CN111876514A - Method for rapidly detecting gibberellin microspecies generated in rice bakanae disease - Google Patents

Abstract

A method for quickly detecting the generation of small gibberellin seeds in bakanae disease of paddy rice belongs to the technical field of plant disease control and plant pathogen detection. The method aims at Fusarium canum, Fusarium proliferatum, Fusarium pseudoverticillarum andF.andiyazidesigning specific primers according to the specific gene difference, performing multiple PCR amplification by using the specific primers and the DNA of a sample to be detected as a template, and judging the generation of the gibberellin microspecies in the rice bakanae bacteria according to the amplification result. The method is suitable for rapid and reliable detection and identification of rice bakanae disease, and can be used for detecting Fusarium graminearum, Fusarium proliferatum, Fusarium pseudoverticillarum and Fusarium graminearumF.andiyaziThe prevention and treatment of the rice bakanae disease caused by the rice bakanae disease have important practical application value.

Description

Method for rapidly detecting gibberellin microspecies generated in rice bakanae disease

Technical Field

The invention belongs to the technical field of plant disease control and plant pathogen detection, and particularly relates to a method for quickly detecting gibberellin-producing microspecies in bakanae disease of rice.

Background

Gibberellin (GA) is one of five major plant hormones, is a high-efficiency plant growth regulator, has multiple physiological functions on plant growth and development, and can regulate plant seed germination, stem leaf elongation, fruit development and the like. At present, 136 species of gibberellin substances have been found from plants, fungi and bacteria, most of which are present in higher plants, some of which are present in fungi or bacteria, and others of which are common to fungi and plants. Gibberellins are tetracyclic diterpenoid compounds whose basic backbone is composed of four isoprene units. Different gibberellins are formed due to differences in the number and position of double bonds, hydroxyl groups, and the presence or absence of a lactone ring. Gibberellins are classified into C19 and C20 according to the number of carbon atoms in the molecule. The former includes more species than the latter, and the physiological activity is higher than the latter. Among them, biologically active gibberellins include mainly GA1, GA3, GA4, GA7, and the like.

In fungi, gibberellin biosynthesis genes were first found in the model strain Fusarium lutescens. 7 genes involved in gibberellin biosynthesisDES、P450-4、P450-1、P450-2、GGS2、CPS/KSAndP450-3the close linkage constitutes a gene cluster, which is present on chromosome 4. The biosynthesis pathway of gibberellin is that acetyl coenzyme A is obtained through mevalonate monoacyl coenzyme A, mevalonic acid, isopentenyl pyrophosphate, isopentenyl diphosphate, geranyl pyrophosphate, farnesyl pyrophosphate, geranylgeranyl pyrophosphate. The biosynthesis process of gibberellins is mainly divided into 3 stages: the first stage is carried out in the cytosol with geranylgeranyl pyrophosphate as substrate; the second stage is the catalytic conversion of ent-kaurene in the endoplasmic reticulum to GA 12-aldehyde by various enzymes; the last stage is carried out in the cytoplasm, and GA 12-aldehyde is subjected to the combined action of GA 3-oxidase (GA 3 ox), GA 20-oxidase (GA 20 ox), GA 2-oxidase (GA 2 ox), etc. to produce different types of gibberellins. Among them, GA20ox is a key enzyme in the later stage of gibberellin synthesis pathway, belongs to the subfamily of soluble dioxygenase 2OG-Fe (II) oxidase, and is responsible for degrading C20 type gibberellins. GA20ox was able to oxidize the biologically inactive GA12 and GA53 in the GA synthesis pathway to biologically active onesGA20 and GA9, maintain a balance between biologically active gibberellins and intermediates.

The bakanae disease of rice is a worldwide disease and is mainly distributed in the places of Guangdong, Hunan, Jiangsu, Zhejiang and the like in China. The symptoms of the disease are mainly represented by spindly growth, chlorosis, dwarfing and dead seedlings, and the yield loss of rice can reach more than 40 percent when the disease is serious. In recent years, with the popularization of light cultivation technologies such as machine transplanting, seedling throwing and direct seeding and the generation of drug resistance of bakanae bacteria to chemical agents, the occurrence degree of rice bakanae disease is increased year by year. Rice bakanae disease is mainly caused by seed spread, and pathogenic bacteria causing the disease include: fusarium graminearumFusarium fujikuroiFusarium proliferatumF. proliferatumFusarium verticilliumF. verticillioides、F. andiyazi[Wulff E G, Sorensen J L, Lübeck M, et al.Fusariumspp. associated with rice bakanae: ecology, genetic diversity,pathogenicity and toxigenicity. Environ Microbiol, 2010, 12: 649-657.]. The four pathogenic bacteria have the characters belonging to the composite species of the gibberella granatum (Gibberella fujikuroispecies complete, GFC). The GibberellｃA fujikuroi compound seed at least contains 11 genetically completely different mating types named as MP-A to MP-K, and the two types are all in heterozygote, and can produce different secondary metabolites, such as fusaric acid, fusarium, gibberellin, moniliformin, fumonisin and the like. Wherein the Fusarium canoensis belongs to mating type MP-C, the Fusarium proliferatum belongs to mating type MP-D, and the Fusarium verticillatum is mating type MP-A. The colony morphology (color and growth speed), spore type (megaspore and microspore) and spore-forming cell structure of the four fusarium microspecies are very similar, and the traditional identification means not only needs a large amount of professional knowledge, but also is relatively complex and consumes a long time. At present, the identification of the composite species of the gibberella barnacii is a trend of distinguishing difficult and complicated species by combining a molecular biological method on the basis of traditional morphological observation. For example, applicationsITS、28S rDNA、mt SSUrDNA、β-tubulinRNA polymerase second group (RPB2) Protein translation elongation factorEF-1αAnalysis of multiple gene sites such as calmodulin to determine rattanInternal members of the gibberella canescens complex species. For example, mu (2004), etc. by designing specific primers using a partially conserved sequence of the calmodulin gene, it is possible to identify Fusarium verticillium and Fusarium delavayi [ mu (G), Susca A, Steag, Moretti A. A species-specific PCR assay based on the calcium polypeptide for identification ofFusarium verticillioides,F. proliferatumandF. subglutinas. Eur J Plant Pathol, 2004, 110: 495-502.]. In addition, Yuan Yongtian et al (2018) and johny et al (2018) are based on loop-mediated isothermal amplification technology, and 4 species of bakanae pathogens can be labeled [ Yuan Yongtian, johny, leaf culture and martial, etc.. Rice bakanae pathogens carried by Jiangsu rice seeds are detected by applying loop-mediated isothermal amplification technology.China Rice science, 2018, 32(5) 493-; johnyo, Yuan Yongtian, Zengdan, etc. based on the loop-mediated isothermal amplification technique, rapid diagnosis is madeF. andiyaziCaused bakanae disease of rice, plant pathology report, 2018, 48(2): 256-phase 262.]。

Fusarium graminearum is the main infection source of rice bakanae disease, the pathogenicity is strongest, and only Fusarium graminearum can secrete gibberellin GA3 with a cyclic alcohol structure. Although Fusarium proliferatum contains all the gibberellin biosynthesis gene clusters, it loses the gibberellin synthesis ability. Based on the fact that the compound seed of the gibberella barnacle causing the rice bakanae disease is difficult to determine in form, the fast and accurate detection technology is researched and explored, and the method has important application value for preventing the spread of the rice bakanae disease, taking prevention and control measures as soon as possible and ensuring the safe production of rice in China. The invention can treat Fusarium canum, Fusarium proliferatum, Fusarium pseudoverticillarum andF. andiyazithe gibberellin biosynthesis gene clusters are compared to find out Fusarium verticillium andF. andiyazilarge fragment deletion of the gibberellin biosynthesis gene cluster occurs; further carrying out whole genome comparison on fusarium graminearum and fusarium laminarina to find gibberellin synthetic genesGA20oxIs absent in Fusarium laminae. Therefore, gibberellin biosynthesis and regulation genes can be applied to rapidly identify the rice bakanae disease caused by fusarium graminearum. At present, no report for detecting fusarium graminearum based on the difference of gibberellin biosynthesis and regulation genes is found at home and abroad. At the same time, the user can select the desired position,the research result can provide an original experimental material for improving the strain of the gibberella barnacle by utilizing a molecular genetic method to improve the content of gibberellin products in the microorganism, and has important practical significance for further applying gibberellin to improve crops.

Disclosure of Invention

To the problem that prior art exists, this application is based on Fusarium graminearum, layer goes out Fusarium, Fusarium verticillioides andF. andiyazithe specific gene is obtained by bioinformatics, and the technical scheme of the method for rapidly detecting the gibberellin race generated in the bakanae disease of rice is designed and provided.

The purpose of the invention is realized as follows:

the specific gene aims at fusarium graminearum, fusarium laminarinum, fusarium verticillioides and fusarium verticillioides in rice bakanae bacteriaF. andiyaziThe method of (1).

Comparing the gibberellin synthesis gene clusters of the four races, finding that the gibberellin biosynthesis gene cluster of Fusarium canoensis appears in Fusarium proliferatum and in Fusarium pseudoverticillarum and Fusarium graminearumF. andiyaziIn the gene cluster for biosynthesis of gibberellinP450-1（SEQ ID NO.22）、P450-2（SEQ ID NO.23）、GGS2（SEQ ID NO.24）、CPS/KS(SEQ ID NO. 25) andP450-3(SEQ ID NO. 26) complete deletion of the gene occurred. According to the synthesis of gibberellins in Fusarium granatumCPS/ KSThe gene design specific primer is characterized by having nucleotide sequences of SEQ ID NO.59 and SEQ ID NO.60, carrying out PCR amplification on four races of genomic DNA of the rice bakanae disease, and separating 1327bp specific fragments from fusarium graminearum and fusarium solani by agarose gel electrophoresis.

Further comparing the whole genome sequence of Fusarium canceolatum and Fusarium proliferatum, the method for regulating and controlling gibberellin biosynthesis is discoveredGA20oxThe gene (SEQ ID NO. 1) is deleted in Fusarium proliferatum. According to Fusarium canumGA20oxThe gene design specific primer is characterized by having the nucleotide sequences of SEQ ID NO.2 and SEQ ID NO.3, carrying out PCR amplification on four race genome DNAs of the rice bakanae disease, and carrying out agarose gel electrophoresisThe 848bp fragment can be separated from Fusarium canescens.

The specific primer is designed according to the calmodulin gene in the fusarium verticillioides and is characterized by having the nucleotide sequences of SEQ ID NO.69 and SEQ ID NO.70, PCR amplification of four microspecies of genome DNA of the rice bakanae is carried out, and a 578bp fragment is separated only in the fusarium verticillioides through agarose gel electrophoresis.

Therefore, for the rice bakanae disease to be detected, the fusarium graminearum can be known to be determined to be fusarium graminearum or not only by identifying whether the sequences shown by SEQ ID No.1 and SEQ ID No.25 exist in the sequence of the genome of the strain; if the sequence shown in SEQ ID NO.25 does not exist, judging the strain to be Fusarium proliferatum; if the specific fragment exists in the PCR amplification by the fusarium verticillioides calmodulin specific primer, judging that the strain belongs to the fusarium verticillioides; if the gene sequences of SEQ ID NO.1, SEQ ID NO.25 and Fusarium verticillium calmodulin do not exist in the genome sequence, the strain can be judged to beF. andiyaziAs shown in fig. 1.

Therefore, the present inventors have achieved the following technical solutions.

The method for rapidly detecting the gibberellin race generated in the rice bakanae disease comprises the following steps of fusarium graminearum, fusarium stratified, fusarium pseudoverticillium andF. andiyaziit is characterized by aiming at fusarium graminearum, fusarium laminarium, fusarium verticillioides andF. andiyazidesigning specific primers according to the specific gene difference, performing multiple PCR amplification by using the specific primers and the DNA of a sample to be detected as a template, and judging the generation of the gibberellin microspecies in the rice bakanae bacteria according to the amplification result.

The method for rapidly detecting the gibberellin race generated in the rice bakanae disease is characterized in that the fusarium graminearum, the fusarium stratified, the fusarium pseudoverticillium and the fusarium graminearumF. andiyaziThe specific genes of (A) are: gibberellin synthesis regulation and control as shown in SEQ ID NO.1GA20oxGene, gibberellin biosynthesis shown in SEQ ID NO.25CPS/KSGenes and calmodulin genes.

In the rice bakanae diseaseA rapid detection method for producing a small species of gibberellin, characterized in that the specific primers comprise: gibberellin synthesis regulation of nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3GA20oxGene specific primers; biosynthesis of gibberellins with nucleotide sequences as shown in SEQ ID NO.59 and SEQ ID NO.60CPS/KSGene specific primers; the calmodulin gene specific primers of the nucleotide sequences shown as SEQ ID NO.69 and SEQ ID NO. 70.

The rapid detection method for the generation of the small gibberellin species in the rice bakanae disease is characterized in that the multiple PCR amplification conditions are as follows:

the multiplex PCR reaction system is as follows: sample genomic DNA100ng, three pairs of positive reverse primers 10. mu.M each and 1. mu.L each of the three pairs of positive reverse primers are includedGA20oxGene specific primer,CPS/KSGene specific primers and calmodulin gene specific primers, 2.5mM dNTPs 4. mu.L, 10 XPCR buffer 2. mu.L, 5U/. mu.LTaqPolymerase 0.4. mu.L, plus ddH₂O is complemented to 20 mu L;

the PCR amplification procedure was: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 10s, annealing at 54 ℃ for 40s, extension at 72 ℃ for 80s, 35 cycles; finally, extension is carried out for 10min at 72 ℃.

The method for rapidly detecting the generated gibberellin microspecies in the rice bakanae disease is characterized in that the judgment result is as follows: when the PCR amplification product presents 1327bp and 848bp bands, judging the sample to be fusarium graminearum; when the PCR product presents a 1327bp single strip, judging that the sample is Fusarium proliferatum; when the PCR product presents a 578bp single band, judging the sample to be fusarium verticillioides; when the PCR product has no strip, judging the sample asF. andiyazi。

The method for rapidly detecting the gibberellin microspecies generated in the rice bakanae disease is characterized by comprising the following steps:

1) extracting whole genome DNA of a sample to be detected;

2) performing multiplex PCR amplification by using a sample DNA to be detected as a template:

the multiplex PCR reaction system is as follows: sample genomic DNA100ng, three pairs of positive reverse primers 10. mu.M each and 1. mu.L each of the three pairs of positive reverse primers are includedGA20oxGene specificityA primer, a,CPS/KSGene specific primers and calmodulin gene specific primers, 2.5mM dNTPs 4. mu.L, 10 XPCR buffer 2. mu.L, 5U/. mu.LTaqPolymerase 0.4. mu.L, plus ddH₂O is complemented to 20 mu L;

the PCR amplification procedure was: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 10s, annealing at 54 ℃ for 40s, extension at 72 ℃ for 80s, 35 cycles; finally, extending for 10min at 72 ℃;

the above-mentionedGA20oxThe gene specific primers are shown as SEQ ID NO.2 and SEQ ID NO.3,CPS/KSThe gene specific primers are shown as SEQ ID NO.59 and SEQ ID NO.60, and the calmodulin gene specific primers are shown as SEQ ID NO.69 and SEQ ID NO. 70;

3) judgment by amplification result

Separating the amplified product by using 1.5% agar gel electrophoresis, after separation, determining the result according to the size of the amplified product by ethidium bromide staining under an ultraviolet lamp, and when the PCR amplified product presents 1327bp and 848bp strips, determining that the sample is fusarium graminearum; when the PCR product presents a 1327bp single strip, judging that the sample is Fusarium proliferatum; when the PCR product presents a 578bp single band, judging the sample to be fusarium verticillioides; when the PCR product has no strip, judging the sample asF. andiyazi。

SaidGA20oxGene specific primer,CPS/KSApplication of gene specific primers and calmodulin gene specific primers in rapid detection of gibberellin race produced in Fusarium graminearum, wherein the Fusarium graminearum, Fusarium laminar flow, Fusarium verticillium and Fusarium graminearumF. andiyazi。

SaidGA20oxGene specific primer,CPS/KSThe application of the gene specific primer and the calmodulin gene specific primer in early diagnosis of rice bakanae disease.

The method is suitable for rapid and reliable detection and identification of rice bakanae disease, and can be used for detecting Fusarium graminearum, Fusarium proliferatum, Fusarium pseudoverticillarum and Fusarium graminearumF. andiyaziThe prevention and treatment of the rice bakanae disease caused by the rice bakanae disease have important practical application value. Compared with the prior art, the invention has the following technical advantages and positive effects:

1. the specificity is strong: the detection method of the invention obtains the microspecies specific gene based on the sequence information of four fusarium genes causing the rice bakanae disease, detects the pathogenic bacteria through the microspecies specific nucleic acid sequence, has good specificity of the detection primer, and can amplify a strip with specific size from a target sample.

2. The practicability is good: the specific gene, the primer and the detection method can be used for quickly, simply and accurately identifying fusarium graminearum, fusarium laminarinum, fusarium verticillium and the like causing the rice bakanae diseaseF. andiyaziThe method can be applied to the detection of DNA of the ill tissue of the rice bakanae disease and the detection of DNA of fungi separated from the ill tissue.

3. The operation is simple, convenient and quick: the series specific primer combination used by the invention can detect four small species in the composite species of the gibberella barnacii, the result can be judged after the completion of a multiple PCR reaction system, PCR amplification and conventional agarose gel electrophoresis, and the whole PCR detection process is generally completed within a few hours.

Drawings

FIG. 1 is an agarose gel electrophoresis image of a PCR detection sample amplified by triple PCR detection technology for bakanae disease of rice; the swimming belt M is a DNA standard substance (100 bp DNA Ladder Marker), and 1-14 are identification strains; wherein, 1-5 is Fusarium cancecronica; 6-7 is Fusarium proliferatum; 8-12 is Fusarium verticillium; 13-14 areF. andiyazi。

FIG. 2 shows the elongation factor for the translation of fusarium proteinsEFCarrying out agarose gel electrophoresis image after PCR detection sample amplification by the universal primer of the gene; the swimming belt M is a DNA standard substance (100 bp DNA Ladder Marker), and 1-14 are identification strains; wherein, 1-5 is Fusarium cancecronica; 6-7 is Fusarium proliferatum; 8-12 is Fusarium verticillium; 13-14 areF. andiyazi。

FIG. 3 shows the biosynthesis genes of gibberellin of Fusarium canumCPS/KSThe specific primer of (2) is used for carrying out an agarose gel electrophoresis picture after the PCR detection sample is amplified; the swimming belt M is a DNA standard substance (100 bp DNA Ladder Marker), and 1-14 are identification strains; wherein, 1-5 is Fusarium cancecronica; 6-7 is Fusarium proliferatum; 8-12 is Fusarium verticillium; 13-14 areF. andiyazi。

FIG. 4 shows the gibberellin regulation and synthesis gene of Fusarium canumGA20oxThe specific primer of (2) is used for carrying out an agarose gel electrophoresis picture after the PCR detection sample is amplified; the band M is a DNA standard (100 bp DNA Ladder Marker), wherein 1-14 are identification strains; wherein, 1-5 is Fusarium cancecronica; 6-7 is Fusarium proliferatum; 8-12 is Fusarium verticillium; 13-14 areF. andiyazi。

FIG. 5 is an agarose gel electrophoresis of a PCR detection sample amplified by specific primers for the gene of Fusarium verticillium calmodulin; the swimming belt M is a DNA standard substance (100 bp DNA Ladder Marker), and 1-14 are identification strains; wherein, 1-5 is Fusarium cancecronica; 6-7 is Fusarium proliferatum; 8-12 is Fusarium verticillium; 13-14 areF. andiyazi。

FIG. 6 shows Fusarium cancearum, Fusarium proliferatum, Fusarium pseudoverticillatum andF. andiyazicomparison of the Gene Cluster for biosynthesis of Mega-giniamycin.

FIG. 7 is an agarose gel electrophoresis image of a PCR detection sample of rice bakanae disease collected in the field after amplification; m is a DNA standard substance (100 bp DNA Ladder Marker), and 1-14 are strains to be detected.

Detailed Description

The present invention is further illustrated below by reference to specific examples, which are intended to be illustrative only and not to be limiting as to the scope of the invention.

Example 1 molecular identification of four Fusarium species of Ramophila oryzae

Extracting strain genome DNA from Fusarium separated from rice bakanae disease sample, and translating extension factor by Fusarium proteinEFAnd (3) designing a universal primer of a gene conserved sequence for molecular identification.

Step 1: culturing of bacterial strains

The strain is inoculated on potato dextrose agar solid culture medium (200 g of potato, 18g of glucose, 20g of agar, 1L of distilled water and PDA), the fungus block growing for 5d is taken out and transferred into 100mL of potato dextrose liquid culture medium (200 g of potato, 18g of glucose, 1L of distilled water and PDB), and after shaking culture is carried out for 5d at the temperature of 28 ℃ and 120 r/min in a constant temperature shaking table, the hypha is collected.

Step 2: rapid extraction of strain DNA

(1) Pretreatment of the sample: 20 mg of mycelia were placed in a2 mL centrifuge tube, and 500 μ L of Extraction Buffer (1M KCL, 100 mM TrisHCl, 10 mM EDTA, pH = 8) was added;

(2) grinding: placing the centrifuge tube in a rapid nucleic acid extraction instrument, setting 60 HZ, and grinding for 1 min;

(3) centrifuging: centrifuging at 12000rpm for 10min at 4 deg.C;

(4) and (3) precipitation: transferring 400 mu L of supernatant into a new centrifuge tube, adding isovoluminous precooled isopropanol, gently mixing uniformly, standing at room temperature for 10min, and centrifuging at 12000rpm for 10min at 4 ℃;

(5) washing: removing supernatant, adding 700 mu L70% ethanol, shaking and mixing uniformly, centrifuging at 12000rpm for 5min at 4 ℃, and washing for 2 times;

(6) dissolving: vacuum drying for 10min, dissolving the DNA in ddH₂In O, stored at 4 ℃.

And step 3:EFmolecular verification of genes

Protein translation elongation factors according to different species of Fusarium (seeEF) Conserved sequence of the genes, O 'Donnell (1998) designed general primers EF1/EF2 for Fusarium [ O' Donnell, K., Cigelnik, E., Nirenberg, H.I. molecular systems and phylogenetic of the sameGibberella fujikuroispeciescomplex. Mycologia, 1998, 90, 465–493.]EF1 and EF2 have the nucleotide sequences of SEQ ID NO.4 and SEQ ID NO.5, respectively, and PCR amplification is carried out on different fusarium species. The PCR reaction system is as follows: 50ng of strain genome DNA, 1. mu.L each of forward and reverse primers (10. mu.M), 4. mu.L of dNTPs (2.5 mM), 2. mu.L of 10 XPCR buffer,Taqpolymerase (5U/. mu.L) 0.3. mu.L, plus ddH₂O make up to 20. mu.L. The PCR reaction program is: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 10s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 40s for 30 cycles; finally, extension is carried out for 10min at 72 ℃. As shown in FIG. 2, the identified strains amplified a fragment of about 700 bp. After the PCR amplification product is cut from the agarose gel, the specific fragment is recovered and purified by using a DNA recovery kitAfter transformation, the plasmid was ligated to pMD18-T vector and transformed into E.coliE. coliThe recombinant plasmid which shows positive clone is sent to Shanghai bioengineering company for sequence sequencing.

Sequencing results were performed on the Fusarium TEF Sequence database (FUSARIUM-ID v 1.0) [ Geiser D M, Jimenez-Gasco M, Kang S, et al, FUSARIUM-ID v 1.0: A DNA Sequence database for identificationFusarium. Eur J Plant Pathol, 2004, 110, 473-479]The submitted sequences are compared to determine the microspecies of the sequences. Five strain protein translation elongation factorEFThe genes respectively have nucleotide sequences of SEQ ID NO. 6-SEQ ID NO.10, and then the gene is judged to be fusarium graminearum; 2 strainsEFThe gene has the nucleotide sequences of SEQ ID NO.11 and SEQ ID NO.12 respectively, and is judged to be fusarium proliferatum; five strainsEFThe genes respectively have nucleotide sequences of SEQ ID NO. 13-SEQ ID NO.17, and then the genes are judged to be fusarium verticillioides; two strainsEFThe gene has the nucleotide sequences of SEQ ID NO.18 and SEQ ID NO.19 respectively, and then the judgment is thatF. andiyazi。

Observing the shapes and the growing modes of the megaspore and the microspore of the strain, the characteristics of the conidiophore, the growing color of the bacterial colony, the existence of pigment generation and the like by combining a traditional morphological method, finally identifying the strains to be detected as Fusarium cancecronii No. 1-5, Fusarium delavayi No. 6-7, Fusarium pseudoverticillarum No. 8-12 and Fusarium verticillium No. 13-14F. andiyazi。

Example 2 comparison of four Fusarium race gibberellin biosynthesis Gene clusters

Wiemann et al (2013) have published the sequence of the gibberellin synthesis gene cluster in Fusarium luteum [ Wiemann P, Sieber C M, von Bargen K W, et alFusarium fujikuroireveal complexregulation of secondary metabolism and novel metabolites. PLoS Pathog, 2013,9(6): e1003475]. According to gibberellin biosynthesis gene clusterDES（SEQ ID NO.20）、P450-4（SEQ IDNO.21）、P450-1（SEQ ID NO.22）、P450-2（SEQ ID NO.23）、GGS2（SEQ ID NO.24）、CPS/KS(SEQ ID NO. 25) andP450-3(SEQ ID NO. 26) Gene sequences, three pairs of specific primers (Table 1) were designed at the front, middle and rear segments of each gene, respectively, for Fusarium proliferatum, Fusarium pseudoverticillium and Fusarium proliferatum in example 1F. andiyaziThe genomic DNA of (1) is subjected to PCR amplification. The PCR reaction system is as follows: 50ng of strain genome DNA, 1. mu.L of forward and reverse primers (10. mu.M) each, 4. mu.L of dNTPs (2.5 mM), 2. mu.L of 10 XPCR buffer,Taqpolymerase (5U/. mu.L) 0.3. mu.L, plus ddH₂O make up to 20. mu.L. The PCR reaction program is: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 10s, annealing at 54 ℃ for 40s, extension at 72 ℃ for 1min/1kb, 30 cycles; finally, extension is carried out for 10min at 72 ℃. The PCR amplification product was detected by 1% agarose gel electrophoresis, and the presence or absence of DNA bands was observed. Through identification, the layered fusarium contains complete gibberellin biosynthesis gene cluster, and the pseudoverticillium dahliae and the fusarium graminearumF. andiyaziOnly containDESAndP450-4the gene(s) is (are),P450-1、P450-2、GGS2、CPS/KSandP450-3all genes were deleted (FIG. 6). FIG. 3 is a drawing showingCPS/KSThe agarose gel electrophoresis picture after the specific primer amplification of the gene, the primer sequences have the nucleotide sequences of SEQ ID NO.59 and SEQ ID NO.60 respectively, and the fusarium granatum and the fusarium laminarinae can amplify a 1327bp specific fragment.

TABLE 1 Gene sequences of Fusarium granatum gibberellin synthesis gene clusters and primer sequences thereof

。

Example 3 comparison of Fusarium canescens and Fusarium stratiotes whole genome

For the functional genome comparison of Fusarium cancescens and Fusarium cambogium, the whole genome sequences of Fusarium cambogium Fp9 strain (SRA access: PRJNA 517537) and Fusarium cancescens 58289 strain (ANFV 00000000), including genes, protein sequences and gene annotation information, were downloaded from NCBI database in view of data availability, representativeness and importance. Whole genome sequence alignment mGenomeSubtractor on-line analysis software (http:// bioin)fo-mml.sjtu.edu.cn/mGS /), pairwise alignment of the whole genome sequences of the two fusarium (see (1) ((ii))EValue is set to 1e^-5) Screening to obtain the specific gene of GA 20-oxidase encoded in later stage of gibberellin synthesis pathwayGA20oxThe gene is present in Fusarium gambosum genome (GenBank number FFUJ _ 12912) but is absent in Fusarium exserotina and has the nucleotide sequence of SEQ ID No. 1.

Example 4 differentiation of Fusarium canescens and Fusarium stratiotes

Using Fusarium granatum of example 3GA20oxSpecific primers are designed for the gene, and have nucleotide sequences of SEQ ID NO.2 and SEQ ID NO.3 respectively, and PCR amplification is carried out on the four fusarium species in the example 1. The PCR reaction system is as follows: 50ng of strain genome DNA, 1. mu.L of forward and reverse primers (10. mu.M) each, 4. mu.L of dNTPs (2.5 mM), 2. mu.L of 10 XPCR buffer,Taqpolymerase (5U/. mu.L) 0.3. mu.L, plus ddH₂O make up to 20. mu.L. The PCR reaction program is: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 10s, annealing at 54 ℃ for 40s, and extension at 72 ℃ for 50s for 30 cycles; finally, extension is carried out for 10min at 72 ℃. The PCR amplification product was detected by 1% agarose gel electrophoresis, and the presence or absence of DNA bands was observed. As shown in figure 4GA20oxThe agarose gel electrophoresis image after gene specific primer amplification can amplify specific fragments of 848bp in fusarium lutescens, and does not amplify specific fragments in other three fusarium races.

Example 5 Fusarium verticillium andF. andiyaziis distinguished by

To distinguish Fusarium verticillium fromF. andiyaziAccording to Muhie et al (2004) [ Muhieg, Susca A, Stea G, Moretti A. A species-specific PCR assay based on the catalytic specific gene for identification ofFusarium verticillioides,F. proliferatumandF. subglutinas. Eur J Plant Pathol, 2004, 110: 495-502.]The fusarium verticillioides calmodulin gene specific primers VER1 and VER2 are used for carrying out PCR amplification on the four fusarium species in the example 1, and VER1 and VER2 respectively have nucleotide sequences of SEQ ID NO.69 and SEQ ID NO. 70. The PCR reaction system is as follows: 50ng of genomic DNA of the strain, 1. mu.L each of forward and reverse primers (10. mu.M), 4. mu.L of dNTPs (2.5 mM), 10 XPCR buffer 2μL，TaqPolymerase (5U/. mu.L) 0.3. mu.L, plus ddH₂O make up to 20. mu.L. The PCR reaction program is: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 10s, annealing at 54 ℃ for 40s, and extension at 72 ℃ for 40s for 30 cycles; finally, extension is carried out for 10min at 72 ℃. The PCR amplification product was detected by 1% agarose gel electrophoresis, and the presence or absence of DNA bands was observed. As shown in FIG. 5, which is an agarose gel electrophoresis image of the amplified calmodulin-encoding gene specific primers (VER 1/VER 2), 578bp PCR product was produced only in Fusarium verticillium, while no specific fragment was amplified in other strains.

Example 6 multiplex PCR detection method for Miao bacterial pathogen

(1) Multiplex PCR amplification: multiplex PCR amplification was performed using the DNA of the test strain in example 1 as a template.

(2) The multiplex PCR reaction system is as follows: sample genomic DNA100ng, three pairs of positive and negative primers (10. mu.M) each at 1. mu.L (inclusive)GA20oxGene, gene,CPS/KSSpecific primers for the gene and calmodulin gene), 4. mu.L of dNTPs (2.5 mM), 2. mu.L of 10 XPCR buffer,Taqpolymerase (5U/. mu.L) 0.4. mu.L, plus ddH₂O make up to 20. mu.L. The PCR amplification procedure was: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 10s, annealing at 54 ℃ for 40s, extension at 72 ℃ for 80s, 35 cycles; finally, extension is carried out for 10min at 72 ℃.

(3) And (3) carrying out electrophoretic separation on the amplification product by using 1.5% agar gel, and after separation, judging the result according to the size of the amplification product by staining the amplification product by ethidium bromide under an ultraviolet lamp. As shown in FIG. 1, samples No.1 to No.5 to be detected all contain 1327bp and 848bp target bands, and then are judged to be fusarium graminearum; the No.6 to No.7 samples to be detected all contain 1327bp target bands, and the samples are judged to be fusarium proliferatum; the samples to be detected No. 8-12 all contain 578bp target bands, and then the samples are judged to be fusarium verticillioides; if there is a band in the sample to be tested No. 13-14, it is judged that it isF. andiyazi. The multiplex PCR assay results are based on example 1EFThe molecular identification results of the gene on four fusarium species are consistent.

Example 7 multiplex PCR detection of Miao bacterial in Rice tissue

Step 1: separation of rice bakanae disease strain: from Hangzhou city, Zhejiang provinceThe rice canker infected stalks are collected in a rice field test base. Cutting the diseased tissue into 3mm³The left and right small blocks are inoculated on a water agar (agar 20g, distilled water 1L) culture medium for growing for 48h, and then top hypha is picked and transferred into a potato glucose agar PDA culture medium to be used as a bacterial strain to be detected of the rice bakanae disease.

Step 2: culturing the strain to be tested: same as in step 1 of example 1.

And step 3: extracting DNA of a strain to be detected: same as in step 2 of example 1.

And 4, step 4: identification of the production of Fusarium gibberellins race:

(1) multiplex PCR amplification: and performing multiplex PCR amplification by using the DNA of the strain to be detected as a template. The multiplex PCR reaction system is as follows: the strain genome DNA was 100ng, and each of three pairs of positive and negative primers (10. mu.M) was 1. mu.L (includingGA20oxGene, gene,CPS/KSPrimers specific for the gene and calmodulin gene), dNTPs (2.5 mM) 4. mu.L, 10 XPCR buffer 2. mu.L,Taqpolymerase (5U/. mu.L) 0.4. mu.L, plus ddH₂O make up to 20. mu.L. The PCR reaction program is: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 10s, annealing at 54 ℃ for 40s, extension at 72 ℃ for 80s, 35 cycles; finally, extension is carried out for 10min at 72 ℃.

(2) And (3) carrying out electrophoretic separation on the amplification product by using 1.5% agar gel, and after separation, judging the result according to the size of the amplification product by staining the amplification product by ethidium bromide under an ultraviolet lamp. As shown in FIG. 7, the sample to be tested both contained 1327bp and 848bp target bands, indicating that all identified strains were Fusarium graminearum, indicating that Fusarium graminearum may be the dominant species of rice bakanae disease in the collection area. If necessary, the target band obtained by electrophoresis can be recovered and sequenced to further judge, or based on the extension factorEFBlast comparison after gene sequencing and cluster analysis based on polygene sequencing.

The multiple PCR reaction system can simultaneously, rapidly and specifically detect four kinds of gibberella granatum, fusarium laminarinum, fusarium verticillioides and fusarium verticillium causing rice bakanae diseaseF. andiyazi。

The foregoing is only a preferred embodiment of this invention and it should be noted that modifications may be made by those skilled in the art without departing from the principles of the invention and these modifications should also be considered as within the scope of the invention.

Sequence listing

<110> institute of Rice research in China

<120> method for rapidly detecting gibberellin microspecies generated in rice bakanae disease

<160>70

<170>SIPOSequenceListing 1.0

<210>1

<211>1067

<212>DNA

<213> Fusarium fujikuroi)

<400>1

atgccttctg ccattgacag catcccaatt gcctcctttg agacaatcaa ctactccgct 60

cttgagagac gagatgcgaa agagattgaa aagctcatgg gtgcaagccg tacagccgga 120

ttcttctacc tagactttga ccgtagtggt gccgctggtc tacccaagaa gaagaaagaa 180

gttctcaagg caatgaagga atatttcagt cagcctgatg acatcaagca acttgacagc 240

aaaggcgttc ctacgcgtgg gtaagtagac cgcaattatg aatggcacag tgctgattag 300

tttcaagata tgtcaagaaa ggcaccttca ccgccgttga ccccagccgc cctgacgaat 360

cttttgaaca tcttgctgta agccatatga gcggttcggc agattcatga ctgacttcaa 420

agcagattgg aacgcacgat ctgggaacta atatagcttc cacgctccct gcagtgttca 480

agaaggctgg aacgctcatc cccgactacg tagctctttg tgagcgtgta gtcgacgttc 540

tgctggactg ctactcacag gctctaggcg tccctggtca gttcctggag taccacgacc 600

acgaaaaacc atccgatacc atccttgcca tgctgagcta tcctggaaag ctcacccatc 660

aaaagcatac cgatctggga tccttgactg ttctcttcag tgatgagtgg ggacttcagg 720

ttgttgaacc cagcaacggc aattgggagt gggtcgagcc gcgggagaac gacgccgtca 780

tcaatgttgg cgacactctt cgcttcctgt cgggaaaaac cttgtattcc tgtgttcaca 840

gggtcatcag agatggtcgt gctagcgatg aggggcatag atactccatc gcatatctgc 900

tgcgtcctgg tgatgacgtg agctttgtcg acgccgatgg gtccaggatc accgcccagt 960

cctttgccgg tatcaagtac aaagcttatt ctgcggacca tgctgagcag gacaagaata 1020

cggtcctgac tggtggaatg gaacaggtac ttggtgtccg cgcctag 1067

<210>2

<211>16

<212>DNA

<213> primer (primer)

<400>2

caaggcaatg aaggaa 16

<210>3

<211>16

<212>DNA

<213> primer (primer)

<400>3

ccagtcagga ccgtat 16

<210>4

<211>20

<212>DNA

<213> primer (primer)

<400>4

atgggtaagg aggacaagac 20

<210>5

<211>21

<212>DNA

<213> primer (primer)

<400>5

ggaagtacca gtgatcatgt t 21

<210>6

<211>646

<212>DNA

<213> Fusarium fujikuroi)

<400>6

tgatatgtta gtatgaataa gtagaatgaa gcatgagcga caacatacca atgacggtga 60

catagtagcg aggagtctcg aacttccaga gagcaatatc gatggtgata ccacgctcac 120

gctcggcctt gagcttgtca agaacccagg cgtacttgaa ggaaccctta ccgagctcag 180

cggcttccta ttgtcgaatg gttagtttga cacgtgacaa tgcgctcatt gaggttgtgg 240

acaggaaagg gcaaaacgcg cccatcactc gagtggcggg gtaaatgccc caccaaaaaa 300

aattacggtc atatcgcaaa atttttggtc tcgagcgggg tagcaggcac gtttcgaatc 360

gtaagggaaa tcggtgggca aaggacgcgc gatcgaaggg aaagtgacta accttctcga 420

acttctcgat ggttcgcttg tcgataccac cgcactggta gatcaagtga ccggtctgtg 480

aagcgatgtc agcatattgt cttctgagat ataccccgcc agatcttggt caggatcacg 540

atgacagata agctcatcgt cgagggtagt actcacagtg gtcgacttgc cagagtcaac 600

gtggccgatg acgacgacgt taaggtgagt cttgttccct tttccc 646

<210>7

<211>646

<212>DNA

<213> Fusarium fujikuroi)

<400>7

tgatatgtta gtatgaataa gtagaatgaa gcatgagcga caacatacca atgacggtga 60

catagtagcg aggagtctcg aacttccaga gagcaatatc gatggtgata ccacgctcac 120

gctcggcctt gagcttgtca agaacccagg cgtacttgaa ggaaccctta ccgagctcag 180

cggcttccta ttgtcgaatg gttagtttga cacgtgacaa tgcgctcatt gaggttgtgg 240

acaggaaagg gcaaaacgcg cccatcactc gagtggcggg gtaaatgccc caccaaaaaa 300

aattacggtc atatcgcaaa atttttggtc tcgagcgggg tagcaggcac gtttcgaatc 360

gtaagggaaa tcggtgggca aaggacgcgc gatcgaaggg aaagtgacta accttctcga 420

acttctcgat ggttcgcttg tcgataccac cgcactggta gatcaagtga ccggtctgtg 480

aagcgatgtc agcatattgt cttctgagat ataccccgcc agatcttggt caggatcacg 540

atgacagata acctcatcgt cgagggtagt actcacagtg gtcgacttgc cagagtcaac 600

gtggccgatg acgacgacgt taaggtgagt cttgttccct tttccc 646

<210>8

<211>646

<212>DNA

<213> Fusarium fujikuroi)

<400>8

tgatatgtta gtatgaataa gtagaatgaa gcatgagcga caacatacca atgacggtga 60

catagtagcg aggagtctcg aacttccaga gagcaatatc gatggtgata ccacgctcac 120

gctcggcctt gagcttgtca agaacccagg cgtacttgaa ggaaccctta ccgagctcag 180

cggcttccta ttgtcgaatg gttagtttga cacgtgacaa tgcgctcatt gaggttgtgg 240

acaggaaagg gcaaaacgcg cccatcactc gagtggcggg gtaaatgccc caccaaaaaa 300

aattacggtc atatcgcaaa atttttggtc tcgagcgggg tagcaggcac gtttcgaatc 360

gtaagggaaa tcggtgggca aaggacgcgc gatcgaaggg aaagtgacta accttctcga 420

acttctcgat ggttcgcttg tcgataccac cgcactggta gatcaagtga ccggtctgtg 480

aagcgatgtc agcatattgt cttctgagat ataccccgcc agatcttggt caggatcacg 540

atgacagata agctcatcgt cgagggtagt actcacagtg gtcgacttgc cagagtcaac 600

gtggccgatg acgacgacgt taaggtgagt cttgttccct tttccc 646

<210>9

<211>646

<212>DNA

<213> Fusarium fujikuroi)

<400>9

tgatatgtta gtatgaataa gtagaatgaa gcatgagcga caacatacca atgacggtga 60

catagtagcg aggagtctcg aacttccaga gagcaatatc gatggtgata ccacgctcac 120

gctcggcctt gagcttgtca agaacccagg cgtacttgaa ggaaccctta ccgagctcag 180

cggcttccta ttgtcgaatg gttagtttga cacgtgacaa tgcgctcatt gaggttgtgg 240

acaggaaagg gcaaaacgcg cccatcactc gagtggcggg gtaaatgccc caccaaaaaa 300

aattacggtc atatcgcaaa atttttggtc tcgagcgggg tagcaggcac gtttcgaatc 360

gtaagggaaa tcggtgggca aaggacgcgc gatcgaaggg aaagtgacta accttctcga 420

acttctcgat ggttcgcttg tcgataccac cgcactggta gatcaagtga ccggtctgtg 480

aagcgatgtc agcatattgt cttctgagat ataccccgcc agatcttggt caggatcacg 540

atgacagata agctcatcgt cgagggtagt actcacagtg gtcgacttgc cagagtcaac 600

gtggccgatg acgacgacgt taaggtgagt cttgttccct tttccc 646

<210>10

<211>646

<212>DNA

<213> Fusarium fujikuroi)

<400>10

tgatatgtta gtatgaataa gtagaatgaa gcatgagcga caacatacca atgacggtga 60

catagtagcg aggagtctcg aacttccaga gagcaatatc gatggtgata ccacgctcac 120

gctcggcctt gagcttgtca agaacccagg cgtacttgaa ggaaccctta ccgagctcag 180

cggcttccta ttgtcgaatg gttagtttga cacgtgacaa tgcgctcatt gaggttgtgg 240

acaggaaagg gcaaaacgcg cccatcactc gagtggcggg gtaaatgccc caccaaaaaa 300

aattacggtc atatcgcaaa atttttggtc tcgagcgggg tagcaggcac gtttcgaatc 360

gtaagggaaa tcggtgggca aaggacgcgc gatcgaaggg aaagtgacta accttctcga 420

acttctcgat ggttcgcttg tcgataccac cgcactggta gatcaagtga ccggtctgtg 480

aagcgatgtc agcatattgt cttctgagat ataccccgcc agatcttggt caggatcacg 540

atgacagata agctcatcgt cgagggtagt actcacagtg gtcgacttgc cagagtcaac 600

gtggccgatg acgacgacgt taaggtgagt cttgttccct tttccc 646

<210>11

<211>646

<212>DNA

<213> Fusarium proliferatum (F. proliferatum)

<400>11

tgatatgtta gtatgaataa gtagaatgaa gcatgagcga cgacatacca atgacggtga 60

catagtagcg aggagtctcg aacttccaga gagcaatatc gatggtgata ccacgctcac 120

gctcggcctt gagcttgtca agaacccagg cgtacttgaa ggaaccctta ccgagctcag 180

cggcttccta ttgtcgaatg gttagtttga cacgtgacaa tgcactcatt gaggttgtgg 240

acaggaaagg gcaaaacgcg cccatcactc gagtggcggg gtaaatgccc caccaaaaaa 300

aattacggtc atatcgcaaa atttttggtc tcgagcgggg tagcaggcac gtttcgaatc 360

gtaagggaaa tcggtgggca aaggacgcgc gatcgaaggg aaagtgacta accttctcga 420

acttctcgat ggttcgcttg tcgataccac cgcactggta gatcaagtga ccggtctgtg 480

aagcgatgtc agcatattgt cttctgagat ataccccgcc agatcttggt caggatcacg 540

atgacagata agctcatcgt cgagggtagt actcacagtg gtcgacttgc cagagtcaac 600

gtggccgatg acgacgacgt taaggtgagt cttgttccct tttccc 646

<210>12

<211>646

<212>DNA

<213> Fusarium proliferatum (F. proliferatum)

<400>12

tgatatgtta gtatgaataa gtagaatgaa gcatgagcga caacatacca atgacggtga 60

catagtagcg aggagtctcg aacttccaga gagcaatatc gatggtgata ccacgctcac 120

gctcggcctt gagcttgtca agaacccagg cgtacttgaa ggaaccctta ccgagctcag 180

cggcttccta ttgtcgaatg gttagtttga cacgtgacaa tgcgctcatt gaggttgtgg 240

acaggaaagg gcaaaacgcg cccatcactc gagtggcggg gtaaatgccc caccaaaaaa 300

aattacggtc atatcgcaaa atttttggtc tcgagcgggg tagcaggcac gtttcgaatc 360

gtaagggaaa tcggtgggca aaggacgcgc gatcgaaggg aaagtgacta accttctcga 420

acttctcgat ggttcgcttg tcgataccac cgcactggta gatcaagtga ccggtctgtg 480

aagcgatgtc agcatattgt cttctgagat ataccccgcc agatcttggt caggatcacg 540

atgacagata agctcatcgt cgagggtagt actcacagtg gtcgacttgc cagagtcaac 600

gtggccgatg acgacgacgt taaggtgagt cttgttccct tttccc 646

<210>13

<211>652

<212>DNA

<213> Fusarium verticillium (F. vertetillioides)

<400>13

tgatgtgtta gtaataggag atatagaacg gagtaagagc gacaacatac caatgacggt 60

gacatagtag cgaggagtct cgaacttcca gagagcgata tcgatggtga taccacgctc 120

acgctcggcc ttgagcttgt caagaaccca ggcgtacttg aaggaaccct taccgagctc 180

agcggcttcc tattgtcgga tggttagtga ctgcttgaca cgtgacgatg agctcagtga 240

ggttgtggaa tgggagaggg cagaaacgcg ccgctcgagt ggcggggtaa atgccccacc 300

agaaaaaatt acggtcgtat cgcaaaattt ttgggctcga gcggggtagcgggtacgttt 360

cgagtcgtag gggggaatcg atgggcaaag aacgcgcgat agaaggaaaa gtgactaacc 420

ttctcgaact tctcgatggt tcgcttgtcg ataccaccgc actggtagat caagtgaccg 480

gtctgtgaag cgatatcagt atgttttctt tgagaaatcc cccgccaggt cttggccggg 540

tttacgatgg ccgataagct catcgtcaag ggtagtactc acagtggtcg acttgccaga 600

gtcaacgtgg ccgatgacga cgacgttaag gtgagtcttg ttcccttttc cc 652

<210>14

<211>652

<212>DNA

<213> Fusarium verticillium (F. vertetillioides)

<400>14

tgatgtgtta gtaataggag atatagaacg gagtaagagc gacaacatac caatgacggt 60

gacatagtag cgaggagtct cgaacttcca gagagcgata tcgatggtga taccacgctc 120

acgctcggcc ttgagcttgt caagaaccca ggcgtacttg aaggaaccct taccgagctc 180

agcggcttcc tattgtcgga tggttagtga ctgcttgaca cgtgacgatg agctcagtga 240

ggttgtggaa tgggagaggg cagaaacgcg ccgctcgagt ggcggggtaa atgccccacc 300

agaaaaaatt acggtcgtat cgcaaaattt ttgggctcga gcggggtagc gggtacgttt 360

cgagtcgtag gggggaatcg atgggcaaag aacgcgcgat agaaggaaaa gtgactaacc 420

ttctcgaact tctcgatggt tcgcttgtcg ataccaccgc actggtagat caagtgaccg 480

gtctgtgaag cgatatcagt atgttttctt tgagaaatcc cccgccaggt cttggccggg 540

tttacgatgg ccgataagct catcgtcaag ggtagtactc acagtggtcg acttgccaga 600

gtcaacgtgg ccgatgacga cgacgttaag gtgagtcttg ttcccttttc cc 652

<210>15

<211>652

<212>DNA

<213> Fusarium verticillium (F. vertetillioides)

<400>15

tgatgtgtta gtaataggag atatagaacg gagtaagagc gacaacatac caatgacggt 60

gacatagtag cgaggagtct cgaacttcca gagagcgata tcgatggtga taccacgctc 120

acgctcggcc ttgagcttgt caagaaccca ggcgtacttg aaggaaccct taccgagctc 180

agcggcttcc tattgtcgga tggttagtga ctgcttgaca cgtgacgatg agctcagtga 240

ggttgtggaa tgggagaggg cagaaacgcg ccgctcgagt ggcggggtaa atgccccacc 300

agaaaaaatt acggtcgtat cgcaaaattt ttgggctcga gcggggtagc gggtacgttt 360

cgagtcgtag gggggaatcg atgggcaaag aacgcgcgat agaaggaaaa gtgactaacc 420

ttctcgaact tctcgatggt tcgcttgtcg ataccaccgc actggtagat caagtgaccg 480

gtctgtgaag cgatgtcagc atgttttctt tgagaaatcc cccgccaggt cttggccggg 540

tttacgatgg ccgataagct catcgtcaag ggtagtactc acagtggtcg acttgccaga 600

gtcaacgtgg ccgatgacga cgacgttaag gtgagtcttg ttcccttttc cc 652

<210>16

<211>652

<212>DNA

<213> Fusarium verticillium (F. vertetillioides)

<400>16

tgatgtgtta gtaatagaag atatagaacg gaataagagc gacaacatac caatgacggt 60

gacatagtag cgaggagtct cgaacttcca gagagcgata tcgatggtga taccacgctc 120

acgctcggcc ttgagcttgt caagaaccca ggcgtacttg aaggaaccct taccgagctc 180

agcggcttcc tattgtcgga tggttagtga ctgcttgaca cgtgacgatg agctcagtga 240

ggttgtggaa tgggagaggg cagaaacgcg ccgctcgagt ggcggggtaa atgccccacc 300

agaaaaaatt acggtcgtat cgcaaaattt ttgggctcga gcggggtagc gggtacgttt 360

cgagtcgtag gggggaatcg atgggcaaag aacgcgcgat agaaggaaaa gtgactaacc 420

ttctcgaact tctcgatggt tcgcttgtcg ataccaccgc actggtagat caagtgaccg 480

gtctgtgaag cgatgtcagc atgttttctt tgagaaatcc cccgccaggt cttggccggg 540

tttacgatgg ccgataagct catcgtcaag ggtagtactc acagtggtcg acttgccaga 600

gtcaacgtgg ccgatgacga cgacgttaag gtgagtcttg ttcccttttc cc 652

<210>17

<211>652

<212>DNA

<213> Fusarium verticillium (F. vertetillioides)

<400>17

tgatgtgtta gtaataggag atatagaacg gagtaagagc gacaacatac caatgacggt 60

gacatagtag cgaggagtct cgaacttcca gagagcgata tcgatggtga taccacgctc 120

acgctcggcc ttgagcttgt caagaaccca ggcgtacttg aaggaaccct taccgagctc 180

agcggcttcc tattgtcgga tggttagtga ctgcttgaca cgtgacgatg agctcagtga 240

ggttgtggaa tgggagaggg cagaaacgcg ccgctcgagt ggcggggtaa atgccccacc 300

agaaaaaatt acggtcgtat cgcaaaattt ttgggctcga gcggggtagc gggtacgttt 360

cgagtcgtag gggggaatcg atgggcaaag aacgcgcgat agaaggaaaa gtgactaacc 420

ttctcgaact tctcgatggt tcgcttgtcg ataccaccgc actggtagat caagtgaccg 480

gtctgtgaag cgatgtcagc atgttttctt tgagaaatcc cccgccaggt cttggccggg 540

tttacgatgg ccgataagct catcgtcaag ggtagtactc acagtggtcg acttgccaga 600

gtcaacgtgg ccgatgacga cgacgttaag gtgagtcttg ttcccttttc cc 652

<210>18

<211>651

<212>DNA

<213>F. andiyazi(F. andiyazi)

<400>18

tgacatgtta gtaagaagag atgtagaatg aagcatgagc gacaacatac caatgacggt 60

gacatagtag cgaggagtct cgaacttcca gagagcaata tcgatggtga taccacgctc 120

acgctcggcc ttgagcttgt caagaaccca ggcgtacttg aaggaaccct taccgagctc 180

agcggcttcc tattgtcgaa tgtttagtga ctgcttgaca cgtgacgatg cgctcagtga 240

ggttgtggaa tgggagaggg caaaaacgcg ccgctcgagt ggcggggtaa ataccccacc 300

aaaaaaatta cggtcatatc gcaaaatttt tggactcgag cggggtagcg ggcacgtttc 360

gagtcgtagg gagaaatcgg tggacaaagg acgcgcgatc gaagggagtg tgactaacct 420

tctcgaactt ctcgatggtt cgcttgtcga taccaccgca ctggtagatc aagtgaccgg 480

tctgtgaagc gatgtcagca tgttttcttt tgaaaatacc ccgccaggtc ttggtcggga 540

atacgatggc cgataagctc atcgtcaagg gtagtactca cagtggtcga cttgccagag 600

tcaacgtggc cgatgacgac gacgttaagg tgagtcttgt tcccttttcc c 651

<210>19

<211>652

<212>DNA

<213>F. andiyazi(F. andiyazi)

<400>19

tgacatgtta gtaagaagag atgtagaacg gagcataagc cacaacatac caatgacggt 60

gacatagtag cgaggagtct cgaacttcca gagagcaata tcgatggtga taccacgctc 120

acgctcggcc ttgagcttgt caagaaccca ggcgtacttg aaggaaccct taccgagctc 180

agcggcttcc tattgtcgaa tggttagtga ctgcttgaca cgtgacaatg cgctcagtga 240

ggttgtggaa tgggagaggg cagaaacgcg ccgctggagt ggcggggtaa atgccccacc 300

aaaaaaatta cggacatatc gcaaaatttt tggactcgag cggggtagcg ggcacgtttc 360

gagtcgtagg gagaaatcgg tggccaaagg acgcgcgatc gaagggattg tgactaacct 420

tctcgaactt ctcgatggtt cgcttgtcga taccaccaca ctggtagatc aagtgaccgg 480

tctgtgaagc gatgtcagca tgttttcttt tgagaaacac ctcgccaggt cttgggcggg 540

tttacgatgg ccgataagct catcgtcaag ggtagtactc acagtggtcg acttgccaga 600

gtcaacgtgg ccgatgacga cgacgttaag gtgagtcttg ttcccttttc cc 652

<210>20

<211>1029

<212>DNA

<213> Fusarium fujikuroi)

<400>20

atgcctcata aagataatct tcttgaatcg ccagtgggca agagtgtcac tgctactata 60

gcctaccata gcggaccggc tcttccaacc tccccgatcg ctggtgtcac tacgctccaa 120

gactgcactc agcaggccgt agcagtgact gatatccgcc cttcagtctc gtcctttacc 180

ctagatggta acggcttcca ggttgtcaaa catacatcgg cggtaggctc tccgccgtat 240

gatcactcgt cgtggacaga tccagtcgtt cgcaaggaag tgtatgaccc cgaaatcatt 300

gaactggcaa agtctctcac tggagccaag aaggtcatga ttctacttgc ttcgtctcgg 360

aatgttccct tcaaggagcc agagctcgcc cctccttatc ccatgcctgg caaatcaagc 420

agcggcagca aggaaaggga agccatccca gctaatgagc tccctactac aagggcaaaa 480

ggtttccaaa aaggcgaaga ggaaggccca gtacgaaagc ctcataagga ctggggtcca 540

tccggtgcgt ggaacactct ccggaactgg agccaagagc tcattgatga ggctggcgat 600

atcatcaagg ctggcgatga ggctgcaaag ctgccagggg gcagagcaaa gaactaccaa 660

ggcagacgat gggccctgta tactacctgg cgtccactga aaactgtcaa gcgggatccc 720

atggcctatg tagactactg gacagctgat gaggaagatg gcgtgagctt ctggcgtaac 780

ccgccagggg tgcatgggac atttgagtcg gatgtactac ttaccaaggc taatccaaag 840

cataagtggt actggatcag tgaccagact ccggatgagg ttctcctcat gaagatcatg 900

gacaccgaga gtgagaagga cgggagtgaa atagcgggag gggttcacca ctgttcattt 960

catctgccgg gaactgagaa ggaggaagtg agagagagca ttgagaccaa gttcattgca 1020

ttctggtag 1029

<210>21

<211>1655

<212>DNA

<213> Fusarium fujikuroi)

<400>21

atgccgctaa tggacgttca ctggctgatc tacgtggcct ttggcgcttg gttatgctct 60

tatgtcatcc atgtcctatc gtcctcttct acagtcaaag tgcccgtcgt aggctaccgc 120

agcgtctttg agcctacatg gcttctccgt ttgcgctttg tttgggaagg gggatctatc 180

atcggccaag gctacaacaa agtaagcgat tccttctaca gccatgtaac catatctcat 240

ctatctatag tttaaagact ctatcttcca ggtgcgaaag cttggtaccg atatcgtcat 300

catcccgcca aactacatcg atgaggtcag aaagctgtcc caagacaaga ctcgctcggt 360

cgagcccttc atcaatgact ttgcgggaca gtatacacgg ggcatggtct ttctgcaaag 420

tgatttgcag aaccgtgtga ttcagcagcg gttgacgcca aaactcgtat cgttgacaaa 480

ggtaatgaag gaggagcttg actatgcctt gaccaaagag atgcctgaca tgaagagtga 540

gaatgtctcg acttttgaac tagatcaata aatgctgatg gttcttagat gatgaatggg 600

ttgaagtcga catttcttcc atcatggtca ggctcatatc acgcatctca gccagagtgt 660

ttctcggtcc agagcactgc cgcaaccaag aatggttgac gaccactgca gagtacagcg 720

agagcctgtt cataactggc tttattctcc gcgttgtccc ccatattcta agaccattca 780

tagccccgct gctaccctcc tacagaacac tacttcgcaa cgtctcgtca ggtcgaagag 840

ttattggaga catcattcgc tcccagcaag gtgatggcaa cgaggacatc ctgtcatgga 900

tgagggatgc tgcgacaggg gaagaaaagc aaattgacaa cattgcccag cggatgctta 960

tcctgagtct cgcgtctatt cacactacgg caatgacgat gacgcatgct atgtatgact 1020

tatgtgcttg ccctgagtac atagagcctc ttagagatga ggtcaaaagt gtcgttggcg 1080

ctagtggttg ggacaagacg gcgttgaatc gattccacaa actcgacagc tttctcaaag 1140

agtcacaacg cttcaacccc gtgttcctct gtaagtcctt ctccatcttt agctcttcta 1200

ggatctggct gaaacctata gtaacgttca atcgcattta tcaccaatcc atgacactct 1260

cagatggcac caacatccca tcaggcactc gcatcgcggt tccctctcac gcgatgcttc 1320

aggactcagc gcatgtccca ggcccgacgc caccaaccga gtttgatgga tttagatact 1380

caaagattcg ctcagactca aactatgcac agaaatatct cttctccatg actgattcta 1440

gtaacatggc gtttgggtat gggaaatacg cctgcccagg gcggttctat gcatctaatg 1500

agatgaagct gactttggcg atactccttt tacaatttga gttcaagttg ccagatggga 1560

aaggaagacc acgaaatatc actattgata gtgacatgat acctgatccg agagctaggc 1620

tgtgcgttag gaagcgatca ctgagagatg aatga 1655

<210>22

<211>1479

<212>DNA

<213> Fusarium fujikuroi)

<400>22

tcaaatcgca atctcctcct ttctgcgacg aacagataac tttgcagttg ggttggcatt 60

catgttgagg ccatacttcc tcggctccat gctcgacccc tcaacaggct tgaagtcgta 120

cttgagcaga atgtgagaca gtgcaatctt gatctcctca gacgcaaaga accgtccagg 180

acaggcatga agcccgtacc cgaagcccat gtgatccgga gtggcactca cgagctgtgc 240

tttgctctct ttgcctggct cgcgccgcatgttgaagaaa cggtatccat cgaacttcag 300

gggatccttg tagtactctg gatcccagtg ttgatgggct gatacaagcg tgagtttgtt 360

cttgggtagg atgacgccat cggataactt gacgttgtgc gttgtgaatc ggcgcatgct 420

tgctagtact gttttttagt gcgtgctatc accccaagct aggaactgga tacgtaccaa 480

tggctatggg cttcagtcgt tgactctctt tcaggacgct gtccatgagc ttcaggttgt 540

acagcgagtt ctttgaccat ccctgcttcc ccaaaacagc tatgatctcc tcgcgcaaag 600

gctcgataag ctccggattc tgcgcaatgt caaacatgac ctgggtaaag aaatcagtag 660

tactatgtaa agcagccact gagagcgaga gctgagcaca agcggggtca tatccaacac 720

ccttttcacg cgcaaggtca tccaaccact caacagcatc gttgtaggtg accttctctc 780

cagttctctc agcctcagct ttctcttcgc gtcgccgctc aagaagcggg ttgataaggt 840

ctcttgcttc ttggactagg gctcgggact gtgtgcagtg cggcatgaac cactggacta 900

caggccggag ccacgatggc cagagacgca gttcttctac tgcacggaag gcgatgacgg 960

cgtaggtaga tgtaattcta agccactggg ggtttcgaca catctcctta ccgaggaata 1020

ctcgagaggt gatgcgggcc atgagtttca tgtttgcgtc tttggcggtg atgtcgtgcc 1080

attctgcgag actgatttag cgactgactc ttgcaagcag cgcatggacc atacctggac 1140

tatctgtgta cacatctttc aacaccaagg cgcactcttc agagactgct cccgtcacca 1200

gagtcaactg atgagtcaat tgatgtcgcg caaccagctt catgatgtga ctctcgttgg 1260

taccctctct gaagccctca aacccaggaa gatgagcata aaaccactat tctcagacgt 1320

cagccacatc ttgatcccgt actttgagct actcaccttg aaagctgcca tggtgaagct 1380

gagcttttca ttattgcgaa cctcgtaggc gtactttggc ggcaggatgt gcagctcccc 1440

gacatcgccc atgattcgaa atggcttgtc ggggctcat 1479

<210>23

<211>1903

<212>DNA

<213> Fusarium fujikuroi)

<400>23

tcaaattgct tccaaatcca actcaactga ctcccgacgc ttgatcaaga tgtccgtgac 60

agggctggac ttggcaatca tgcccctggt atcaggcttg gtctccgtgt cagggcacag 120

cttccaatca tacttgacca agatgtggca tagcgctact ttgatctcat tcgcagcgaa 180

gaaacgccct gggcatgagt gctgaccgtg gccgaagccc atatggtttg agccagttga 240

tactagctgt gccccatggt ctttcccggc ttcggagcgc atgtcgtaga agcgataagg 300

attgtaaacc tcggggttat cgtagatttt gggatcgtcg aggcgtctgt tgtcaacgtt 360

gaggcgggtc ccttttttga gggctaggca aaggaagggt tagtcagaaa tgcaggtgga 420

atgtgggatc tactaactca ggccgctaga gagggtgatg tcttcggtta cgtagcgacg 480

catggtaact gtattgcgag tgtcagtagt actcaagaaa ccgttggaaa gtccatacct 540

atgcttccag gcttcattcg ctgagactct ttgatagcac tgtcaaggag cttcatcttg 600

aaaagcgttg ttttcttcca accttcttca cgaagaagtt gaacaacttc ctgtctaaga 660

ggctcgatat actctgggtg gcgaccaagg tcaatcatcg tttgctggag gagatcatac 720

gtcgtatgaa ttgccagaag agagagcgta agctggaaga tcacggggtc aaacgaggcc 780

cctgtgcctg cagcttctgc ctcctgttcc gaccagtcaa tagcgtcgtg gaacacaggc 840

agaggctgac cagctgcgat cgcagctctt cgaagctcac ggcggcgctc aatcagtggc 900

gtaataatac cgattgcatc cttgcgctcc tgtcgaagct ttctgcattc ggggaggaac 960

cagtgggcga gaggacggat cgatcgagga aacattcgga ggttggtaga tgcagtgtag 1020

aagttggtgg tgtatgtctt tgtgatcttc agccaagctt cgttgcggca tagttggtcg 1080

ccgagataga ttctggacga gatgcgggcg atgatgtcta gaattgcggg cttgaggcgt 1140

atcgctcgcc attctgtatt tttggtgggt tagtgatagc tcttggctga tgagcatcgg 1200

aaagagactt gcctgttgtc tctccaaagt tgagcgacac tgcgagggtg gactctctag 1260

atagtggctc tatgacagcg gcttcttctt gttagtgtat ggtcctcact cgctagggat 1320

gaaaggtctc acaaagatgc ttggtcaact gctttcgggc caccttctga ataagttggt 1380

cttcacgacc caccagggca acagtctcaa agccaggtat tccagcatga ttatcctatg 1440

gcacaaggtt ttgtattcag cgctccagaa atccaaggtg ttgttagggg tacttacctg 1500

catcgccgcc ttggagaagc tcagtctcgg atcatttcta atctcatctg caaagtctgg 1560

ggggagaatg agaacctcac cccagtccgt aatcaagcga aatggctcat tagggaacaa 1620

gctcctcgct ttagcgagaa tttctctact aagcttgaca aaactcctct atagacaaag 1680

tcagtttccg cttggttgtc tcgtcaacag atggtcagac cctggtttta ccggtgccga 1740

acagtgagtc gggcgggttc gcaagtggca ccactgagcc cttgcgcaat tctagccaag 1800

agaagcggat tgcccatggg actaaagtaa agacgaatat ggcgatgtag aagggcaaaa 1860

gttggctacc cgcatagctg gtgatcatattgaagatgct cat 1903

<210>24

<211>1445

<212>DNA

<213> Fusarium fujikuroi)

<400>24

atggctgaac aacagatctc caaccttctt tcaatgtttg atgcttctca cgcaagccag 60

aagttggaga ttacggttca gatgatggat acctaccatt acagagaaac tcctccagac 120

tcttcctctt cagaaggcgg ttccttatct cgctatgatg agcgacgggt ctcccttccg 180

ctctctcaca atgcagcctc cccagacata gtctcccagt tatgcttctc aacagctatg 240

agctcggagc tcaatcacag gtggaagtca cagcgcctca aggtgagtcg agatcgccct 300

catcccttta caatcacttg ctgagtatcc aggttgctga ctctccctac aactacatcc 360

tgactcttcc atctaaaggt attcgtgggg ctttcattga ctcactgaat gtctggctcg 420

aggtccccga agacgagacc tcggtgatca aagaggtgat tggcatgctc cacaactcgt 480

ctctcatgtt tgtatcccaa tctgttattg ctagagaccc tgctgacaat caagaatcga 540

tgacttccaa gacaactccc cacttcggcg gggcaagcca tctacacata ctgtcttcgg 600

tccagcacaa gcaatcaaca cagcaacata tgtcatcgtc aaggccatcg agaaaataca 660

ggatatcgtc ggtcacgatg cattggcaga tgtaactggc actataacca caatcttcca 720

gggtcaggca atggatctgt ggtggactgc taatgccatt gttccgtcta tccaagaata 780

tctcctgatg gtcaatgaca gtaagatgcc cctgtttatt gtggtgagac atagactaac 840

ttgcgttcct gcagagactg gtgccctgtt caggttatcg cttgaactac tggcgctgaa 900

ctctgaagca tccatcagtg acagcgcgct tgaatctctc agcagcgctg tctcactgct 960

cgggcagtat ttccagataa gagatgatta catgaatctc attgacaaca aggttcgatc 1020

cccacagccc acttcttgtc ttcggttacc agtaaaggag gtccacctct cggcactttg 1080

acctatctcc actatgttcc agaccctctg ctaaccactc tcagtatact gatcagaaag 1140

gattttgcga ggatctggac gaggggaaat actcgttgac tctaatccat gctctgcaga 1200

ccgactccag cgaccttctc accaacatct tatcgatgag aagagtccaa ggaaaactta 1260

cggcgcagca aaagatgctg gttttggaag tgatgaaaac aaacggcagc ttagactgga 1320

cgagcaaact ccttggcatg ctgcacacaa gagttgtagc cgagattgag agcctggaag 1380

ttagcacgaa gagggataac catgcattga gggctttagt ggaacgcctg aagctggaaa 1440

cctag 1445

<210>25

<211>3056

<212>DNA

<213> Fusarium fujikuroi)

<400>25

tcacttcatg ctgcttgaaa ggtccttgat cacgtaaagc tgatcataca agtcggtgac 60

atcacagaac agttttacaa tcttgagctt cctcatatcc ttagacccag cacgatcacc 120

tgcatcatca cgagactgtc gttccagagc ttcgagagca cgatcaagat aaccttgctc 180

atacgtagct atctttaaaa gtctctcttt cctttcatcg agattctgtg acgttccgtt 240

acataacgtg aactcgggga agtggatcga gttcacattc cgctcagcgt tatcgcgagc 300

tatggaccca aagtcgttgt acatacgaca catatttgta gcgtgacgca taacggatga 360

aatgagatat ttctgagtgc cggagggaaa tgcgtccttg ccttggagca gattcgctga 420

cattaggcag ttggagaaag cgaatgagta cgcgcaggcg acgtgactgc ctcctgtact 480

gttgacccat tggaagtacg attgttctgg ggaagagaaa gcgtcgctgg aggcctgctt 540

ggagaagcga ctgttgtcct ctatctgtgt gatatgggca tgcatgaacg ttctgaattc 600

tcggcgaaga gtgtcttggt cagaagagct tgaattcaga acatctttgt ggttgagcac 660

gctgttggtg aagcgagtga gagtatcctc aacttgtcca atgttgggtg actcatgctg 720

atgaccattg ccactgtgca cggtaccatt ggccctggct aagtttccca ttgtgttgtc 780

tatgaccttg tcgatggtct ggtgaagcag agagacatca ccgaataccg gcccagcgac 840

agcttccatg tactcatcgg tctggtagcc caggagggac aggtacatca tatcgtagag 900

ccatctgtta gatgcaaatg tgcgggatct gttgttgcat ccgacccaag taaaaggaat 960

gatgctcagg tatttgtcct cgtcgacctt gatgttgtcc ctcggataaa tctcaacgcg 1020

ctgagcttgt agaaggggca cgaagaacga ggactcaatg attgacgcca tgagtcccca 1080

ctcgtccagt ggcgagaaca aagcagtctt gcgcacaagc ctcatgtact tctccaagtc 1140

cgatgatgga accgccgagg tgacgctgtg gccaatagta gcggcgggca cctctaggct 1200

tgctgactga agggctgcta gcttgtacgc ttcagcaaca aacccaacct catatgctgt 1260

ctttgacgtc caagtgaggt cctgagaatg aaagctgcag gacttgagcc acgaaaagcc 1320

acggtcgacg caactctgta gcctgtccac catgtgagtg aagaaacata catggcgtgc 1380

ctgtacaaga gctagaatgg cgtagcatgt ttgctcgcga tatcctctcc aagatccgtc 1440

gttatcttgg gtgaggatga tacgtagtac agcctggaag attgacaggc cgatcttgca 1500

cttgaagctc tcgtcaaaga gactagaaag ctcgccacca tcaatgagat gaagtacctc 1560

ggtgaaagct tccaccagaa gcatggttgg gtatagatga ctcaaattct agaatagtta 1620

gcgagtgctt ctactagttg ggaagcagaa ctcacccatt tatctttgac gcaatggtcg 1680

ctgccccacc accatcggca agtgaacaac gtggtcttca ggatttgtgg gtggtattgc 1740

gatagattgg actgcttcag gagactcagc agcacatgga ggttggaagt caagctggga 1800

tcacgttcag atccgaacgt ggtgaagtga tcttttcctt caaagacctt gatcatgata 1860

tctgggctga caggttgatt gacaaggctc aatgccagaa gagcttttgc agtgtcatca 1920

acatcagcag tacggggtgc tgtactgtag ttagtctcca tggtacgata atgaaattgg 1980

ggcattctaa ccaaagccaa ttactccatt ctcgtccctc aacgcttcga gaagtatagt 2040

tgacaagccg cgcaagccat caccatcgat ttgtttcaaa gtgaagccac ccttcaggag 2100

tgtcgctatg atctaaaacc aaacttagca gccagaaggc gaaaataact agaacactta 2160

cccagctaca ctcaaaatgt gttgtaggaa aggtgcctga gatgccacca ttcccgtgac 2220

cagcaccatt tctcataacg tgcctcaggt aatcttcagc ctcgtcgtcc cacttggttg 2280

caccaatgag gtaggctgca gtggaagaag gtgaagccat catagagcca tgataaagat 2340

ggtgagaaag gcgatcaaag tcaagctttc caagaaaggc ttcaagggag tgaagtagtg 2400

aagacggctt gccatatact tgctccaaat cgaaatggcc gagcttctct ccgtgcatcc 2460

tctccaagat acttctgcaa ggaaactcaa aagatggcac gtcgagctct ttctcaagca 2520

tggaaagtaaagctggaata ataaactcga caccaatgtg attggtatct tcaacatcgt 2580

tccaaacagc tagctgtcgc ttcaaagaag ttaccccgtg ctcgatcctg agacccatct 2640

cgtctggcga gacgtccagt atctgcagag gctcttgtgc gtgacataag agtgcaagca 2700

cagctgaagc agtgtctaga ataccagcag tctgggtcgt ggggagacta ccccaactac 2760

catcagcggc ctgagtcttc agaagatagt ggaagcactc aggaaacagc cattgcttga 2820

cattgtctct cgtcttgggt atcatggcca cccaagcagt gtcatatacc tgacagctgg 2880

tggaacatag accatagtag ctatgatggc tcttgaaggc gcggtccagc agcgactttg 2940

ctgctgatac aaagtcattt cctgtcttga ggtctttggg ggtgccgttc tcgattttgc 3000

cacttggata ggttagaatg tgcatcagct aaaggtgtgt ttcatacgta cggcat 3056

<210>26

<211>1794

<212>DNA

<213> Fusarium fujikuroi)

<400>26

tcatctcctt cgcatctcaa gaccagcttt ggtatccagc cgagtctccg tcccaacacg 60

catcaactca ggccctggct ttccatcctc aagtctaaaa tcatactttg ccaatagttc 120

tatgagtatc atcttgatct cagatatggc aaagaacctc ccagggcatg catgctttcc 180

atggttgaag atcagatagt caggacctgt agtggctgcc tggtgttgtg acccctgtcc 240

tttgatagat cggagattca agtaccggaa cccgtcaaag attcgaggag acgggttctc 300

gaagtcagag ctaaagtctg gcgagaatgt tggcgtttcc tccgacatgc tgttagatag 360

ttagtacagt aactattgac aaggggaagg gatggaaata ctggattgcg tgagcgggga 420

atgctataga agttcctctc tgtagcttga taccgtttga tagtgtcatt gacttcatga 480

cgcgtctgct tggagtcact gaaccattct gttagtgcct cttgcattac cagcatatgt 540

gctttagact taccaaatgt tgaagggcac cagcgctgga cctctctaat gaagctatcc 600

aacttgtgga gcctagaaag agcctctttg ttgatgcata tgtctggtga tacggcatca 660

ggtccaaaga catcttgcat ctcggttctc aacggctcga tgtactccgg ccgcttaaca 720

agctcccata ctacctttgt gagggccatg gctacccaag gtaacaagat cagaaacata 780

aacctagtat tgcggtttaa ataacttact cgtagtgtgg attgcggcga acgagaccag 840

catttgatct agcccgacct gctctggggt tctgagctcc tcaggtaagt gccgaagaag 900

ccatgagata aatgtacctc gcccttccgt ctgatccgct agaagtgtat ctgctcgatg 960

ttgcttttca tcttgtaaag cttgggagat cagaggagcc attatctctg ctgcgaagcg 1020

tagatgtctt cgcaccgaac ggacgctggg taaaaacggc ccaatgattg gtctcagcac 1080

cggactccag gtaaagagct gatcgcgaat tgagacacat tgaacagtgt agcctatgga 1140

agcttgtagc cagccttcat cgcgacacaa gggcagacca acaaacgctc tgccactcaa 1200

aagcgccacg gtccttagca tcatgtcata taaagataca gatgaccatt tgcttgttct 1260

aggccactga tcggaagcat atgttaactc atcctgtaat tccagtatga tgttgggcat 1320

atttcgagtc aagtcctggc gaatagtggc gggaatctca ggtctgatgg tggtaatgtg 1380

ggtgtacttg ccctgaaact tgtcttcatg ctccacaatg atggaaatat attcatttgg 1440

catgttgtgt atttcatgaa agacggacat tggtaggatg agcagtggtg ggcgtgatcc 1500

agccaagaag aagggcgagt cacgatactg cgctgtttag agacaagtga gtctggaaat 1560

catatgactt acctgctgca tccccttgat gaggttcttc tccaacgatt gtgcgtgggt 1620

atcgcctact acagggtatg gcaaggtcgg tttactcgaa gactgcttgt agatccacca 1680

agagaatgct aagagtcctg tagcgccgca aagggcggcg aacgccaccg cgatacgcaa 1740

aacccgtgag ccagtgagct ccagaggctc aatcaacgtc acaaaattac tcat 1794

<210>27

<211>16

<212>DNA

<213> primer (primer)

<400>27

ggctcttcca acctcc 16

<210>28

<211>16

<212>DNA

<213> primer (primer)

<400>28

gatggcttcc ctttcc 16

<210>29

<211>16

<212>DNA

<213> primer (primer)

<400>29

ggctcttcca acctcc 16

<210>30

<211>16

<212>DNA

<213> primer (primer)

<400>30

ccgctatttc actccc 16

<210>31

<211>16

<212>DNA

<213> primer (primer)

<400>31

aggcccagta cgaaag 16

<210>32

<211>17

<212>DNA

<213> primer (primer)

<400>32

tgaacagtgg tgaaccc 17

<210>33

<211>16

<212>DNA

<213> primer (primer)

<400>33

atgccgctaa tggacg 16

<210>34

<211>16

<212>DNA

<213> primer (primer)

<400>34

ttcgcacctg gaagat 16

<210>35

<211>18

<212>DNA

<213> primer (primer)

<400>35

gtcaaagtgc ccgtcgta 18

<210>36

<211>16

<212>DNA

<213> primer (primer)

<400>36

gtcgcagcat ccctca 16

<210>37

<211>16

<212>DNA

<213> primer (primer)

<400>37

tcccatcagg cactcg 16

<210>38

<211>16

<212>DNA

<213> primer (primer)

<400>38

cgcttcctaa cgcaca 16

<210>39

<211>17

<212>DNA

<213> primer (primer)

<400>39

ctgcgacgaa cagataa 17

<210>40

<211>18

<212>DNA

<213> primer (primer)

<400>40

cctacccaag aacaaact 18

<210>41

<211>20

<212>DNA

<213> primer (primer)

<400>41

gtgagtttgt tcttgggtag 20

<210>42

<211>16

<212>DNA

<213> primer (primer)

<400>42

tggtgacggg agcagt 16

<210>43

<211>16

<212>DNA

<213> primer (primer)

<400>43

tgacggcgta ggtaga 16

<210>44

<211>15

<212>DNA

<213> primer (primer)

<400>44

acaggttcgc aataa 15

<210>45

<211>16

<212>DNA

<213> primer (primer)

<400>45

agggctaggc aaagga 16

<210>46

<211>16

<212>DNA

<213> primer (primer)

<400>46

gtcgccaccc agagta 16

<210>47

<211>16

<212>DNA

<213> primer (primer)

<400>47

gtcaatagcg tcgtgg 16

<210>48

<211>17

<212>DNA

<213> primer (primer)

<400>48

tgagaccttt catccct 17

<210>49

<211>20

<212>DNA

<213> primer (primer)

<400>49

tctccaaagt tgagcgacac 20

<210>50

<211>16

<212>DNA

<213> primer (primer)

<400>50

tgccacttgc gaaccc 16

<210>51

<211>16

<212>DNA

<213> primer (primer)

<400>51

cggttcctta tctcgc 16

<210>52

<211>16

<212>DNA

<213> primer (primer)

<400>52

atggcattag cagtcc 16

<210>53

<211>16

<212>DNA

<213> primer (primer)

<400>53

cttcggtcca gcacaa 16

<210>54

<211>16

<212>DNA

<213> primer (primer)

<400>54

tccagatcct cgcaaa 16

<210>55

<211>18

<212>DNA

<213> primer (primer)

<400>55

actatgttcc agaccctc 18

<210>56

<211>16

<212>DNA

<213> primer (primer)

<400>56

atccctcttc gtgcta 16

<210>57

<211>17

<212>DNA

<213> primer (primer)

<400>57

gattcgctga cattagg 17

<210>58

<211>16

<212>DNA

<213> primer (primer)

<400>58

gtcggatgca acaaca 16

<210>59

<211>18

<212>DNA

<213> primer (primer)

<400>59

cgctgacatt aggcagtt 18

<210>60

<211>16

<212>DNA

<213> primer (primer)

<400>60

cgcaatacca cccaca 16

<210>61

<211>18

<212>DNA

<213> primer (primer)

<400>61

agggagtgaa gtagtgaa 18

<210>62

<211>16

<212>DNA

<213> primer (primer)

<400>62

ctatccaagt ggcaaa 16

<210>63

<211>16

<212>DNA

<213> primer (primer)

<400>63

cctggtgttg tgaccc 16

<210>64

<211>16

<212>DNA

<213> primer (primer)

<400>64

ccgttgagaa ccgaga 16

<210>65

<211>16

<212>DNA

<213> primer (primer)

<400>65

cggcatcagg tccaaa 16

<210>66

<211>16

<212>DNA

<213> primer (primer)

<400>66

gtggcagagc gtttgt 16

<210>67

<211>16

<212>DNA

<213> primer (primer)

<400>67

aatagtggcg ggaatc 16

<210>68

<211>16

<212>DNA

<213> primer (primer)

<400>68

ctggctcacg ggtttt 16

<210>69

<211>19

<212>DNA

<213> primer (primer)

<400>69

cttcctgcga tgtttctcc 19

<210>70

<211>26

<212>DNA

<213> primer (primer)

<400>70

aattggccat tggtattata tatcta 26

Claims (8)

1. A method for quickly detecting the generation of small gibberellin seeds in the bakanae disease of paddy rice includes such steps as Fusarium graminearum, Fusarium proliferatum, Fusarium pseudoverticillarum and Fusarium graminearumF. andiyaziIt is characterized by aiming at fusarium graminearum, fusarium laminarium, fusarium verticillioides andF. andiyazidesigning specific primers according to the specific gene difference, performing multiple PCR amplification by using the specific primers and the DNA of a sample to be detected as a template, and judging the generation of the gibberellin microspecies in the rice bakanae bacteria according to the amplification result.

2. The method according to claim 1, wherein said Fusarium graminearum, Fusarium proliferatum, Fusarium pseudoverticillium and Fusarium graminearum are selected from the group consisting of Fusarium graminearum, Fusarium proliferatum, Fusarium solani, Fusarium graminearum, Fusarium paraverticillium, and Fusarium graminearumF. andiyaziThe specific genes of (A) are: gibberellin synthesis regulation and control as shown in SEQ ID NO.1GA20oxGene, gibberellin biosynthesis shown in SEQ ID NO.25CPS/KSGenes and calmodulin genes.

3. The method for rapidly detecting the production of a gibberellin microspecies in bakanae disease of rice as claimed in claim 1 or 2, wherein the specific primers comprise: gibberellin synthesis regulation of nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3GA20oxGene specific primers; biosynthesis of gibberellins with nucleotide sequences as shown in SEQ ID NO.59 and SEQ ID NO.60CPS/KSGene specific primers; the calmodulin gene specific primers of the nucleotide sequences shown as SEQ ID NO.69 and SEQ ID NO. 70.

4. The method for rapidly detecting the generation of the race gibberellin in bakanae disease of rice as claimed in claim 3, wherein the multiplex PCR amplification conditions are as follows:

the multiplex PCR reaction system is as follows: sample genomic DNA100ng, three pairs of positive reverse primers 10. mu.M each and 1. mu.L each of the three pairs of positive reverse primers are includedGA20oxGene specific primer,CPS/KSGene specific primers and calmodulin gene specificityPrimer, 2.5 mMdNTPs 4. mu.L, 10 XPCR buffer 2. mu.L, 5U/. mu.LTaqPolymerase 0.4. mu.L, plus ddH₂O is complemented to 20 mu L;

the PCR amplification procedure was: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 10s, annealing at 54 ℃ for 40s, extension at 72 ℃ for 80s, 35 cycles; finally, extension is carried out for 10min at 72 ℃.

5. The method for rapidly detecting the generation of the race gibberellin in the bacterial pathogen of rice seedling as claimed in claim 4, wherein the determination result is: when the PCR amplification product presents 1327bp and 848bp bands, judging the sample to be fusarium graminearum; when the PCR product presents a 1327bp single strip, judging that the sample is Fusarium proliferatum; when the PCR product presents a 578bp single band, judging the sample to be fusarium verticillioides; when the PCR product has no strip, judging the sample asF. andiyazi。

6. The method for quickly detecting the generation of the gibberellin microspecies in the rice bakanae bacteria is characterized by comprising the following steps of:

1) extracting whole genome DNA of a sample to be detected;

2) performing multiplex PCR amplification by using a sample DNA to be detected as a template:

the multiplex PCR reaction system is as follows: sample genomic DNA100ng, three pairs of positive reverse primers 10. mu.M each and 1. mu.L each of the three pairs of positive reverse primers are includedGA20oxGene specific primer,CPS/KSGene specific primers and calmodulin gene specific primers, 2.5mM dNTPs 4. mu.L, 10 XPCR buffer 2. mu.L, 5U/. mu.LTaqPolymerase 0.4. mu.L, plus ddH₂O is complemented to 20 mu L;

the PCR amplification procedure was: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 10s, annealing at 54 ℃ for 40s, extension at 72 ℃ for 80s, 35 cycles; finally, extending for 10min at 72 ℃;

the above-mentionedGA20oxThe gene specific primers are shown as SEQ ID NO.2 and SEQ ID NO.3,CPS/KSThe gene specific primers are shown as SEQ ID NO.59 and SEQ ID NO.60, and the calmodulin gene specific primers are shown as SEQ ID NO.69 and SEQ ID NO. 70;

3) judgment by amplification result

Will expandSeparating the amplified product by using 1.5% agar gel electrophoresis, after separation, determining the result according to the size of the amplified product by ethidium bromide staining under an ultraviolet lamp, and when the PCR amplified product presents 1327bp and 848bp strips, determining that the sample is fusarium granatum; when the PCR product presents a 1327bp single strip, judging that the sample is Fusarium proliferatum; when the PCR product presents a 578bp single band, judging the sample to be fusarium verticillioides; when the PCR product has no strip, judging the sample asF. andiyazi。

7.GA20oxGene specific primer,CPS/KSApplication of gene specific primers and calmodulin gene specific primers in rapid detection of gibberellin race produced in Fusarium graminearum, wherein the Fusarium graminearum, Fusarium laminar flow, Fusarium verticillium and Fusarium graminearumF. andiyazi。

8.GA20oxGene specific primer,CPS/KSThe application of the gene specific primer and the calmodulin gene specific primer in early diagnosis of rice bakanae disease.

Images