CN110760604B - Padlock probe for pecan anthracnose pathogen and detection method thereof - Google Patents

Padlock probe for pecan anthracnose pathogen and detection method thereof Download PDF

Info

Publication number
CN110760604B
CN110760604B CN201910879229.XA CN201910879229A CN110760604B CN 110760604 B CN110760604 B CN 110760604B CN 201910879229 A CN201910879229 A CN 201910879229A CN 110760604 B CN110760604 B CN 110760604B
Authority
CN
China
Prior art keywords
probe
pecan
detection
anthracnose
ppl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910879229.XA
Other languages
Chinese (zh)
Other versions
CN110760604A (en
Inventor
赵玉强
田艳丽
朱灿灿
陈于
王敏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Botany of CAS
Original Assignee
Institute of Botany of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Botany of CAS filed Critical Institute of Botany of CAS
Priority to CN201910879229.XA priority Critical patent/CN110760604B/en
Publication of CN110760604A publication Critical patent/CN110760604A/en
Application granted granted Critical
Publication of CN110760604B publication Critical patent/CN110760604B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a method for detecting anthracnose germs of carya cathayensisColletotrichum gloeosporioides) The padlock probe and the detection method belong to the field of biotechnology. The method is characterized in that the sequence of the probe P-Ppl is as follows: 5'-TTGAGTCTTTGACTAGGACTCAGTTCTCCTCGACCGTTAGCAGCATGACCGAGATGTACCGCTATCGTacgtcgtattaggtagtcacATCCAGAACGTATG-3' for P-Ppl. The pecan anthracnose germ detection kit based on the probe has stronger specificity and stability, the sensitivity is 50 spores per ul or 100 pg/ul DNA at the lowest, and a quick, sensitive and specific technical method is provided for pecan anthracnose germ detection.

Description

Padlock probe for pecan anthracnose pathogen and detection method thereof
Technical Field
The invention relates to a method for detecting anthracnose germs of carya cathayensisColletotrichum gloeosporioides)The padlock probe and the detection method belong to the field of biotechnology. It is suitable for port inspection and quarantine, agriculture and forestry production, plant protection and other departments.
Background
Thin-shelled hickory nut (A)Carya illinoinensis ) Also called as the american hickory, is a deciduous and big tree of hickory of juglandaceae, has the academic name of hickory, is pleased with light and warm humid climate, has strong adaptability, can grow in hilly and mountainous areas, coastal mudflats and low-lying wetlands, has dual purposes of fruit and material, and is a preferred tree species for plain greening (Pengzhan and the like, 2012; megacloud equals, 2014; yangjianhua et al, 2007; tianaimei et al, 2002). The carya illinoensis is one of famous dry fruits in the world and is increasingly popular as a nutritional health food. The apocarya is introduced from the beginning of the 20 th century in China and is mainly distributed in Zhejiang and Jiangsu provinces at present.
The anthracnose of the thin-shell pecan is mainly harmful to fruits, leaves, twigs, petioles and inflorescences, once the diseases occur, the fruit yield can reach 10-40 percent, and the thin shell is seriously influencedYield and quality of the pecan fruit. At present, the disease has already occurred in Zhejiang and Jiangsu provinces (chiffon, Qian, etc., 2016) in China. The pathogenic bacteria of anthracnose of Carya illinoensis is colletotrichum gloeosporioidesColletotrichum gloeosporioides) (megacloud et al, 2017). At present, the identification method of colletotrichum gloeosporioides is mainly judged by methods such as culture and morphological characteristics of pathogenic bacteria, ITS sequence sequencing and the like. The traditional pathogen quarantine detection technology is mainly a traditional detection method based on the morphological characteristics of pathogenic organisms. The method is long in time consumption and low in efficiency, materials suspected of carrying pathogenic bacteria or diseased plant tissues are usually required to be separated and cultured, then purely cultured pathogenic organisms are returned to parasitic plants, and further pathogen identification is carried out indoors through morphological and physiological characters. Therefore, the traditional detection method cannot meet the requirements of port quarantine, field quarantine and healthy seed production.
In order to overcome the above problems, molecular detection techniques have been studied and have been greatly developed in various countries in recent years. The invention of Padlock probes (PLPs) provides a new idea for the molecular detection of phytopathogens. The Padlock probe is a mononucleotide probe about 100bp in length, and comprises a phosphorylated 5 'end and a hydroxylated 3' end, and the two ends can recognize a DNA sequence of a specific target (Nilsson)et al.1994), we generally refer to as the T1 end and the T2 end. Between the T1 end and the T2 end, there is a universal sequence and a specific sequence, which we call the P1 end, the P2 end and ZipCode. In the reaction, the padlock probe and the target DNA to be detected are first ligated, and the T1 and T2 ends of the probe are bound by being complementary to the DNA sequence of the specific detection target by the action of TaqDNA ligase, and the 5 'and 3' ends of the probe are ligated into a loop. Due to the fact thatTaqThe DNA ligase is characterized in that the probe can form a circular shape only when the DNA sequence is completely complemented with the T1 end and the T2 end of the probe, otherwise, the probe exists in a linear shape. Using exonuclease to removeExcept for the probe without the loop and the mismatched probe, the excised products were then subjected to rolling circle amplification using primers at the T1 and T2 ends of all probes in common. The amplified product is then hybridized with a nucleic acid sequence complementary to the ZipCode sequence, immobilized on a membrane or Microarray (Shoemaker)et al., 1996). Whether the specific pathogen exists in the detection sample or not is judged by a digoxin labeled signal on the membrane or fluorescence on Microarray. Since the padlock probe can be combined with macro or micro array technology, high throughput can be achieved during the detection process (Hardenbol)et al., 2003). Currently, the padlock probe is uniquely designed, and only one base difference can be used for distinguishing the target bacteria from the similar species. Therefore, the technology has been used for molecular detection of various pathogenic bacteria due to its characteristics of strong specificity, high sensitivity and the like (Baner J) et al., 2007； Jobs et al., 2013；Kuroda et al., 2014; Liu et al., 2013; Tian et al., 2014; Velayos et al2018) and Single nucleotide mutation detection (Baner J)et al., 2003). However, the method of the Padlock probe is lacked at present and is used for detecting pecan anthracnose bacteria. The present invention satisfies these needs.
Reference is made to the literature.
Jobs, M., Eriksson, R., & Blomberg, J. (2013). Quantitative and multiplex detection of pathogenic fungi using padlock probes, generic qpcr, and suspension array readout. Methods in Molecular Biology, 968(968), 105。
Kim, S., Frye, J.G., Hu, J. X., Fedorka-Cray, P. J., Gautom, R. and Boyle, D. S. (2006) Multiplex PCR-Based Method for Identification of Common Clinical Serotypes of Salmonella enterica subsp. enteric. J. Clin. Microbiol.44: 3608-3615。
Kuroda, A., Ishigaki, Y., Nilsson, M., Sato, K., & Sato, K. (2014). Microfluidics-based in situ padlock/rolling circle amplification system for counting single dna molecules in a cell. Analytical Sciences the International Journal of the Japan Society for Analytical Chemistry,30(12), 1107-12。
Liu, H., Li, L., Duan, L., Wang, X., Xie, Y., & Tong, L., et al. (2013). High specific and ultrasensitive isothermal detection of microrna by padlock probe-based exponential rolling circle amplification. Analytical Chemistry,85(16), 7941-7947。
McManus P S, Jones A L. 1995. Detection of Erwinia amylovora by nested PCR and PCR-dot-blot and reverse blot hybridisations. Phytopathology, 85(5): 618~623。
Tian, Y., Zhao, Y., Xu, R., Liu, F., Hu, B., & Walcott, R. R. (2014). Simultaneous detection of xanthomonas oryzae pv. oryzae and x. oryzae pv. oryzicola in rice seed using a padlock probe-based assay. Phytopathology, 104(10), 1130。
Toth, I. K., Hyman, L. J., Taylor, R. and Brich, P. R. J. (1998) PCR-based detection of Xanthomonas campestris pv. phaseoli var. fuscans in plant material and its differentiation from X. c. pv. phaseoli. J. Applied. Microbioligy 85: 327-336。
Velayos, B., Olmo, L. D., Merino, L., Valsero, M., & González, J. M. (2018). Non-visible colovesical fistula located by cystoscopy and successfully managed with the novel padlock ®, device for endoscopic closure. International Journal of Colorectal Disease(5), 1-3。
Wang, H., Qi, M., & Cutler, A. J. (1993). Wang h, qi m, cutler aj. a simple method of preparing plant samples for pcr. nucleic acids res 21: 4153-4154. Nucleic Acids Research, 21(17), 4153-4154。
Zhang, M.; Wu, H.Y.; Tsukiboshi, T.; Okabe, I. (2010). First Report of Pestalotiopsis microspora Causing Leaf Spot of Hidcote (Hypericum patulum) in Japan. Plant Disease. 94 (8): 1064。
Dailulan, China Fugu headquarters, page 1021, science publishers, 1979.
Pengfang Kenren, Yongrong Li, Haiguanzhuo, etc. the current status of the production of the carya illinoensis and the strategy of the industrial development of the carya illinoensis in China [ J ] the technological development of forestry, 2012 and 4: 1-4.
Juyun is Caocai, Yejia, etc. the American Carya illinoensis Pest research reviews [ J ]. Chinese forest pest, 2014, 33 (1): 29-43.
Yangjianhua, Li shufang, learning well, major insect damage of hickory and control method [ J ] Jiangxi forestry science and technology, 2007 (2) 30-31.
Tianaimei, Wu Guo Liang, Liu qun Long, etc. characteristics of American hickory nut and its main variety [ J ]. deciduous fruit tree, 2002 (6) 59-60.
Tianyanli, xu Jing, Zhao Yu Qiang, etc. the PCR technology is used for detecting melon bacterial fruit blotch pathogen specially [ J ]. Jiangsu agricultural bulletin 2010, 26: 512-.
Disclosure of Invention
The technical problem is solved.
The invention aims to solve the problems of long required period, difficult identification and the like of a biological detection method of the pecan anthracnose pathogens in the prior art, provides a detection method of the pecan anthracnose pathogens, carries out Padlock probe detection on the pecan anthracnose pathogens, and has high accuracy, short period and good sensitivity.
The technical scheme is as follows.
The pecan anthracnose bacterium is compared with other similar bacteria by using a Blast comparison method in a bioinformatics technology to find that a specific fragment exists in a pectin lyase gene (pl) sequence of the pecan anthracnose bacterium. We then chooseplThe gene is used as a target gene design probe, the Padlock probe technology is adopted to detect the pecan fruits carrying the pecan anthracnose pathogen, and the fruits carrying the pathogen can be quickly and accurately identified from the apparent healthy pecan fruits.
The Padlock probe sequence for detecting pecan anthracnose pathogen is as follows:
P-Ppl:5’-TTGAGTCTTTGACTAGGACTCAGTTCTCCTCGACCGTTAGCAGCATGACCGAGATGTACCGCTATCGTacgtcgtattaggtagtcacATCCAGAACGTATG -3’
the final concentration of the probe was 100pm by optimization and screening of the reaction conditions.
Has the beneficial effects.
Compared with the prior art, the invention has the advantages and positive effects.
(1) The practicability is good: the method has important practical application value in directly detecting the pecan anthracnose pathogen in diseased tissues. The most possible transmission route of pecan anthracnose pathogens along with trade is along with plant materials (such as seedlings, scions and the like). However, the existing detection method needs to separate and purify the pathogenic bacteria, and needs several days; and the separation process is easily interfered by some saprophytic bacteria, and the actual requirements cannot be met. In order to enable the quarantine method to have practical application value, DNA is extracted from diseased tissues quickly and then is detected directly, the pecan anthracnose germs of a plurality of samples to be detected can be detected within 4 hours, and the detection result is sensitive and reliable. Therefore, the method greatly improves the detection efficiency.
The accuracy is high: because the traditional detection technology of pecan anthracnose pathogens only determines objects according to physiological and biochemical characteristics of separating bacteria and cannot distinguish similar species, the accuracy is not high; according to the pectin lyase gene (pl) sequence of the pecan anthracnose pathogenic bacterium, the sequence is compared with other similar species by Bioedit softwareplThe gene sequences are compared, a specific segment of conserved sequence of pecan anthracnose pathogenic bacteria is selected as a specific primer, the specific primer can be designed according to the variant sequence for amplification comparison, and accurate target sites are provided for identification and detection of pathogenic bacteria. Compared with pecan anthracnose pathogens and other different plant pathogens, the accuracy of the primer is 100%.
(2) The sensitivity is high: the sensitivity of the padlock probe detection method is 50 spores/ul or 100 pg/ul DNA at the lowest.
(3) High flux: the detection method developed by the project can detect a plurality of samples simultaneously, and is time-saving and labor-saving.
Drawings
FIG. 1A shows that the detection result of the Padlock probe P-Ppl on pecan anthracnose pathogenic bacteria strains in different areas is 1-32: 2016-2018 separated from colletotrichum gloeosporioides strain (Anthragma gloeosporioides strain) in different walnut producing areas of Jiangsu, Zhejiang, Anhui, Xinjiang, Qinghai, Yunnan and Shaanxi in ChinaColletotrichum gloeosporioides) : hb01、hb02、hb 03、js01、js 02、js 03、js 04、js 05、js 06、zj01、zj 02、zj 03、zj 04、zj 05、zj 06、zj 07、zj 08、ah01、ah 02、ah 03、ah 04、Yn01、Yn 02、Yn 03、Yn 04、xj01、xj 02、xj 03、sx 01、sx 02、qh01、qh02; 33: ddH2O。
FIG. 1B shows specificity verification of Padlock probe P-Ppl for detecting pecan anthracnose bacteria of Carya cathayensis Koch 1:Colletotrichum higginsianum cx101；2: C.destructivumyc-5；3: C.linicola mg02；4: C.caudatumbm；5: C.sublineolum gl；6: C.falcatum gz110；7: C.orbicularemelon001；8: C.graminicola cp；9: C.dematium xc01；10: C.capsicilj ；11: C.musaexj003；12: C.coccodes 02；13: C.lini CB01；14: C.orchidearum 102；15: Glomerella acutata 002；16: G.lindemuthianaMK, 17: peptospira heteroclita (A. sp.), (B. sp.), (C. sp.), (B. sp.), (C. sp.), (C. in (C. sp.), (C. in)P. versicolor) 18: pestalotiopsis grandiflora (C. grandiflora)P.dissmeninta) 19: pestalotiopsis okana (Sphaerotheca fuliginea)P.oxyanthi) 20: pestalotiopsis virginiana (Spirosporus virginiana) (Spirosporus virginiana)P.vismiae) 21: pestalotiopsis elongata (C.), (C.)P.longisetula) 22: pestalotiopsis clavuligerus: (P.clavispora) 23: pestalotiopsis of sweet Potato: (P.batatae) 24: pestalotiopsis equi (C.) RaddeP.macrochaeta) 25: pestalotiopsis lanuginosa (A. lanuginosa) ((B. lanuginosa))P.pauciseta) 26: pestalotiopsis Chaetosa (A. Chaetosa) ((B. Chaetosa))P. theae) 27, a step of: pestalotiopsis cassiteriensis (C.), (C.P.karstenii) 28: hangzhou pestalotiopsis, (C) AP.hangzhougensis) 29: bacteroidectoidophyte (C.), (Pestalotiopsis bicolor) 30: pseudoplectania solanacearum (A), (B), (C), (Pestalotiopsis funerea) 31: colletotrichum torvum (A. orbiculata) ((B.))Melanconium juglandinum) 32: gather together and growCordycepsmilitaris (Aschersonia minor: (A)Dothiorella gregaria) 33: walnut rot pathogen (C)Crytospora juglandis) 34: brown spot of walnut (Marssonina juglandis) 35: staphylococus (Vitaceae, and Vitaceae, and Vitaceae, and Luculia, andBotryosphoeria dothidea) 36: pestalotiopsis microphylla (A), (B), (CPestalotiopsis microspora) 37: walnut Gray leaf fungus: (Phyllosticta juglandi) 38: hickory scab bacteria (1)Fusicladium effusum) 39: alternaria alternata (Alternaria alternata) 40: called Zuotenuis (Zuochuang) ((Zuochuang))Septobasidium tanakae) 41: xanthomonas Juglandis (Xanthomonas jugladis) 42: agrobacterium tumefaciens (A. tumefaciens) (B)Agrobacterium tumefaciens) 43: charred coal bacterium (C.) (Hypoxylonsp.), 44: cladosporium species (A), (B), (C), (B), (C), (B), (C), (B), (C), (B), (C)Cladosporiumsp.), 45: pea foot rot bacteria (Phoma pinodella) 46: phomopsis helianthi (Phomopsis helianthi) 47: phaseolus vulgaris (B)Macrophomina phaseolina) 、48：Fusarium oxysporum 、49: Colletotrichum gloeosporioides js01。
FIG. 2A the sensitivity detection system of Padlock probe P-Ppl for detecting genomic DNA of Scutellaria cathayensis C.H.Cheng et L.Ling in the detection system takes the genomic DNA of Scutellaria cathayensis C.Ling as a template, and the DNA concentrations of the templates used in the detection system represented by 1-7 are as follows in sequence: 1 ug/uL, 100 ng/uL, 10 ng/uL, 1 ng/uL, 100 pg/uL, 10 pg/uL, and 1 pg/uL.
FIG. 2B A shows that the detection sensitivity of the Padlock probe P-Ppl to the pecan anthracnose pathogenic bacteria spore suspension is that the pecan anthracnose pathogenic bacteria suspension is used as a template, and the spore bacteria suspension concentration of the template used by the detection system represented by 1-7 is as follows: 2000/uL, 1000/uL, 500/uL, 100/uL, 50/uL, 20/uL and 0/uL.
FIG. 3 detection result 1 of actual sample using Padlock probe P-Ppl, negative control ddH22-47, wherein the template is 46 parts of hickory nut samples from different areas in China; 48, the template is pecan anthracnose germ js 01.
Detailed Description
(1) And (4) preparing a sample.
The genome DNA of the pure bacteria is extracted by a fungus genome DNA miniprep kit of an OMEGA company, and the specific steps are described in the specification. After extraction, the concentration was set to 1 ug/uL, and specificity detection was performed. The dilutions were made at 1 ug/uL, 100 ng/uL, 10 ng/uL, 1 ng/uL, 100 pg/uL, 10 pg/uL, and 1 pg/uL for sensitivity validation.
Spore suspension: suspending the induced spore producing spore container in sterile water, and counting spores by adopting a blood counting plate. The spore suspension is diluted in a multiple ratio to obtain the concentrations of 2000/uL, 1000/uL, 500/uL, 100/uL, 50/uL, 20/uL and 0/uL which are respectively used as detection templates.
And (3) actual sample detection: in the experiment, 46 hickory nut samples from different areas in China are selected for detection. A section of walnut tissue (1-2 g) is properly selected, and the genome DNA is quickly extracted by referring to the method of Wang et al (1993) (see the reference specifically). The specific method comprises the following steps: adding 100 mul of 0.5M NaOH into each gram of tissue, fully grinding the tissue in a mortar, transferring the tissue to a 1.5 ml EP tube, centrifuging the tissue at 12000 rpm for 5 min, adding 495 mul of 0.1M Tris (pH 8.0) into 5 mul of supernatant, and uniformly mixing the supernatant and the supernatant to obtain 1 mul of the supernatant serving as a detection template.
(2) And (5) detecting the result of the P-Ppl detection of the Padlock probe.
2.1 Probe ligation, the ligation reaction solution comprising: 20mM Tris-HCl, pH 9.0, 25 mM KCH3COO, 10 mM Mg(CH3COO)210 mM DTT, 1 mM NAD, 0.1% Triton X-100, 2.4U Taq DNA ligase, 1. mu.l template, 100Pm probe P-Pm. The reaction sequence for ligation was: pre-denaturation at 95 ℃ for 5 min; then, the mixture enters circulation, denaturation is carried out for 30 seconds at 95 ℃, connection is carried out for 5 minutes at 65 ℃, and 20 cycles of reaction are carried out; then inactivated at 95 ℃ for 5 minutes. Adding 2 units of exonuclease I and 2 units of exonuclease III into the connected product, reacting at 37 ℃ for 0.5 h, and then inactivating the reacted product at 95 ℃ for 5 min.
PCR amplification of the ligation products was performed using primers P1-F (5'-CTCGACCGTTAGCAGCATGA-3') and P2-R (5'-CCGAGATGTACCGCTATCGT-3'), and the reaction solution included: 0.5 mu M P1-F and P2-R, 50 mu M each of 4 dNTPs, 2.5 mu l 10 XPCR reaction buffer，2 mM Mg2+2.5 μ l of 1% BSA, 1.25 units Taq enzyme (TaKaRa), 3 μ l of ligation product after exonuclease treatment. The reaction procedure is as follows: pre-denaturation at 94 ℃ for 5 min; then entering into circulation, denaturation at 94 ℃ for 30 sec, annealing at 60 ℃ for 30 sec, and extension at 72 ℃ for 30 sec, and 35 cycles; finally, extension was carried out at 72 ℃ for 7 min.
2.2 Macroarray multiplex assay. In order to realize high-throughput detection of a plurality of samples, PLP is combined with forward dot blot hybridization to detect pecan anthracnose bacteria. The forward dot blot hybridization method is mainly referred to Saiki et al (Saiki)et al., 1989). The method mainly comprises the following steps: 1 muL of 2) PCR amplification products were spotted on a nylon membrane (Hybond-N +; amersham), uv-crosslinked for 30 s, then soaked with 2 × SSC +1% SDS at room temperature for 2 min, and the nylon membrane was air-dried naturally. Digoxigenin-labeled cZipcode probe (GTGACTACCTAATACGACGT) was added to the hybridization solution and hybridized at 42 ℃ for 4 h. After the hybridization was completed, the nylon membrane was washed with 2 XSSC +1% SDS wash solution at room temperature for 5 min 2 times with shaking, and then washed with 0.5 XSSC +0.1% SDS wash solution at 68 ℃ for 2 times for 15 min each. Before color development, the nylon membrane is soaked in maleic acid buffer solution for 2 min at room temperature. Color development was then performed according to the kit (Roche Applied Science) instructions.
2.3 detecting results. As a result, the Padlock probe P-Ppl can detect signals from 32 genomic DNAs of colletotrichum gloeosporioides strains which are separated from different walnut producing areas in China in 2016-2O) no signal (fig. 1A, B). The sensitivity of the detection of the Padlock probe P-Ppl was a minimum of 50 spores/ul spore suspension or 100 pg/ul genomic DNA (FIG. 2A, B). When 46 hickory nut samples from different areas in China are detected, 31 positive samples, namely 3, 4, 9, 10, 15, 16, 17, 18, 21-36, 39-42 and 45-47 (figure 3), can be detected by the Padlock probe P-Ppl, and meanwhile, the detection result of the Padlock probe P-Ppl is correct through sequencing after the pathogenic bacteria of the positive samples are separated to obtain pure cultures (specific experimental data are not listed). The above results indicate that the detection of the Padlock probe P-Ppl can meet the practical requirements.
Sequence listing
<110> institute of plant of Chinese academy of sciences of Jiangsu province
<120> Padlock probe of pecan anthracnose pathogen and detection method thereof
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 102
<212> DNA
<213> Scottish hickory charcoal spot pathogen (Colletotrichum gloeosporioides)
<400> 1
ttgagtcttt gactaggact cagttctcct cgaccgttag cagcatgacc gagatgtacc 60
gctatcgtac gtcgtattag gtagtcacat ccagaacgta tg 102

Claims (2)

1. The padlock probe P-Ppl for detecting the pecan anthracnose pathogen is characterized in that the sequence of the probe P-Ppl is as follows:
P-Ppl:5’-TTGAGTCTTTGACTAGGACTCAGTTCTCCTCGACCGTTAGCAGCATGA
CCGAGATGTACCGCTATCGTacgtcgtattaggtagtcacATCCAGAACGTATG -3’。
2. the method for detecting pecan anthracnose pathogens by combining the probe of claim 1 with Macroarray technology, which comprises the following detection steps:
(1) the connection and the exonuclease treatment of the probe, firstly hybridizing the padlock probe and target DNA to be detected, combining the two ends of the probe by complementing with the DNA sequence of a specific detection target object under the action of TaqDNA ligase, connecting the 5 'end and the 3' end of the probe into a ring, and removing the probe which does not form the ring and the mismatched probe by adopting the exonuclease;
(2) amplifying the probe, namely amplifying the ligation product generated in the step (1) by adopting a primer; the primer is P1-F: 5'-CTCGACCGTTAGCAGCATGA-3', P2-R: 5'-CCGAGATGTACCGCTATCGT-3', respectively;
(3) and (3) performing Macroarray multiplex detection, namely spotting the product amplified in the step (2) on a nylon membrane, hybridizing the nylon membrane with a digoxin-labeled cZipcode probe, and judging whether a detection sample contains a pathogen or not according to a digoxin-labeled signal on the membrane, wherein the cZipcode probe is GTGACTACCTAATACGACGT.
CN201910879229.XA 2019-09-18 2019-09-18 Padlock probe for pecan anthracnose pathogen and detection method thereof Active CN110760604B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910879229.XA CN110760604B (en) 2019-09-18 2019-09-18 Padlock probe for pecan anthracnose pathogen and detection method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910879229.XA CN110760604B (en) 2019-09-18 2019-09-18 Padlock probe for pecan anthracnose pathogen and detection method thereof

Publications (2)

Publication Number Publication Date
CN110760604A CN110760604A (en) 2020-02-07
CN110760604B true CN110760604B (en) 2022-06-14

Family

ID=69330286

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910879229.XA Active CN110760604B (en) 2019-09-18 2019-09-18 Padlock probe for pecan anthracnose pathogen and detection method thereof

Country Status (1)

Country Link
CN (1) CN110760604B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113373258A (en) * 2021-06-30 2021-09-10 中国林业科学研究院亚热带林业研究所 LAMP detection primer for alternaria solanacearum on thin shell, and establishment method and application of detection system
CN115058531A (en) * 2022-06-01 2022-09-16 浙江农林大学 Hickory nut oligonucleotide probe and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101608236A (en) * 2009-03-27 2009-12-23 南京农业大学 The padlock probe and the multiple detection method of erwinia amylovora and Asia erwinia amylovora
CN106868142A (en) * 2017-03-03 2017-06-20 浙江农林大学 Detect the loop-mediated isothermal amplification method of hickory nut dry rot germ

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101608236A (en) * 2009-03-27 2009-12-23 南京农业大学 The padlock probe and the multiple detection method of erwinia amylovora and Asia erwinia amylovora
CN106868142A (en) * 2017-03-03 2017-06-20 浙江农林大学 Detect the loop-mediated isothermal amplification method of hickory nut dry rot germ

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Mantz G等.First report of Colletotrichum gloeosporioides causing pecan anthracnose in Argentina.《Journal of Plant Pathology》.2010,第92卷(第2期), *
王清海等.核桃炭疽病病原菌鉴定及生物学特性.《山东农业大学学报(自然科学版)》.2016,第47卷(第01期), *
韩长志.胶孢炭疽病菌的研究进展.《华北农学报》.2012, *

Also Published As

Publication number Publication date
CN110760604A (en) 2020-02-07

Similar Documents

Publication Publication Date Title
CN110760604B (en) Padlock probe for pecan anthracnose pathogen and detection method thereof
ji Cho et al. Development of a multiplex PCR method to detect fungal pathogens for quarantine on exported cacti
CN110699475B (en) Padlock probe of pecan alternaria alternata and detection method thereof
Sławiak et al. Multiplex detection and identification of bacterial pathogens causing potato blackleg and soft rot in Europe, using padlock probes
JP6253132B2 (en) Markers related to resistance to anthracnose in Strawberry plants and their utilization
Sarkes et al. Detection of Xanthomonas translucens pv. undulosa, pv. translucens, and pv. secalis by quantitative PCR
CN102352354A (en) Specific mark of thinopyrum elongatum chromosome in wheat background and application thereof
CN101608236A (en) The padlock probe and the multiple detection method of erwinia amylovora and Asia erwinia amylovora
Galetto et al. Real-time PCR diagnosis and quantification of phytoplasmas
JP2019110810A (en) Primer sets for specific amplification of nucleic acids derived from strawberry pathogenic viruses and methods for detecting strawberry pathogenic viruses
CN111876514A (en) Method for rapidly detecting gibberellin microspecies generated in rice bakanae disease
KR20120045917A (en) Specific primers for rapid detection of bakanae disease pathogen(fusarium fujikuroi) and method for detection using the same
CN112662804B (en) Primer group, kit and method for detecting pathogenic variation of avirulence gene AvrPi9 of rice blast
CN112176080B (en) Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma
WO2003068988A1 (en) A method of pcr based detection and identification of rice blast fungus magnaporthe grisea
CN114032334A (en) Primer group and kit for detecting quinoa phomopsis and detection method thereof
KR101719719B1 (en) Kit for detection of Pseudomonas syringae pv. actinidiae of Psa1 group
CN109338004B (en) Primer combination, kit and method for detecting resistance of botrytis cinerea to boscalid
CN113373258A (en) LAMP detection primer for alternaria solanacearum on thin shell, and establishment method and application of detection system
JP2018522559A (en) Novel microorganisms and their use in agriculture
KR101876273B1 (en) Molecular marker for selecting clubroot of Chinese cabbage and selection method using the same molecular marker
Chavhan et al. Real-time PCR assay for rapid, efficient and accurate detection of Paramyrothecium roridum a leaf spot pathogen of Gossypium species
CN111778345A (en) Simple and efficient potato multi-R gene polymerization assisted breeding method
CN108192992A (en) The molecular detection primer and its detection method of potato plant tikka class disease Alternaria tenuissima pathogen
CN108148924A (en) The molecular detection primer and its detection method of potato plant tikka class disease alternariosis opportunistic pathogen

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant