Domain transfer Factor Z1 expression, supplement, spread, plasma additive and molecular electronics 8218, as shown in FIG. 8213, Journal of Cell 8213, Biological 8213, by SpeI Single enzyme digestion. Thus, the 580bp fragment in the middle of MAA-03753 was replaced by a Bar sequence of 938bp in length.

The mixture of the PCR reactions was: 2.5 u L10 x Ex Taq Buffer polymerase Buffer solution, 2u L2.5 mM dNTP, 10 u M upstream and downstream primers of 1 u L, 1 u L template, 0.25 u L Takara Ex Taq DNA polymerase, adding ultrapure water to the total volume of 25L;

and (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 5min, 94 ℃ for 30sec, 54 ℃ for 30sec, 72 ℃ for 1min (35 cycles); finally, extension is carried out for 10min at 72 ℃. And (3) carrying out electrophoresis on the PCR reaction product by using agarose gel with the mass fraction of 1.0%, and then recovering the product by using a gel recovery kit.

Enzyme digestion system: mu.L of 10 Xcutmarst buffer, 1. mu.g of plasmid DNA, 1. mu.L of endonuclease (NEB), complement ddH₂O to 50. mu.L.

Seamless connection: clone

IIOne Step Cloning Kit(Vazyme)

4 μ L of 5 XBuffer, 2 μ L of ExnaseII, vector amount 0.02 Xvector base number ng, insert amount 0.04 Xinsert base number ng, remainder H₂O was supplemented to 20. mu.L, and the cells were incubated at 37 ℃ for 30min before transformation.

2. Construction of engineering strains:

the amplified upstream sequence and downstream sequence were inserted into the vector PDHt-Bar, respectively, and confirmed as successfully constructed knock-out vectors after sequencing validation (as shown in fig. 1). The knockout plasmid was then transferred into MAA using Agrobacterium tumefaciens mediated method.

Agrobacterium Tumefaciens Mediated Transformation (ATMT) construction of a fungal genetic transformation System: and transforming the obtained vector to agrobacterium AGL-1, selecting a positive agrobacterium AGL-1 transformation strain after PCR identification, and carrying out amplification culture on a YEB culture medium (containing 50mg/mL Carb and 50mg/mL Kan). The cells were collected and the OD resuspended in the appropriate amount of IM broth₆₆₀Culturing at 0.15 deg.C in dark at 28 deg.C to obtain bacterial liquid concentration OD₆₆₀Is 0.5-0.8.

Meanwhile, a wild type broad spectrum robertzschia destructor (marked as MAA) conidia suspension is prepared. Wild-type MAA was inoculated on PDA plates for culture. After culturing for 14 days, scraping a proper amount of wild broad-spectrum Metarhizium robustum MAA conidia from a PDA plate into 1mL of sterile water containing 0.05% Tween-20, vortex shaking, filtering with glass wool to remove hyphae, and collecting the filtrate. Centrifuging at 12000rpm for 3min, washing with Tween-20 sterile water for 2 times, resuspending, counting with a hemocytometer, and adjusting the suspension of wild-type MAA spores to about 1.0X 10/mL⁶Conidium, for use.

100. mu.L of each of the AGL-1 bacterial liquid cultured in the IM medium and the conidium suspension of the wild-type broad-spectrum Metarrhizium robustum MAA was mixed and uniformly spread on an IM medium plate. And after the co-culture is carried out for 48h, washing the co-culture with sterile water, carrying out light-proof culture for 7-10 days by using an M-100 culture medium containing the thielavine and the glufosinate-ammonium until resistant colonies appear, and preserving the resistant fungal tissues for later use after single spore separation. The resistant fungal tissue genome was extracted and transformants were verified by PCR using specific primers.

3. Fungal genome validation

The genome of the transformants was verified using the all-gold Plant Tissue PCR Kit (AD301) Kit.

The resistant fungal tissue was picked, added with 40. mu.L PD1Buffer and vortexed or pipetted. And (3) incubating in a metal bath at 95 ℃ for 10min (preheating the equipment in advance), adding 40 mu L of PD2Buffer, and uniformly mixing to directly serve as a template for PCR verification. After sequencing verification, the fungus tissue successfully transferred into the knockout plasmid is confirmed.

And (3) inoculating the fungus tissue successfully transferred into the knockout plasmid to a PDA culture medium, and culturing until conidia grow out. Inoculating spore into SDB culture medium, culturing at 28 deg.C and 180rpm in dark for 3 days, vacuum filtering to collect mycelium, grinding mycelium with liquid nitrogen, adding Trizol, extracting RNA, reverse transcribing to cDNA template, and performing PCR. In this experiment, the expression of Tublin was used as a reference, and the following primers were used:

MAA-03753-ORF-F: CAAGCTGGGCTACTACTCA (shown in SEQ ID NO: 6);

MAA-03753-ORF-R: AAGCATCAATAACCTCCCTC (shown in SEQ ID NO: 7);

Tublin-F: GATCTTGAACCTGGCACCAT (shown in SEQ ID NO: 8);

Tublin-R: CCATGAAGAAGTGCAGACGA (shown as SEQ ID NO: 9)

The PRC system is as follows:

the PCR product was electrophoresed on a 1% agarose gel, and the results of the experiment are shown in FIG. 2. In fig. 2, the first lane is marker, the second lane is tublin expression of wild-type MAA, the third lane is tublin expression of the knockout plasmid of MAA _03753, the fourth lane is expression of monoamine oxidase of wild-type MAA _03753, and the fifth lane is expression of monoamine oxidase of MAA _03753 of the knockout plasmid. As can be seen from FIG. 2, MAA _03753 of the knockout plasmid does not express monoamine oxidase, indicating that the gene sequence of monoamine oxidase has been knocked out, and the above-mentioned fungus with resistance is recombinant broad-spectrum Metarrhizium anisopliae (marked as MAA-KO, abbreviated as KO).

Example 2 determination of tryptamine content in recombinant broad-spectrum Metarhizium robustum

Wild-type MAA, the recombinant MAA-KO selected in example 1 and wild-type obligate fungus Metarhizium anisopliae (recorded as MAC) were cultured on PDA plates, respectively. Culturing in a dark incubator at 28 deg.C for 6 days, collecting mycelia, and culturing with ddH₂The medium was washed twice with O, and then lyophilized at-20 ℃. Weighing 1mg of dried mycelium, lysing with 100 μ L of 0.1M perchloric acid, grinding, 5200g, centrifuging at 4 deg.C for 30min, collecting supernatant, and adding Na₂CO₃Neutralizing to pH 6, collecting supernatant, and filtering with 0.22 μm microporous membrane. The content of tryptamine in the supernatant was checked by HPLC.

And (4) HPLC detection:

agilent 1100, G1315A fluorescence detector (FLD), the chromatographic column is C18 column;

mobile phase A: [ 0.05M acetic acid solution/tetrahydrofuran (96/4) ]: methanol (V: V) is 60: 40. the mobile phase B is methanol.

Sample introduction procedure:

A(in％)：75.00(0min)，75.00(8min)，66.67(12min)，50.00(25min)，0(30min)，66.67(35min)，75.00(40min)；

B(in％):25.00(0min)，25.00(8min)，33.33(12min)，50.00(25min)，100(30min)，33.33(35min)，25.00(40min)。

preparation of a sample:

preparing 0.4N boric acid buffer solution (pH is 10.2);

dissolving a derivatization reagent of o-phthalaldehyde (OPA)1mg in methanol 100. mu.L, adding 0.4N boric acid buffer solution 900. mu.L after complete dissolution, and then adding 3-mercaptopropionic acid (3-MPA) 10. mu.L to prepare a mixed solution H.

And (3) mixing the mixed solution H with the wild MAA, the recombinant MAA-KO and the MAC supernatant liquid respectively, and injecting the mixture. The amount of the sample was 0.5. mu.L. The results of the experiment are shown in FIG. 3A.

As can be seen from FIG. 3A, the concentration of tryptamine in the wild-type MAA is 34.47ng/mg, the concentration of tryptamine in the MAC is 85.07ng/mg, the concentration of tryptamine in the recombinant MAA-KO is 84.53ng/mg, and the recombinant MAA-KO has no significant difference (a) from the concentration of tryptamine in the MAC, but has significant difference (a and b respectively) from the wild-type MAA, so that the monoamine oxidase gene in the recombinant MAA-KO screened in example 1 is knocked out, which can obviously improve the concentration of tryptamine.

The wild MAA, the recombinant MAA-KO screened in the example 1 and the spores of the wild obligate strain Metarrhizium anisopliae (marked as MAC) are respectively infected with migratory locust, hemolymph of the migratory locust is taken after 4 days, and the tryptamine content in the hemolymph is measured and respectively marked as MAA-4d, MAC-4d and KO-4 d. Normal migratory locust hemolymph without infection was used as a control and was designated as CK. The experimental results are shown in fig. 3B.

As can be seen from FIG. 3B, the concentration of tryptamine in the control CK was 32.11pg/ul, the concentration of tryptamine in the wild-type MAA was 152.67pg/ul, the concentration of tryptamine in the MAC was 266.89pg/ul, and the concentration of tryptamine in the recombinant MAA-KO was 247.02 pg/ul. The concentration of tryptamine in the recombinant MAA-KO and the concentration of tryptamine in MAC are not significantly different (a), but are significantly different from wild MAA (a and b respectively), and are also significantly different from a control group (a and c respectively), so that after the migratory locust is infected by the recombinant MAA-KO which is screened in example 1 and is knocked out of the monoamine oxidase gene, the tryptamine content in the migratory locust can be significantly increased, the level of the tryptamine content is equal to that of the obligate bacterium MAC, and the content of the tryptamine content is significantly higher than that of the wild MAA and that of the control group.

Example 3 recombinant broad-spectrum Robertsonia destructor for promoting growth of plant root system

Respectively inoculating the wild MAA and the recombinant MAA-KO prepared in the above example on a PDA culture medium for culture, respectively scraping spores of the MAA and the MAA-KO, respectively adding a proper amount of peanut oil suspension spores, respectively, carrying out vortex shaking, filtering with glass silk floss, collecting the spores, and carrying out resuspension with peanut oil. Counting under microscope using cell counting plate, resuspending and counting several times to make final concentration 1 × 10⁶Spores/ml.

After 4-degree purification of arabidopsis thaliana, the arabidopsis thaliana is spotted on a culture medium (0.5 multiplied by MSP21), wherein the MSP21 culture medium does not contain nitrogen, and then the arabidopsis thaliana is placed in a climatic box, the temperature is kept at 21 ℃, and the day-night ratio is 16 hours: the plate was left at 30 degrees for 8 hours. When the plant grows two leaves, add the plant 2cm belowAdding 2uL of locust protein extract of 5 ug/uL. The control group was mixed with 2uL of L-15 medium, while the treatment group was mixed with 2uL of wild-type MAA and 1X 10 of recombinant MAA-KO⁶spores/mL fungal solution. After 14 days of culture at 30 degrees, the fresh weight, main root length and lateral root number of the plants were measured.

The results show that:

after co-cultivation of MAA and Arabidopsis, the plant root system was longer than that without co-cultivation of fungi, whereas after co-cultivation of MAA-KO with plants, the root length was longer than that of MAA co-cultivated plants and plants without co-cultivation of fungi (FIG. 4). After the plants and the MAA-KO are co-cultured, the weight of the whole plant and the number of lateral roots are obviously more than those of the plants which are not co-cultured with the fungus or are co-cultured with the MAA fungus, and the results show that the MAA-KO can obviously promote the growth of the plants.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and the like that are within the spirit and principle of the present invention are included in the present invention.

Sequence listing

<110> institute of animal research of Chinese academy of sciences

<120> recombinant broad-spectrum metarhizium anisopliae and application thereof in promoting plant root growth

<130> 2017

<160> 9

<170> PatentIn version 3.3

<210> 1

<211> 1419

<212> DNA

<213> Metarhizium robertsii MAA

<400> 1

atggcgacaa cccaaatcga caacttggac gttgtaatag ttggagctgg cctaagcggt 60

ctccgagcag caagagaaat acacgccgca ggcctgaaat atgttgtcct ggaagctatg 120

gaccgcgtgg gcggcaagac gctctcggtt cctgcatcat ccaagggcac tggcgttgta 180

gacctgggcg cggcttggat caacgataca aaccagtctg aaatgtattc gttagcccaa 240

gaattcagct ttgatctcgt caagcaacga gatgaagggg actcagtggt cagagcccca 300

gatggcaaaa ttgacaaggt tccctacgga atgctggcaa aattggagcc agaacaactc 360

gagcggctca tgcatcttct acaaaagatc ggagagcttg ccgagaaaag caataccagc 420

gatcctagcc tcacacccaa cgcagagaca ctcgactcgg tgtcgctgca cgattttgtg 480

gcagacaagt tcaaaaacga ggatgcaaac actctcgtga acgagctggt caaggcactt 540

gtggggttgg aaagcagcta tcccagcgca ttgtactttc tggacaccat caagcgcgca 600

gccggacttg caaacatgat ttctgatggg aagaacgggg ggcagtacct acgaaaccgc 660

caaggaaacc agggtttcag cgttgaaata gaacgagggt tgacacccgg tgccgtcaaa 720

ctctccagcc cagtcacgag cattacccag tccgccacag gatgcgtcgt cgaatccaaa 780

accggggaca aatacacggc caagaaagtc atcatgtccc ttccaagctg tctcctcccc 840

actgtccaat tctcccccgg gctgccacag cccaagcggc ttctcagcca atccaccaag 900

ctgggctact actcaaagac aattcttgta tttgcagaac cgtggtggct tgccgccgac 960

ctatcggggg tatacacgtc tactggtact gcgatttcct tcacgcggga tacttgtgtc 1020

cctgaagatg gccaatacag cattacgtgc tttcacacgg gagagacggg gcgctcctgg 1080

tctcgtttgt ccgcggagga gaggcggacc gccgtgctcg cggaattcaa gacggcgttt 1140

gaaaccgcga tgggggaggg gattcccgat cccgtcaacg tcatcgagaa ggagtggaca 1200

aaagacccct ggacattggg tgcgcctagt cccgtgatgc ctcctgggct gcttacaagc 1260

gaggcgggca aggcactgta tgagccgttt cggaacattc actttgttgg gacggagacg 1320

gcggatgtgt ggagggggta tatggagggc gcggttcgtt ctggacttcg gggcgcgagg 1380

gaggttattg atgctttggg gggctcgtcc acacgttag 1419

<210> 2

<211> 34

<212> DNA

<213> Artificial

<220>

<223> MAA_03753Fs

<400> 2

attcctgcag cccgggatgg cgacaaccca aatc 34

<210> 3

<211> 36

<212> DNA

<213> Artificial

<220>

<223> MAA_03753Rs

<400> 3

cgacggatcc cccggggtgt caaccctcgt tctatt 36

<210> 4

<211> 36

<212> DNA

<213> Artificial

<220>

<223> MAA_03753Fx

<400> 4

gatctgatga actagtgttt cggaacattc actttg 36

<210> 5

<211> 35

<212> DNA

<213> Artificial

<220>

<223> MAA_03753Rx

<400> 5

ccgctctaga actagtcggg caagattccg ttcgt 35

<210> 6

<211> 19

<212> DNA

<213> Artificial

<220>

<223> MAA_03753-ORF-F

<400> 6

caagctgggc tactactca 19

<210> 7

<211> 20

<212> DNA

<213> Artificial

<220>

<223> MAA_03753-ORF-R

<400> 7

aagcatcaat aacctccctc 20

<210> 8

<211> 20

<212> DNA

<213> Artificial

<220>

<223> Tublin-F

<400> 8

gatcttgaac ctggcaccat 20

<210> 9

<211> 20

<212> DNA

<213> Artificial

<220>

<223> Tublin-R

<400> 9

ccatgaagaa gtgcagacga 20

Claims

1. Use of recombinant metarhizium anisopliae for promoting root growth of a plant, wherein the recombinant metarhizium anisopliae expresses a down-regulated monoamine oxidase or does not express monoamine oxidase, wherein the recombinant metarhizium anisopliae is capable of significantly increasing the concentration of tryptamine in its spores, and wherein tryptamine is capable of promoting root growth of the plant, and wherein the plant is a crucifer plant.

2. The use of claim 1, wherein the recombinant broad spectrum Metarhizium anisopliae is a recombinant broad spectrum bacterium Metarhizium robusta (Metarhizium robertsii) or a recombinant broad spectrum bacterium Metarhizium anisopliae (Metarhizium anisopliae).

3. The use of claim 1 or 2, wherein the recombinant broad spectrum Metarhizium anisopliae is the recombinant broad spectrum bacterium Metarhizium robertsii (Metarhizium robertsii) with accession number CGMCC No. 14152.

4. The use of claim 1, wherein the recombinant broad spectrum Metarrhizium anisopliae promotes growth of a plant selected from the group consisting of: rape, Arabidopsis thaliana, or white radish.

5. Use of a recombinant broad spectrum Metarrhizium anisopliae as defined in any one of claims 1-3, or progeny of said recombinant broad spectrum Metarrhizium anisopliae, or conidia produced thereof or mycelium produced thereof, or any combination thereof, for the preparation of a microbial fertilizer for promoting the growth of plant roots, wherein said plant is a Cruciferae plant.

6. A method of promoting the growth of roots of plants comprising the step of applying a recombinant broad spectrum metarhizium anisopliae as defined in any one of claims 1 to 3, or progeny of said recombinant broad spectrum metarhizium anisopliae, or conidia produced therefrom or mycelia produced therefrom, or a microbial fertilizer as defined in claim 5, wherein said plants are cruciferous plants.