CN109338004B - Primer combination, kit and method for detecting resistance of botrytis cinerea to boscalid - Google Patents
Primer combination, kit and method for detecting resistance of botrytis cinerea to boscalid Download PDFInfo
- Publication number
- CN109338004B CN109338004B CN201811345216.6A CN201811345216A CN109338004B CN 109338004 B CN109338004 B CN 109338004B CN 201811345216 A CN201811345216 A CN 201811345216A CN 109338004 B CN109338004 B CN 109338004B
- Authority
- CN
- China
- Prior art keywords
- primer
- pcr
- boscalid
- resistance
- botrytis cinerea
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer combination, a kit and a method for detecting resistance of botrytis cinerea to boscalid, and relates to the technical field of agricultural science. The primer combination comprises one or more of the following primer combinations: a primer combination 1, a primer combination 2 and a primer combination 3; wherein, the primer combination 1 comprises: primers shown in SEQ ID NO. 1-3; the primer combination 2 comprises: primers shown in SEQ ID NO. 4-7; the primer combination 3 comprises: primers shown in SEQ ID NO. 8-11. The primer group can be used for quickly and effectively identifying Botrytis cinerea which is resistant to boscalid and mutation types of Botrytis cinerea which is resistant to boscalid.
Description
Technical Field
The invention relates to the technical field of agricultural science, and particularly relates to a primer combination, a kit and a method for detecting resistance of botrytis cinerea to boscalid.
Background
Strawberry gray mold (gray mold disease) is one of the most serious diseases that jeopardize the production and storage of strawberries. The pathogen Botrytis cinerea (Botrytis cinerea Pers.) can also infect more than 200 crops such as grapes, cucumbers, tomatoes and the like, and the symptoms such as soft rot, black rot, mildew and the like are generated, thereby causing great economic loss.
Succinate dehydrogenase inhibitors (SDHIs) are a class of bactericides containing amide groups, which have a protective or therapeutic effect on crops by inhibiting the activity of the electron transport chain protein complex II (succinate dehydrogenase, SDH) of mitochondria of pathogenic bacteria. Boscalid is a picolinamide SDHI which enters the market in 2003, has low toxicity, and has good inhibitory activity on fungi such as Sclerotinia spp, Alternaria spp, Botrytis spp and Mycosphaerella spp. Boscalid has efficient inhibition effects on spore germination, sprout tube elongation, attachment cell formation, hypha growth and the like of botrytis cinerea (B.cinerea), has good systemic conduction characteristics in plant leaves and stems, and is proved to be highly effective in field control of strawberry botrytis cinerea.
Since the B.cinerea has high propagation speed, large spore quantity and easy genetic variation, the B.cinerea belongs to a plant pathogenic fungus which is easy to generate resistance to medicaments. Meanwhile, the boscalid has a single action site, and resistance can be generated to the single nucleotide mutation of the genome of pathogenic bacteria, the boscalid is identified as a bactericide with higher resistance risk by the international bactericide resistance committee (FRAC), and the b.cinerea-boscalid is also identified as a pathogen-bactericide combination with high resistance risk by FRAC. The reports of resistance of field B.cinerea to boscalid have appeared in China, the United states, Germany and the like, and the control effect is reduced.
Therefore, grasping and understanding the resistance of botrytis cinerea, i.e., b.cinerea, to boscalid is one of measures to improve the effect of controlling botrytis cinerea. However, at present, a related reagent for detecting whether the botrytis cinerea is resistant to boscalid is lacked.
In view of this, the invention is particularly proposed.
Disclosure of Invention
The invention aims to provide a primer group for detecting the resistance of botrytis cinerea to boscalid, and the primer group can be used for quickly and effectively identifying the botrytis cinerea which is resistant to boscalid and the mutation type of the botrytis cinerea which is resistant to boscalid.
The invention also aims to provide a kit for detecting the resistance of botrytis cinerea to boscalid, and by adopting the kit, the botrytis cinerea which is resistant to boscalid and the mutation type of the botrytis cinerea which is resistant to boscalid can be quickly and effectively identified.
Another object of the present invention is to provide a method for detecting resistance of botrytis cinerea to boscalid, by which it is possible to rapidly and effectively identify botrytis cinerea resistant to boscalid and mutation types thereof resistant to boscalid.
The invention is realized by the following steps:
the resistance of the cinerea to the boscalid is mainly related to the point mutation of a pathogen succinic dehydrogenase SdhB subunit, the most common mutation sites are 225 sites (proline) and 272 sites (histidine), the mutation types comprise P225L/F/T, H272Y/R/L and the like, and P225F, H272R, H272Y and the like are common resistance mutation types.
AS-PCR (Allele-specific PCR) is one of the most commonly used molecular tests for detecting the resistance of pathogenic bacteria to bactericides. The principle of AS-PCR is to determine the mutation condition of a specific site by the amplification efficiency difference of complete and incomplete pairing of the 3' end of a PCR primer at the specific site and a template. The method has the advantages of simplicity, rapidness, accuracy and the like.
Based on the primer, the invention provides a primer group for detecting the resistance of botrytis cinerea to boscalid, which comprises one or more of the following primer combinations: a primer combination 1, a primer combination 2 and a primer combination 3;
wherein, the primer combination 1 comprises: primers shown in SEQ ID NO. 1-3;
the primer combination 2 comprises: primers shown in SEQ ID NO. 4-7;
the primer combination 3 comprises: primers shown in SEQ ID NO. 8-11;
preferably, the primer set comprises primer combination 1;
preferably, the primer set comprises a primer combination 1 and a primer combination 2;
preferably, the primer set comprises a primer set 1 and a primer set 3.
Based on the AS-PCR principle and combined with resistance mutation sites of Botrytis fragilis to boscalid (P225F (CCC mutation is TTC), N230I (AAC mutation is ATC), H272R (CAC mutation is CGC) and H272Y (CAC mutation is TAC)) on SdhB subunit, the invention designs a pathogen primer combination 1 containing three primers aiming at 4 mutation types (P225F, N230I, H272R and H272Y) of the 3 mutation sites (225, 230 and 272) of the SdhB subunit for carrying out preliminary detection on the boscalid resistance of Botrytis fragilis.
The primer combination 1 comprises:
external primer Tri-EX-F:
5’-CTTCAACACACCGACCCAGC-3’(SEQ ID NO.1)；
the inner primer Tri-272-R:
5’-CCTCGAGCAGTTGAGAATAGACTG-3’(SEQ ID NO.2)；
the inner primer Tri-225-R10:
5’-CTCACTGTTGCACCAGTAGCAAGG-3’(SEQ ID NO.3)。
the primer combination 1 can be used for specifically amplifying a band at a site where no mutation site occurs, and can distinguish a wild sensitive strain (which does not have resistance) from 4 mutant strains (P225F, N230I, H272R and H272Y) having boscalid resistance, and is used for carrying out primary detection on the boscalid resistance of Botrytis cinerea.
The DNA templates of the P225F and N230I resistant mutant strains can only amplify one 282bp band, the H272R and H272Y resistant mutant strains can only amplify one 141bp band, and wild type sensitive germs can simultaneously amplify 141bp and 282bp bands.
In addition, in order to specifically identify a specific mutation type (whether P225F, N230I, or H272R or H272Y) of a mutant strain having boscalid resistance, identification can be performed using the primer combination 2 and the primer combination 3.
outer primer 225-EX-F6:
5’-CTTCAACACACCGACGCACC-3’(SEQ ID NO.4)；
outer primer 225-EX-R:
5’-ACCGCCCAAAACACCACAAC-3’(SEQ ID NO.5)；
inner primer 225-M-F9:
5’-CATGCTGCTCGACATCTAACTTC-3’(SEQ ID NO.6)；
inner primer 225-S-R3:
5’-CCTCACTGTTCCACCAGTTGCAGG-3’(SEQ ID NO.7)。
when the primer combination 2 is used for PCR amplification, 426bp bands and 330bp specific bands can be amplified for the strain with the P225F mutation, and 426bp bands and 142bp specific bands can be amplified for the strain without the P225F mutation. Therefore, whether the Botrytis cinerea strain sample has the boscalid resistance mutation P225F can be distinguished through the size and the type of the amplified band.
outer primer 272-EX-F:
5’-AGACGCTAAGCACGAAACGA-3’(SEQ ID NO.8)；
outer primer 272-EX-R2:
5’-TAACCGCCCAAAACACGTCA-3’(SEQ ID NO.9)；
inner primer 272-M-F2:
5’-AGCATGAGTTTGTACAGATCGCGC-3’(SEQ ID NO.10)；
inner primer 225-S-R2:
5’-CCTCGAGCAGTTGAGAATAGACTG-3’(SEQ ID NO.11)。
when PCR amplification is carried out by using the primer combination 3, a 540bp band and a 192bp specific band can be amplified for a strain with H272R mutation, and a 540bp band and a 394bp specific band are amplified for a strain without H272R mutation. Therefore, whether the Botrytis cinerea strain sample has the boscalid resistance mutation H272R can be distinguished through the size and the type of the amplified band.
Botrytis cinerea is easy to generate resistance to boscalid, so that control failure is caused, and serious economic loss is caused. However, the traditional sensitivity detection method, such as the hypha growth rate method or the spore germination inhibition method, requires the culture of pathogenic bacteria, is long in time consumption and complicated in steps, and is not suitable for the detection of a large number of samples. Therefore, the establishment of the rapid resistance detection method is extremely important for scientific utilization of boscalid and efficient prevention and control of diseases.
According to the primer group for detecting the resistance of Botrytis cinerea to boscalid, provided by the invention, Botrytis cinerea with resistance is quickly and effectively identified by utilizing the primer combination 1 through band difference, and two high-frequency mutation types can be further identified by utilizing the primer combination 2 to detect P225F or utilizing the primer combination 3 to detect H272R, so that the mutation types of resistant strains are quickly obtained, and guarantee is provided for scientific utilization of boscalid and efficient prevention and control of Botrytis cinerea.
In addition, the primer group provided by the invention has a mismatch site near the 3' end of each inner primer, so that the specificity during amplification can be greatly improved.
In another aspect, the invention provides a kit for detecting the resistance of botrytis cinerea to boscalid, which comprises the primer set.
Further, in some embodiments of the invention, the kit further comprises a PCR reaction buffer;
the PCR reaction buffer contained: taq DNA polymerase, mg2+And dNTPs.
The kit can quickly and effectively identify Boscaly mildew which is resistant to boscalid to obtain the mutation type of the resistant strain, has the characteristics of simple operation and accurate result, and provides guarantee for scientific utilization of boscalid and efficient prevention and control of Boscaly mildew.
In still another aspect, the present invention provides a method for detecting resistance of botrytis cinerea to boscalid, comprising any one of the following steps:
step (a): carrying out PCR on a sample to be detected by using the primer combination 1;
step (b): carrying out PCR on a sample to be detected by using the primer combination 2;
and, step (c): carrying out PCR on a sample to be detected by using the primer combination 3;
wherein, the primer combination 1 comprises: primers shown in SEQ ID NO. 1-3;
the primer combination 2 comprises: primers shown in SEQ ID NO. 4-7;
the primer combination 3 comprises: primers shown in SEQ ID NO. 8-11;
preferably, the method comprises step (a);
preferably, the method comprises steps (a) and (b) performed sequentially;
preferably, the method comprises steps (a) and (c) performed sequentially.
Further, in some embodiments of the present invention, in the PCR in the step (a), the annealing temperature is set to 52-54 ℃.
Further, in some embodiments of the present invention, in the step (a), the number of cycles is set to 30 to 34 cycles when the PCR is performed.
Further, in some embodiments of the present invention, in the PCR in the step (b), the annealing temperature is set to 54-56 ℃.
Further, in some embodiments of the present invention, in the step (b), the number of cycles is set to 30 to 34 cycles when the PCR is performed.
Further, in some embodiments of the present invention, in the PCR in the step (c), the annealing temperature is set to 54-56 ℃.
Further, in some embodiments of the present invention, in the step (c), the number of cycles is set to 30 to 34 cycles when the PCR is performed.
Further, in some embodiments of the present invention, in step (a), the procedure of performing PCR using primer combination 1 comprises: denaturation: 95 ℃ and 20s, annealing: 53 ℃, 20s, extension: 72 ℃, 30s, 32 cycles;
in step (b), the procedure for performing PCR using primer set 2 includes: denaturation: 95 ℃ and 20s, annealing: 55 ℃, 20s, extension: 72 ℃, 30s, 32 cycles;
in step (c), the procedure for performing PCR using primer set 3 includes: denaturation: 95 ℃ and 20s, annealing: 55 ℃, 20s, extension: 72 ℃, 30s, 32 cycles.
The method for detecting the resistance of the botrytis cinerea to the boscalid can quickly and effectively identify the botrytis cinerea which is resistant to the boscalid and the mutation type of the botrytis cinerea which generates resistance to the boscalid on the basis of the designed primer group.
In addition, through scientific optimization of PCR reaction conditions, the detection method provided by the invention also improves the specificity and amplification efficiency of each primer combination during PCR, greatly improves the brightness of strips during electrophoresis detection, and is easy to observe.
In conclusion, the primer combination, the kit and the method for detecting the resistance of botrytis cinerea to boscalid provided by the invention have the following advantages:
(1) the detection range is wide: relates to all the resistance genotypes reported in China and found in international research.
(2) The identification is quick: the detection time is only 3-4 hours; the traditional plate method needs long time, which is more than 1 week.
(3) The specificity is good: can effectively distinguish sensitive strains from 4 resistant mutant strains.
(4) The operation is simple and convenient: the invention only needs 1 PCR amplification instrument and the conventional reagents required by PCR amplification reaction. Therefore, the primer group, the kit and the detection method provided by the invention have very high practical values.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.
FIG. 1 is a 2% agarose gel electrophoresis of three primer PCR for detection of Botrytis cinerea boscalid resistance, wherein M: marker; 1. 2: a P225F resistant mutant strain; 3. 4: N230I resistant mutant strains; 5. 6: H272R resistant mutant strains; 7. 8: H272Y mutant strain; 9. 10: wild-type susceptible strains.
FIG. 2 is a 2% agarose gel electrophoresis of a four primer P225F PCR identification system, wherein M: marker; 1. 2: a P225F resistant mutant strain; 3. 4: N230I resistant mutant strains; 5. 6: H272R resistant mutant strains; 7. 8: H272Y mutant strain; 9. 10: wild-type susceptible strains.
FIG. 3 is a 2% agarose gel electrophoresis of a four primer H272R PCR identification system, wherein M: marker; 1. 2: a P225F resistant mutant strain; 3. 4: N230I resistant mutant strains; 5. 6: H272R resistant mutant strains; 7. 8: H272Y mutant strain; 9. 10: wild-type susceptible strains.
FIG. 4 is a 2% agarose gel electrophoresis of 272 site specific primer screening in a three-primer PCR detection system. Wherein in A-C, 1-2: a P225F mutant strain; 3-4: the N230I mutant strain; 5-6: H272R mutant strain; 7-8: H272Y mutant strain. A: amplification results of the primers Tri-EX-F and Tri-272-R; b: the amplification results of the primers Tri-EX-F and Tri-272-R2; c: the amplification results of the primers Tri-EX-F and Tri-272-R3;
FIG. 5 is a 2% agarose gel electrophoresis of specific primer screening in a three-primer PCR detection system. Wherein in A to G, M: marker; 1-3: a P225F resistant mutant strain; 4-6: N230I resistant mutant strains; 7-9: H272R resistant mutant strains; 10. 11: H272Y resistant mutant strains; 12-14: wild-sensitive strains. Wherein in H to K, 1, 2: a P225F resistant mutant strain; 3. 4: N230I resistant mutant strains; 5. 6: H272R resistant mutant strains; 7. 8: H272Y resistant mutant strains; 9. 10: wild-sensitive strains. A: the amplification result of the primer group Tri-EX-F, Tri-272-R and Tri-225-R1; b: the amplification result of the primer group Tri-EX-F, Tri-272-R and Tri-225-R2; c: the amplification result of the primer group Tri-EX-F, Tri-272-R and Tri-225-R3; d: and (3) amplification results of the primer group Tri-EX-F, Tri-272-R and Tri-225-R4. E: the amplification result of the primer group Tri-EX-F, Tri-272-R and Tri-225-R5; f: the amplification result of the primer group Tri-EX-F, Tri-272-R and Tri-225-R6; g: the amplification result of the primer group Tri-EX-F, Tri-272-R and Tri-225-R7; h: the amplification result of the primer group Tri-EX-F, Tri-272-R and Tri-225-R8; i: the amplification result of the primer group Tri-EX-F, Tri-272-R and Tri-225-R9; j: and (3) amplification results of the primer group Tri-EX-F, Tri-272-R and Tri-225-R11. K: and (3) amplification results of the primer group Tri-EX-F, Tri-272-R and Tri-225-R10.
FIG. 6 is a 2% agarose gel electrophoresis of four primer P225F PCR identification system specific primer screening. Wherein in A to T, M: marker; 1-3: a P225F resistant mutant strain; 4-6: wild-sensitive strains. A: amplification results of the primer sets 225-EX-F, 225-EX-R, 225-M-F and 225-S-R. B: amplification results of the primer sets 225-EX-F2, 225-EX-R, 225-M-F and 225-S-R2. C: amplification results of the primer sets 225-EX-F2, 225-EX-R, 225-M-F2 and 225-S-R2. D: amplification results of the primer sets 225-EX-F2, 225-EX-R, 225-M-F3 and 225-S-R2. E: amplification results of the primer sets 225-EX-F2, 225-EX-R, 225-M-F4 and 225-S-R2. F: amplification results of the primer sets 225-EX-F2, 225-EX-R, 225-M-F5 and 225-S-R3. G: amplification results of the primer sets 225-EX-F2, 225-EX-R, 225-M-F and 225-S-R3. H: amplification results of the primer sets 225-EX-F3, 225-EX-R, 225-M-F6 and 225-S-R3. I: amplification results of the primer sets 225-EX-F3, 225-EX-R, 225-M-F8 and 225-S-R3. J: amplification results of the primer sets 225-EX-F4, 225-EX-R2, 225-M-F7 and 225-S-R4. K: amplification results of the primer sets 225-EX-F2, 225-EX-R, 225-M-F9 and 225-S-R3. L: amplification results of the primer sets 225-EX-F2, 225-EX-R, 225-M-F8 and 225-S-R2. M: amplification results of the primer sets 225-EX-F3, 225-EX-R, 225-M-F10 and 225-S-R3. N: amplification results of the primer sets 225-EX-F3, 225-EX-R, 225-M-F9 and 225-S-R3. O: amplification results of the primer sets 225-EX-F2, 225-EX-R, 225-M-F8 and 225-S-R3. P: amplification results of the primer sets 225-EX-F4, 225-EX-R, 225-M-F9 and 225-S-R3. Q: amplification results of the primer sets 225-EX-F5, 225-EX-R, 225-M-F9 and 225-S-R3. R: amplification results of the primer sets 225-EX-F2, 225-EX-R, 225-M-F11 and 225-S-R3. S: amplification results of the primer sets 225-EX-F6, 225-EX-R, 225-M-F9 and 225-S-R3. T: amplification results of the primer sets 225-EX-F6, 225-EX-R, 225-M-F10 and 225-S-R3.
FIG. 7 is a 2% agarose gel electrophoresis of four primers H272R PCR identification system specific primer screening. Wherein in A to C, M: marker; 1-3: a wild-sensitive strain; 4-6: H272R resistant mutant strain. A: amplification results of the primer sets 272-EX-F, 272-EX-R, 272-M-F and 272-S-R. B: amplification results of the primer sets 272-EX-F2, 272-EX-R3, 272-M-F3 and 272-S-R3. C: amplification results of the primer sets 272-EX-F, 272-EX-R2, 272-M-F2 and 272-S-R2.
FIG. 8 is a 2% agarose gel electrophoresis of a three primer PCR detection system comparing amplification conditions. Wherein in A to I, 1 and 2: a P225F resistant mutant strain; 3. 4: N230I resistant mutant strains; 5. 6: H272R resistant mutant strains; 7. 8: H272Y resistant mutant strains; 9. 10: wild-sensitive strains. A to I adopt a primer group Tri-EX-F, Tri-272-R and Tri-225-R10 to amplify, wherein the amplification conditions are pre-denaturation at 95 ℃ for 3min, 30 to 34 cycles of denaturation at 95 ℃ for 20s, annealing at 51 to 57 ℃ for 20s, extension at 72 ℃ for 30s, and finally extension at 72 ℃ for 5 min. A-I used different annealing temperatures (Tm) and cycle numbers. Wherein A: tm 51 ℃, 30 cycles; b: tm 51 ℃, 32 cycles; c: tm 53 ℃, 30 cycles; d: tm 53 ℃, 32 cycles; e: tm 53 ℃, 34 cycles; f: tm 55 ℃, 32 cycles; g: tm 55 ℃, 34 cycles; h: tm 57 ℃, 32 cycles; i: tm 57 ℃, 34 cycles.
FIG. 9 is a 2% agarose gel electrophoresis of four primers P225F PCR identification system under comparative amplification conditions. Wherein in A to I, 1 and 2: a P225F resistant mutant strain; 3. 4: N230I resistant mutant strains; 5. 6: H272R resistant mutant strains; 7. 8: H272Y resistant mutant strains; 9. 10: wild-sensitive strains. A to I are amplified by adopting primer groups 225-EX-F6, 225-EX-R, 225-M-F6 and 225-S-R3 under the conditions of pre-denaturation at 95 ℃ for 3min, 30 to 34 cycles of denaturation at 95 ℃ for 20S, annealing at 51 to 57 ℃ for 20S, extension at 72 ℃ for 30S and finally extension at 72 ℃ for 5 min. A-I used different annealing temperatures (Tm) and cycle numbers. Wherein A: tm 51 ℃, 32 cycles; b: tm 53 ℃, 32 cycles; c: tm 55 ℃, 30 cycles; d: tm 55 ℃, 32 cycles; e: tm 55 ℃, 34 cycles; f: tm 57 ℃, 32 cycles.
FIG. 10 is a 2% agarose gel electrophoresis of four primers H272R PCR identification system under comparative amplification conditions. Wherein in A to F, 1, 2: a P225F resistant mutant strain; 3. 4: N230I resistant mutant strains; 5. 6: H272R resistant mutant strains; 7. 8: H272Y resistant mutant strains; 9. 10: wild-sensitive strains. A to F adopt primer groups 272-EX-F, 272-EX-R2, 272-M-F2 and 272-S-R2 to carry out amplification under the conditions of pre-denaturation at 95 ℃ for 3min, 30 to 34 cycles of denaturation at 95 ℃ for 20S, annealing at 51 to 57 ℃ for 20S, extension at 72 ℃ for 30S and finally extension at 72 ℃ for 5 min. A-F used different annealing temperatures (Tm) and cycle numbers. Wherein A: tm 51 ℃, 32 cycles; b: tm 53 ℃, 32 cycles; c: tm 55 ℃, 30 cycles; d: tm 55 ℃, 32 cycles; e: tm 55 ℃, 34 cycles; f: tm 57 ℃, 32 cycles.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
The features and properties of the present invention are described in further detail below with reference to examples.
Example 1
Collection of pathogenic strains, determination of resistance phenotype and determination of resistance mutation
The strawberry botrytis cinerea is obtained by separating strawberry botrytis cinerea fruits in Shanghai city in 2017-2018, and is stored in the institute of ecological environment protection of agricultural academy of sciences in Shanghai city. Obtaining the monospore strain by a spore liquid dilution separation method. The method comprises the specific steps of hooking a mildew layer of the diseased fruit by using a sterile toothpick and placing the mildew layer in sterile water. The spore liquid concentration was adjusted to 10ml by a hemocytometer4Within. mu.L of the spore suspension dilution was spread on potato dextrose medium (PDA) plates containing 50ppm streptomycin sulfate and ampicillin. After culturing at 24 ℃ for 2 days, a few terminal hyphae of the single spore colonies growing on the PDA plate were picked up using sterile forceps and inoculated on a new PDA medium plate.
The resistant phenotype of the pathogen was determined using the hyphal growth rate method. Dissolving boscalid raw pesticide in acetone to prepare a mother solution of 50000 mu g/mL. According to the result of the preliminary test, the mother liquor is diluted by acetone in a gradient way to prepare PDA plates containing medicine with final concentrations of 0.1, 0.2, 0.5, 1, 2 and 5 mug/mL respectively for measuring sensitive strains; PDA plates containing drugs with final concentrations of 2, 5, 20, 50 and 110. mu.g/mL were prepared for the determination of resistant strains, and PDA plates with the addition of equal amounts of acetone were used as blanks. The edge of the colony cultured at 24 deg.C for 5 days is punched to obtain a fungus cake with a diameter of 5mm, the fungus cake is inoculated to the center of the drug-containing plate with the above-mentioned series of concentrations, after the culture is inverted in the dark at 24 deg.C for 3 days, the diameter of the colony is measured by a cross method, and each strain and each concentration are repeated for 3 times. The level of resistance was calculated using the sensitivity baseline reported by Zhang et al (1.07. + -. 0.11. mu.g/mL) as a reference standard: level of resistance ═ strain EC50/1.07 μ g/mL. Resistance grading criteria: sensitivity (S) with a resistance level < 10; the level of resistance is ≥ 10 resistance (R).
Respectively selecting resistant strains and sensitive strains, and extracting hypha DNA of the strains. The DNA extraction steps are as follows: adding 0.5g of ground hypha sample into 10mL of Urea extracting solution (7mol/L Urea, 50mmol/L Tris-HCl pH 8.0, 62.5mmol/L NaCl, 1% SDS), shaking, centrifuging at 12000r/min for 5min, sucking supernatant, centrifuging the supernatant again at 12000r/min for 5min, transferring the supernatant into another new tube, adding an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1, volume ratio) solution, shaking forcefully for several times, mixing uniformly, and centrifuging at 12000r/min for 5 min; taking supernatant to a new tube, adding equal volume of isopropanol and 1/10 volume of 3mol/L NaAc (pH 5.2), standing at-20 deg.C for 20min, and centrifuging at 12000r/min for 5 min; discarding the supernatant, inverting to drain the liquid on the tube wall, washing the precipitate with 70% absolute ethyl alcohol, standing at room temperature, drying for 5-10 min, dissolving in 200 μ L double distilled water, adding 2 μ L RNase A (10 μ g/μ L), and storing in water bath at 37 deg.C for 30min and-20 deg.C for later use.
PCR amplification of the succinate dehydrogenase subunit B coding gene (SdhB) sequence was performed on the pathogen mycelium genomic DNA obtained by the above extraction. The PCR system was a 20. mu.L system containing 2 XPCR Supermix of 1/2 volume, 0.25. mu. mol each of primers and 20ng of DNA template.
The sequence of the amplification primer is as follows:
SdhB-F：5’-TCGAACCTACTCGCCCTATCCAATT-3’，SdhB-R：5’-GACTTCTTAGAAAGCCATTTCCTTC-3’。
the PCR amplification conditions were:
pre-denaturation at 95 ℃ for 3 min; 32 cycles of 95 ℃ 20s, 55 ℃ 20s and 72 ℃ 30 s; finally, extension was carried out at 72 ℃ for 5 min.
And (3) entrusting the PCR product obtained by amplification to Shanghai biological engineering Limited company for sequencing, and comparing SdhB subunit sequences of the sensitive and resistant strains by adopting a BLAST n tool of an NCBI website (https:// www.ncbi.nlm.nih.gov) to obtain the resistant mutation type.
The sequence of the wild-type succinate dehydrogenase subunit B encoding gene (SdhB) is as follows:
Atggctgctctccgcacaggtgcccgcagtgcacgcgcgatattcgccgcatcacgaccagctttcagaactcagatgcgaaccatggcatcagtcgacagctcagtacctgaaagtcctaccgtttctccatcccgtcctgtcgaatctgcttccaagacctccactgtcaaggaacctgctgccgactcggagtctttgatcaagacattcaacatttacagatggaacccagatgagccaaccagcaagccccgcatgcaatcttacactttggatctcaacaagactggacctatgatgttggatgcgcttattagaatcaagaatgaggtcgaccctacccttacattcagaagatcttgcagagaaggtatctgcggcagttgtgcaatgaacattgatggagtaaacacattggcttgcttgtgtatgttaatcaactattcaatattaaaacacatttgctgaccatttattctacaggccgcattccaagagacgctaagcacgaaacgaagatctacccactaccccacacctatgtcgtcaaggatattgttccagatttgacacaattctacaagcaatacaagtccattaagccatatcttcaacacaccgacccagcaccagaaggaaaagaatacttgcaatctaaggaggatcgtaagaagcttgatggactttacgaatgtattctctgcgcatgctgctcgacatcttgcccctcctactggtggaacagtgaggagtacttgggaccagctatcttgttgcagagttacagatggcttgcagattcccgtgatcagaagaaggaagaacgtaaggcagctttggataacagcatgagtttgtacagatgtcacactattctcaactgctcgaggacatgtccgaagggattgaatcctggtttggcaattgcggagattaagaaggaaatggctttctaa。
the gene sequence encoding the P225F mutation is as follows:
Atggctgctctccgcacaggtgcccgcagtgcacgcgcgatattcgccgcatcacgaccagctttcagaactcagatgcgaaccatggcatcagtcgacagctcagtacctgaaagtcctaccgtttctccatcccgtcctgtcgaatctgcttccaagacctccactgtcaaggaacctgctgccgactcggagtctttgatcaagacattcaacatttacagatggaacccagatgagccaaccagcaagccccgcatgcaatcttacactttggatctcaacaagactggacctatgatgttggatgcgcttattagaatcaagaatgaggtcgaccctacccttacattcagaagatcttgcagagaaggtatctgcggcagttgtgcaatgaacattgatggagtaaacacattggcttgcttgtgtatgttaatcaactattcaatattaaaacacatttgctgaccatttattctacaggccgcattccaagagacgctaagcacgaaacgaagatctacccactaccccacacctatgtcgtcaaggatattgttccagatttgacacaattctacaagcaatacaagtccattaagccatatcttcaacacaccgacccagcaccagaaggaaaagaatacttgcaatctaaggaggatcgtaagaagcttgatggactttacgaatgtattctctgcgcatgctgctcgacatcttgcttctcctactggtggaacagtgaggagtacttgggaccagctatcttgttgcagagttacagatggcttgcagattcccgtgatcagaagaaggaagaacgtaaggcagctttggataacagcatgagtttgtacagatgtcacactattctcaactgctcgaggacatgtccgaagggattgaatcctggtttggcaattgcggagattaagaaggaaatggctttctaa。
the gene sequence encoding the N230I mutation is as follows:
Atggctgctctccgcacaggtgcccgcagtgcacgcgcgatattcgccgcatcacgaccagctttcagaactcagatgcgaaccatggcatcagtcgacagctcagtacctgaaagtcctaccgtttctccatcccgtcctgtcgaatctgcttccaagacctccactgtcaaggaacctgctgccgactcggagtctttgatcaagacattcaacatttacagatggaacccagatgagccaaccagcaagccccgcatgcaatcttacactttggatctcaacaagactggacctatgatgttggatgcgcttattagaatcaagaatgaggtcgaccctacccttacattcagaagatcttgcagagaaggtatctgcggcagttgtgcaatgaacattgatggagtaaacacattggcttgcttgtgtatgttaatcaactattcaatattaaaacacatttgctgaccatttattctacaggccgcattccaagagacgctaagcacgaaacgaagatctacccactaccccacacctatgtcgtcaaggatattgttccagatttgacacaattctacaagcaatacaagtccattaagccatatcttcaacacaccgacccagcaccagaaggaaaagaatacttgcaatctaaggaggatcgtaagaagcttgatggactttacgaatgtattctctgcgcatgctgctcgacatcttgcccctcctactggtggatcagtgaggagtacttgggaccagctatcttgttgcagagttacagatggcttgcagattcccgtgatcagaagaaggaagaacgtaaggcagctttggataacagcatgagtttgtacagatgtcacactattctcaactgctcgaggacatgtccgaagggattgaatcctggtttggcaattgcggagattaagaaggaaatggctttctaa。
having H272R (the mutated coding gene sequence is as follows:
Atggctgctctccgcacaggtgcccgcagtgcacgcgcgatattcgccgcatcacgaccagctttcagaactcagatgcgaaccatggcatcagtcgacagctcagtacctgaaagtcctaccgtttctccatcccgtcctgtcgaatctgcttccaagacctccactgtcaaggaacctgctgccgactcggagtctttgatcaagacattcaacatttacagatggaacccagatgagccaaccagcaagccccgcatgcaatcttacactttggatctcaacaagactggacctatgatgttggatgcgcttattagaatcaagaatgaggtcgaccctacccttacattcagaagatcttgcagagaaggtatctgcggcagttgtgcaatgaacattgatggagtaaacacattggcttgcttgtgtatgttaatcaactattcaatattaaaacacatttgctgaccatttattctacaggccgcattccaagagacgctaagcacgaaacgaagatctacccactaccccacacctatgtcgtcaaggatattgttccagatttgacacaattctacaagcaatacaagtccattaagccatatcttcaacacaccgacccagcaccagaaggaaaagaatacttgcaatctaaggaggatcgtaagaagcttgatggactttacgaatgtattctctgcgcatgctgctcgacatcttgcccctcctactggtggaacagtgaggagtacttgggaccagctatcttgttgcagagttacagatggcttgcagattcccgtgatcagaagaaggaagaacgtaaggcagctttggataacagcatgagtttgtacagatgtcgcactattctcaactgctcgaggacatgtccgaagggattgaatcctggtttggcaattgcggagattaagaaggaaatggctttctaa。
having H272Y (the mutated coding gene sequence is as follows:
Atggctgctctccgcacaggtgcccgcagtgcacgcgcgatattcgccgcatcacgaccagctttcagaactcagatgcgaaccatggcatcagtcgacagctcagtacctgaaagtcctaccgtttctccatcccgtcctgtcgaatctgcttccaagacctccactgtcaaggaacctgctgccgactcggagtctttgatcaagacattcaacatttacagatggaacccagatgagccaaccagcaagccccgcatgcaatcttacactttggatctcaacaagactggacctatgatgttggatgcgcttattagaatcaagaatgaggtcgaccctacccttacattcagaagatcttgcagagaaggtatctgcggcagttgtgcaatgaacattgatggagtaaacacattggcttgcttgtgtatgttaatcaactattcaatattaaaacacatttgctgaccatttattctacaggccgcattccaagagacgctaagcacgaaacgaagatctacccactaccccacacctatgtcgtcaaggatattgttccagatttgacacaattctacaagcaatacaagtccattaagccatatcttcaacacaccgacccagcaccagaaggaaaagaatacttgcaatctaaggaggatcgtaagaagcttgatggactttacgaatgtattctctgcgcatgctgctcgacatcttgcccctcctactggtggaacagtgaggagtacttgggaccagctatcttgttgcagagttacagatggcttgcagattcccgtgatcagaagaaggaagaacgtaaggcagctttggataacagcatgagtttgtacagatgttacactattctcaactgctcgaggacatgtccgaagggattgaatcctggtttggcaattgcggagattaagaaggaaatggctttctaa。
in this case, the base mutation position is underlined.
Example 2
Respectively arranging 225(Phe, CCC) and 272(His, CAC) sites of the SdhB subunit at the 3 'ends of the primers to preliminarily obtain two specific downstream primers, wherein the primer sequence taking the 225 site as the 3' end comprises 230 sites (Asn, AAC), and screening an upstream primer with the annealing temperature close to that of the downstream primer. To improve primer specificity, experiments were performed with different additional mismatch sites placed near sites 225, 230 and 272 in the two primarily designed downstream primers. First, the downstream primer at position 272 (Tri-272-R. about. Tri-272-R3) was screened (FIG. 4). The primer specificity was considered to be higher when the 272 site non-mutated strain amplified a 282bp band, whereas the H272R and H272Y resistant mutant strains did not, or the band was significantly darker (FIG. 4-A). On the basis, 225 and 230 site specific downstream primers (Tri-225-R1-Tri-225-R11) are added into the upstream primer EX-F and 272 specific primer systems for screening (figure 5). The primer set was considered to have higher specificity only when a 282bp band was amplified from the DNA template of the P225F and N230I resistant mutant strains, a 141bp band was amplified from the H272R and H272Y resistant mutant strains, and a 141bp and 282bp band was amplified from the wild type sensitive pathogen simultaneously (FIG. 5-K).
The PCR systems for primer screening were all 20. mu.L systems, containing 1/2 volumes of 2 XPCR Supermix (Beijing holotype Jinbiol), 0.25. mu. mol of each primer and 20ng of DNA template. The PCR procedure was: pre-denaturation at 95 ℃ for 3 min; 32 cycles of 95 ℃ 20s, 55 ℃ 20s and 72 ℃ 30 s; finally, extension was carried out at 72 ℃ for 5 min. The PCR product was subjected to 2% agarose gel electrophoresis.
The sequences of the primers used in the assay were as follows:
Tri-EX-F：CTTCAACACACCGACCCAGC(SEQ ID NO.1)；
Tri-272-R：CCTCGAGCAGTTGAGAATAGACTG(SEQ ID NO.2)；
Tri-272-R2：CCTCGAGCAGTTGAGAATAGAGTG；
Tri-272-R3：CCTCGAGCAGTTGAGAATAGGTTG；
Tri-225-R1：CCTCACTGTTCCACCAGTTGCAGG；
Tri-225-R2：CTCACTGTACCACCAGTTGCAGGG；
Tri-225-R3：CTCACTGTACGACCAGTTGCAGGG；
Tri-225-R4：CTCACTGTACGACCAGAACGTGGG；
Tri-225-R5：CTCACTGTGACACCAGGAGGAAGG；
Tri-225-R6：CTCACTTTGAGACCAGTAGCAAGG；
Tri-225-R7：CTCACTTTGACACCTGTAGCAAGG；
Tri-225-R8：CTCACTTTGACACCAGTAGCAAGG；
Tri-225-R9：CTCACTCTTGCACCAGTAGCAAGG；
Tri-225-R10：CTCACTGTTGCACCAGTAGCAAGG(SEQ ID NO.3)；
Tri-225-R11：CTCACTGTTCCACCAGTAGCAAGG。
example 3
And (3) carrying out optimization test on the PCR annealing temperature and the cycle number of the three-primer system. According to the primer screening test, a better primer combination (Tri-EX-F, Tri-272-R and Tri-225-R10) is selected for testing. Setting annealing test temperatures to be 51 ℃, 53 ℃, 55 ℃ and 57 ℃ respectively according to the Tm value of the primer, and selecting a better temperature from the annealing test temperatures; and based on the brightness of the band, the detection method is established by selecting the optimal amplification conditions for the tests at cycle numbers of 30, 32 and 34, respectively (FIG. 8). As a result of the condition optimization experiment, the correct band could not be amplified at an annealing temperature of 57 ℃ (FIG. 8-H, FIG. 8-I). At an annealing temperature of 55 ℃, the 141bp band was blurred or shallow, and the band tailing phenomenon was observed in some cases (FIGS. 8-F and 8-G). When the annealing temperature is 53 ℃, the size of the strip is correct, the non-specific strip is not obvious, and the system specificity is higher; of these, 32 cycles (FIG. 8-D) showed higher specificity than 34 cycles (FIG. 8-E) and the bands were brighter than 30 cycles (FIG. 8-C). When the annealing temperature was 51 ℃, the nonspecific band was significant and the detection results were easily affected (FIG. 8-A, FIG. 8-B). Therefore, the primers Tri-EX-F, Tri-272-R and Tri-225-R10 showed high detection specificity and brightest product bands at an annealing temperature of 53 ℃ and a PCR cycle number of 32 (FIG. 8-D).
Example 4
Establishment of three-primer PCR detection system
The three-primer PCR detection system comprises the following primers: Tri-EX-F, Tri-272-R and Tri-225-R10; the amplification system is as follows: 20. mu.L of 2 XPCR Supermix (Beijing holotype gold organism) containing 1/2 volumes, 0.25. mu. mol of each primer and 20ng of DNA. Amplification conditions 95 ℃ 3min 1 cycle; 95 ℃ 20sec, 53 ℃ 20sec, 72 ℃ 30sec, 32 cycles; 5min at 72 ℃ for 1 cycle.
Under the three-primer PCR system, 4 resistant mutation types of 3 mutation sites can be successfully detected, only one 282bp band can be amplified by a DNA template of P225F and N230I resistant mutant strains, only one 141bp band can be amplified by H272R and H272Y resistant mutant strains, and 141bp and 282bp bands can be simultaneously amplified by wild sensitive pathogenic bacteria (figure 1 and figure 8-D).
Example 5
Primer design and screening of four-primer PCR P225F resistance mutation detection system
For the four-primer PCR method for detecting P225F (CCC mutation is TTC) resistant mutation, based on the AS-PCR principle, the mutant base (CC) and the un-mutated base (TT) at the 225 site are respectively arranged at the 3' ends of the inner upstream and downstream primers, and the outer upstream and downstream primers with the annealing temperature close to that of the inner primer are screened. To improve primer specificity, an additional mismatch site was placed near the 3' end of the two preliminarily designed inner primers, and an experiment was conducted to screen for inner specific primers (225-M-F-225-M-F9; 225-S-R-225-S-R4) and to place mismatch sites on the outer primers according to the difference in brightness between the control band and the specific band (225-EX-F-225-EX-F6) (FIG. 6). The primer set was considered to be highly specific only when the P225F strain (CCC) amplified 426bp and 330bp, while the wild type strain (TTC) amplified 426bp and 142bp bands (FIG. 6-S).
The PCR systems for primer screening were all 20. mu.L systems, containing 1/2 volumes of 2 XPCR Supermix (Beijing holotype gold organism), 0.25. mu. mol of each primer and 20ng of DNA. The PCR procedure was: pre-denaturation at 95 ℃ for 3 min; 32 cycles of 95 ℃ 20s, 55 ℃ 20s and 72 ℃ 30 s; finally, extension was carried out at 72 ℃ for 5 min. The PCR product was subjected to 2% agarose gel electrophoresis.
The sequences of the primers used in the assay were as follows:
225-EX-F：CTTCAACACACCGACCCAGC；
225-EX-F2：CTTCAACACACCGAGCGAGC；
225-EX-F3：CTTCAACACACCGTGCGAGC；
225-EX-F4：GCCATATCTTCAACACACCGTGCGAGC；
225-EX-F5：CTTCAACACACCGACGCTGC；
225-EX-F6：CTTCAACACACCGACGCACC(SEQ ID NO.4)；
225-EX-R：ACCGCCCAAAACACCACAAC(SEQ ID NO.5)；
225-EX-R2：GCAATAACCGCCCAAAACACCACAAC；
225-M-F：CATGCTGCTCGACATCTTGCTTC；
225-M-F2：CATGCTGCTCGACATCTCACTTC；
225-M-F3：CATGCTGCTCGACATCTTGGCTT；
225-M-F4：TGCTGCTCGACATCTTTCCTTTC；
225-M-F5：TGCTGCTCGACATCTTGGCTTTC；
225-M-F6：CTGCTCGACATCTTGGCTTTCC；
225-M-F7：GGGGCGGGCGCTCGACATCTTGGCTTTCC；
225-M-F8：CATGCTGCTCGACATCTTACTTC；
225-M-F9：CATGCTGCTCGACATCTAACTTC(SEQ ID NO.6)；
225-M-F10：CATGCTGCTCGACATCGAACTTC；
225-M-F11：CATGCTGCTCGACATCAAGCTTC；
225-S-R：CCTCACTCTTCCACCAGTAGGAGG；
225-S-R2：CCTCACTGTTCCACCAGTAGCAGG；
225-S-R3：CCTCACTGTTCCACCAGTTGCAGG(SEQ ID NO.7)；
225-S-R4：GGGGCGGGGCACTGTTCCACCAGTTGCAGG。
example 6
Condition optimization of four-primer PCR P225F resistance mutation detection system
The optimization experiment was performed on the PCR annealing temperature and cycle number of the four-primer PCR P225F resistant mutation detection system (fig. 9). Preferred combinations of primers (225-EX-F6, 225-EX-R, 225-M-F9 and 225-S-R3) were selected for the tests based on the above-described primer screening tests. Setting annealing test temperatures to be 51 ℃, 53 ℃, 55 ℃ and 57 ℃ respectively according to the Tm value of the primer, and selecting the optimal temperature from the annealing test temperatures; and according to the brightness of the strip, performing tests when the cycle numbers are respectively 30, 32 and 34, and selecting the optimal combination and amplification conditions to establish a detection method.
When the annealing temperature was 57 ℃, the band was dark and the specific band could not be clearly recognized (FIG. 9-F). When the annealing temperature is 55 ℃, the specificity is high and the strip is bright; of these, the bands were brighter at 32 cycles (FIG. 9-D) than at 30 cycles (FIG. 9-C), and the bands were more prone to banding at 34 cycles (FIG. 9-E). The annealing temperatures were 53 ℃ and 51 ℃ (FIGS. 9-A and 9-B), and bands with correct sizes could not be amplified. Thus, the primer sets 225-EX-F6, 225-EX-R, 225-M-F9, and 225-S-R3 exhibited the highest detection specificity and the brightest product band at an annealing temperature of 55 ℃ and a PCR cycle number of 32 (FIG. 9-D).
Example 7
Establishment of four-primer PCR P225F resistance mutation detection system
The four-primer PCR P225F resistance mutation detection system primer is: 225-EX-F6, 225-EX-R, 225-M-F9, 225-S-R3; the amplification system is as follows: 20. mu.L of 2 XPCR Supermix (Beijing holotype gold organism) containing 1/2 volumes, 0.25. mu. mol of each primer and 20ng of DNA. Amplification conditions 95 ℃ 3min 1 cycle; 95 ℃ 20sec, 55 ℃ 20sec, 72 ℃ 30sec, 32 cycles; 5min at 72 ℃ for 1 cycle.
Under the four-primer PCR system, 426bp positive control bands can be amplified by botrytis cinerea, 330bp bands can be specifically amplified by the P225F mutant strain, and 142bp bands can be specifically amplified by the 225 (and 230) site non-mutant strain. While the other mutant strains (N230I) of 225 or 230 except P225F only amplified the 426bp band of the positive control, and no other specific band. Therefore, the system can specifically detect the occurrence of the botrytis cinerea P225F resistance mutation.
Example 8
Primer design and screening of four-primer PCR H272R resistance mutation detection system
For the four-primer PCR method for detecting H272R (CAC mutation to CGC) resistant mutation, based on the AS-PCR principle, the mutant base (G) and the unmutated base (A) at the 225 th site are respectively arranged near the 3' ends of the inner upstream and downstream primers, and the outer upstream and downstream primers with the annealing temperature close to that of the inner primer are screened. To improve primer specificity, an additional mismatch site was placed near the 3' end of the two preliminarily designed inner primers, an experiment was conducted to screen the inner specific primers (272-M-F. about. 272-M-F4; 272-S-R. about. 272-S-R2), and an experiment was conducted by placing mismatch sites on the outer primers according to the difference in brightness between the control band (the band amplified by the 2 outer primers) and the specific band (272-EX-F. about. 272-EX-F2) (FIG. 7). The primer set was considered to be highly specific only when H272R amplified 540bp and 192bp, whereas the wild type strain amplified 540bp and 394bp bands (FIG. 7-C).
The PCR systems for primer screening were all 20. mu.L systems, containing 1/2 volumes of 2 XPCR Supermix (Beijing holotype gold organism), 0.25. mu. mol of each primer and 20ng of DNA. The PCR procedure was: pre-denaturation at 95 ℃ for 3 min; 32 cycles of 95 ℃ 20s, 55 ℃ 20s and 72 ℃ 30 s; finally, extension was carried out at 72 ℃ for 5 min. The PCR product was subjected to 2% agarose gel electrophoresis.
The sequences of the primers used in the assay were as follows:
272-EX-F：AGACGCTAGCACGAAACGA(SEQ ID NO.8)；
272-EX-F2：CATTCCAAGAGACGCTAAGCACGAAACGA；
272-EX-R：TAACCGCCCAAAACACCACA；
272-EX-R2：TAACCGCCCAAAACACGTCA(SEQ ID NO.9)；
272-EX-R3：CGATTCAATAACCGCCCAAAACACGTCA；
272-M-F：AGCATGAGTTTGTACAGATGACGC；
272-M-F2：AGCATGAGTTTGTACAGATCGCGC(SEQ ID NO.10)；
272-M-F3：GGGGCGAGCATGAGTTTGTACAGATCGCGC；
272-S-R：CCTCGAGCAGTTGAGAATAGAGTG；
272-S-R2：CCTCGAGCAGTTGAGAATAGACTG(SEQ ID NO.11)；
272-S-R3：GGGGCGCCTCGAGCAGTTGAGAATAGACTG。
example 9
Condition optimization of four-primer PCR H272R resistance mutation detection system
The optimization experiment was performed on the PCR annealing temperature and cycle number of the four-primer PCR H272R resistant mutation detection system (fig. 10). Preferred combinations of primers (272-EX-F, 272-EX-R2, 272-M-F2, and 272-S-R2) were selected and tested according to the above-described primer screening test. Setting annealing test temperatures to be 51 ℃, 53 ℃, 55 ℃ and 57 ℃ respectively according to the Tm value of the primer, and selecting the optimal temperature from the annealing test temperatures; and according to the brightness of the strip, performing tests when the cycle numbers are respectively 30, 32 and 34, and selecting the optimal combination and amplification conditions to establish a detection method.
When the annealing temperature was 57 ℃ (FIG. 10-F), the 192bp band was darker and the non-specific band was more likely to appear. When the annealing temperature is 55 ℃, the specificity is better and the strips are bright; among them, the H272Y mutant strain had a relatively obvious 394bp band (a characteristic band of 272-site non-mutation) at 34 cycles (FIG. 10-E), while the H272Y mutant strain had a darker band at 30 cycles (FIG. 10-C), and the amplification result was optimal at 32 cycles (FIG. 10-D). Both at 53 ℃ and 51 ℃ (FIGS. 10-A and 10-B), the amplification results were not correct. Therefore, the four primer sets 272-EX-F, 272-EX-R2, 272-M-F2, and 272-S-R2 showed the highest detection specificity and the brightest product band at an annealing temperature of 55 ℃ and a PCR cycle number of 32 (FIG. 10-D).
Example 10
Establishment of four-primer PCR H272R resistance mutation detection system
The primers of the four-primer PCR H272R resistance mutation detection system are as follows: 272-EX-F, 272-EX-R2, 272-M-F2, 272-S-R2; the amplification system is as follows: 20. mu.L of 2 XPCR Supermix (Beijing holotype gold organism) containing 1/2 volumes, 0.25. mu. mol of each primer and 20ng of DNA. Amplification conditions 95 ℃ 3min 1 cycle; 95 ℃ 20sec, 55 ℃ 20sec, 72 ℃ 30sec, 32 cycles; 5min at 72 ℃ for 1 cycle.
Under the four-primer PCR system, the botrytis cinerea can amplify a 540bp positive control band, the H272R mutant strain (CGC) can specifically amplify a 192bp band, and the 272-locus unmutated strain (CAC) can specifically amplify a 394bp band. The H272Y mutant strain (TAC) can only amplify the positive control 540bp band (sometimes with a very weak 394bp band). Therefore, the system can specifically detect the generation of the botrytis cinerea H272R resistance mutation.
The above experimental results demonstrate that: the three-primer PCR resistance detection system can effectively distinguish Boscalid resistance and sensitive Botrytis cinerea. Further, the results were verified by using the four-primer P225F test system or H272R test system, and the types of resistant mutations of the resistant strains were further clarified. The four-primer P225F detection system or the H272R detection system can be used alone to effectively detect the resistance mutation at the 225(230) or 272 (two mutation hot spots), respectively.
It should be noted that, after reading the above teaching of the present invention, those skilled in the art can modify or extend the sequence of the above 3 sets of primers by partial bases, and perform PCR amplification, so as to obtain the effects of the 3 sets of primers of the present invention, and these equivalents also fall within the scope of the claims appended to the present application.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> Shanghai city academy of agricultural sciences
<120> primer combination, kit and method for detecting Botrytis cinerea resistance to boscalid
<160> 11
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence
<400> 1
cttcaacaca ccgacccagc 20
<210> 2
<211> 24
<212> DNA
<213> Artificial sequence
<400> 2
cctcgagcag ttgagaatag actg 24
<210> 3
<211> 24
<212> DNA
<213> Artificial sequence
<400> 3
ctcactgttg caccagtagc aagg 24
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<400> 4
cttcaacaca ccgacgcacc 20
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence
<400> 5
accgcccaaa acaccacaac 20
<210> 6
<211> 23
<212> DNA
<213> Artificial sequence
<400> 6
catgctgctc gacatctaac ttc 23
<210> 7
<211> 24
<212> DNA
<213> Artificial sequence
<400> 7
cctcactgtt ccaccagttg cagg 24
<210> 8
<211> 19
<212> DNA
<213> Artificial sequence
<400> 8
agacgctagc acgaaacga 19
<210> 9
<211> 20
<212> DNA
<213> Artificial sequence
<400> 9
taaccgccca aaacacgtca 20
<210> 10
<211> 24
<212> DNA
<213> Artificial sequence
<400> 10
agcatgagtt tgtacagatc gcgc 24
<210> 11
<211> 24
<212> DNA
<213> Artificial sequence
<400> 11
cctcgagcag ttgagaatag actg 24
Claims (12)
1. A primer group for detecting the resistance of botrytis cinerea to boscalid is characterized by comprising the following primer combinations: a primer combination 1, a primer combination 2 and a primer combination 3;
wherein, the primer combination 1 comprises: primers shown in SEQ ID NO. 1-3;
the primer combination 2 comprises: primers shown in SEQ ID NO. 4-7;
the primer combination 3 comprises: primers shown in SEQ ID NO. 8-11.
2. A kit for detecting resistance of botrytis cinerea to boscalid, characterized by comprising the primer set according to claim 1.
3. A method for detecting resistance of Botrytis cinerea to boscalid, which is characterized by comprising any one of the following steps:
step (a): carrying out PCR on a sample to be detected by using the primer combination 1;
step (b): carrying out PCR on a sample to be detected by using the primer combination 2;
and, step (c): carrying out PCR on a sample to be detected by using the primer combination 3;
wherein, the primer combination 1 comprises: primers shown in SEQ ID NO. 1-3;
the primer combination 2 comprises: primers shown in SEQ ID NO. 4-7;
the primer combination 3 comprises: primers shown in SEQ ID NO. 8-11.
4. The method of claim 3, comprising steps (a) and (b) performed sequentially.
5. The method of claim 3, comprising steps (a) and (c) performed sequentially.
6. The method for detecting Botrytis cinerea resistance to boscalid according to claim 3, wherein in the step (a), the annealing temperature is set to 52-54 ℃ when the PCR is performed.
7. The method for detecting Botrytis cinerea resistance to boscalid according to claim 6, wherein in the step (a), the number of cycles is set to 30-34 cycles when PCR is performed.
8. The method for detecting Botrytis cinerea resistance to boscalid according to claim 3, wherein in the step (b), the annealing temperature is set to 54-56 ℃ when the PCR is performed.
9. The method for detecting boscalid resistance to botrytis cinerea according to claim 8, wherein in the step (b), the number of cycles is set to 30-34 cycles when PCR is performed.
10. The method for detecting Botrytis cinerea resistance to boscalid according to claim 3, wherein in the step (c), the annealing temperature is set to 54-56 ℃ when the PCR is performed.
11. The method for detecting boscalid resistance to botrytis cinerea according to claim 10, wherein in the step (c), the number of cycles is set to 30-34 cycles when PCR is performed.
12. The method for detecting Botrytis cinerea resistance to boscalid according to claim 7, 9 or 11,
in step (a), the procedure for performing PCR using primer set 1 includes: denaturation: 95 ℃ and 20s, annealing: 53 ℃, 20s, extension: 72 ℃, 30s, 32 cycles;
in step (b), the procedure for performing PCR using primer set 2 includes: denaturation: 95 ℃ and 20s, annealing: 55 ℃, 20s, extension: 72 ℃, 30s, 32 cycles;
in step (c), the procedure for performing PCR using primer set 3 includes: denaturation: 95 ℃ and 20s, annealing: 55 ℃, 20s, extension: 72 ℃, 30s, 32 cycles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811345216.6A CN109338004B (en) | 2018-11-12 | 2018-11-12 | Primer combination, kit and method for detecting resistance of botrytis cinerea to boscalid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811345216.6A CN109338004B (en) | 2018-11-12 | 2018-11-12 | Primer combination, kit and method for detecting resistance of botrytis cinerea to boscalid |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109338004A CN109338004A (en) | 2019-02-15 |
| CN109338004B true CN109338004B (en) | 2021-06-22 |
Family
ID=65314591
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811345216.6A Active CN109338004B (en) | 2018-11-12 | 2018-11-12 | Primer combination, kit and method for detecting resistance of botrytis cinerea to boscalid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109338004B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115786560B (en) * | 2022-08-12 | 2024-03-22 | 上海市农业科学院 | Primer group, kit and method for detecting B subunit point mutation type of succinate dehydrogenase of Botrytis cinerea |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103789409B (en) * | 2013-11-15 | 2015-05-27 | 中国农业大学 | Molecular detection method for identifying insecticide resistance of Botrytis cinerea on zoxamide |
| CN103725776B (en) * | 2013-12-08 | 2015-07-08 | 北京工业大学 | ARMS-based method for detecting botryis cinerea SdhB gene H272Y mutation |
| CN105154432B (en) * | 2015-09-17 | 2018-04-06 | 北京工业大学 | A kind of method and its multiple PCR primer group for being used to expand four genes of the pathogen of Botrytis cinerea |
| CN106191205A (en) * | 2016-09-14 | 2016-12-07 | 江苏丘陵地区镇江农业科学研究所 | A kind of ash arrhizus bacteria method for quick drug-fast to various medicaments |
| KR101917368B1 (en) * | 2016-11-14 | 2019-01-29 | 대한민국 | Selective medium for isolation of Botyrtis cinerea and Use Thereof |
-
2018
- 2018-11-12 CN CN201811345216.6A patent/CN109338004B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN109338004A (en) | 2019-02-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101883117B1 (en) | SNP marker for selecting tomato cultivars resistant to tomato Bacterial wilt and use thereof | |
| Ahmadvand et al. | Development of molecular tools for distinguishing between the highly similar Rx1 and Rx2 PVX extreme resistance genes in tetraploid potato | |
| Dubey et al. | Molecular diversity analysis of Rhizoctonia solani isolates infecting various pulse crops in different agro-ecological regions of India | |
| JP2004533230A (en) | Method | |
| KR101970264B1 (en) | CAPS marker for discriminating bacterial wilt-resistant pepper cultivar and uses thereof | |
| Shen et al. | Development of a loop‐mediated isothermal amplification assay for rapid and sensitive detection of Sporisorium scitamineum in sugarcane | |
| Sławiak et al. | Multiplex detection and identification of bacterial pathogens causing potato blackleg and soft rot in Europe, using padlock probes | |
| CN109338004B (en) | Primer combination, kit and method for detecting resistance of botrytis cinerea to boscalid | |
| CN111961751B (en) | KASP primer for detecting tomato root knot nematode resistance gene Mi-1.2 and application thereof | |
| CN110699475B (en) | Padlock probe of pecan alternaria alternata and detection method thereof | |
| KR20090011741A (en) | Scar marker involving in powderly mildew resistance and selection method in melon thereof | |
| CN110760604B (en) | Padlock probe for pecan anthracnose pathogen and detection method thereof | |
| JP2014003946A (en) | Method for detecting thermoascus fungus | |
| CN112176080B (en) | Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma | |
| KR101955074B1 (en) | Snp markers for discrimination of raphanus sativus | |
| CN112410463B (en) | Molecular marker for resisting bacterial wilt of tomatoes and application of molecular marker | |
| CN114032334A (en) | Primer group and kit for detecting quinoa phomopsis and detection method thereof | |
| KR100490483B1 (en) | DNA marker, primer kits, and method for effective detection of clubroot disease resistant plant | |
| CN111394491B (en) | Mushroom mating type molecular marker and application thereof in identification of mushroom mating type | |
| KR20160056219A (en) | Single Nucleotide Polymorphism Marker Useful for Selecting Pathogen Resistance Tomato | |
| KR102412793B1 (en) | SNP genetic markers and primer sets for discriminating domestic wheat cultivar and uses thereof | |
| Kyrova et al. | Diagnostics of phytopathogens of genus Xanthomonas infecting Poaceae plants | |
| Trang et al. | Analyzing sequence variation of the avirulence Avr-Pita1 gene of rice blast isolates, Magnaporthe oryzae in vietnam | |
| CN113430289B (en) | Primer pair, kit and method for detecting and identifying Dike's bacteria | |
| Chakdar et al. | New generation markers for fingerprinting and structural analysis of fungal community |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |