CN109338004A - A kind of detection ash arrhizus bacteria is to the combination of the primer of Boscalid resistance, kit and method - Google Patents
A kind of detection ash arrhizus bacteria is to the combination of the primer of Boscalid resistance, kit and method Download PDFInfo
- Publication number
- CN109338004A CN109338004A CN201811345216.6A CN201811345216A CN109338004A CN 109338004 A CN109338004 A CN 109338004A CN 201811345216 A CN201811345216 A CN 201811345216A CN 109338004 A CN109338004 A CN 109338004A
- Authority
- CN
- China
- Prior art keywords
- primer
- boscalid
- pcr
- resistance
- tri
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of detection ash arrhizus bacterias to primer combination, kit and the method for Boscalid resistance, is related to technical field of agriculture science.Primer combination includes one of following primer combination or a variety of: primer combination 1, primer combination 2 and primer combination 3；Wherein, primer combination 1 includes: primer shown in SEQ ID NO.1-3；Primer combination 2 includes: primer shown in SEQ ID NO.4-7；Primer combination 3 includes: primer shown in SEQ ID NO.8-11.The ash arrhizus bacteria and its mutation type for Boscalid generating resistance resistant to Boscalid can quickly and efficiently be identified using the primer sets.
Description
Technical field
The present invention relates to technical field of agriculture science, anti-to Boscalid in particular to a kind of detection ash arrhizus bacteria
Property primer combination, kit and method.
Background technique
Grey mould fruit rot of strawberry (gray mold disease) is one of the most serious disease for endangering strawberry production and storage.
Its cause of disease Botrytis cinerea (Botrytis cinerea Pers.) can also infect more than 200 crop such as grape, cucumber, tomato, produce
The symptoms such as raw soft rotten, black rotten, mildew, cause heavy economic losses.
Succinate dehydrogenase inhibitors (SDHIs) are the fungicide of a kind of phosphinylidyne-containing amine group, by inhibiting germ line grain
The electron transport chain protein complexes II (succinate dehydrogenase, SDH) of body are active and play the protection or therapeutic effect to crop.
Boscalid be 2003 enter market picolinamide class SDHI, low toxicity, and to Sclerotinia (Sclerotinia spp.),
Alternaria (Alternaria spp.), Botrytis (Botrytis spp.), mycosphaerella (Mycosphaerella
) etc. spp. fungies have preferable inhibitory activity.Boscalid stretches the spore germination of Botrytis cinerea (B.cinerea), germ tube
Length, note fields, mycelia growth etc. have efficient inhibiting effect, and have preferable Uptake and translocation in plant leaf blade and stem
Characteristic, the field control being proved to grey mould fruit rot of strawberry are highly effective.
Since B.cinerea reproduction speed is fast, spore quantity is big and is relatively also easy to produce hereditary variation, belong to easily anti-to medicament generation
A kind of plant pathogenic fungi of property.Meanwhile Boscalid action site is single, the single nucleotide mutation of pathogenic bacteria gene group can
Resistance can be generated to it, the world the Yi Bei fungicide resistance committee (FRAC) regards as generating the higher fungicide of resistance risk,
B.cinerea- Boscalid also is regarded as being the pathogen-antimicrobial combination with highly resistant risk by FRAC.China, beauty
Has there is the report that field B.cinerea generates resistance to Boscalid in the country such as state, Germany, and under control efficiency
Drop.
Therefore, grasping and understanding Botrytis cinerea germ i.e. B.cinerea is to improve prevention and treatment strawberry to the resistance of Boscalid
One of the measure of ash arrhizus bacteria effect.But currently, whether shortage detection Botrytis cinerea germ is resistant to Boscalid
Related reagent.
In consideration of it, the present invention is specifically proposed.
Summary of the invention
The purpose of the present invention is to provide a kind of detection ash arrhizus bacterias to the primer sets of Boscalid resistance, using the primer
Group can quickly and efficiently identify the ash arrhizus bacteria resistant to Boscalid and it generates resistance to Boscalid and dashes forward
Become type.
Another object of the present invention is to provide a kind of detection ash arrhizus bacterias to the kit of Boscalid resistance, using this
Kit can quickly and efficiently identify the ash arrhizus bacteria resistant to Boscalid and it generates resistance to Boscalid
Mutation type.
Another object of the present invention is to provide a kind of detection ash arrhizus bacterias to the method for Boscalid resistance, using the party
Method can quickly and efficiently identify the ash arrhizus bacteria resistant to Boscalid and it generates resistance to Boscalid and dashes forward
Become type.
The present invention is implemented as follows:
B.cinerea generates the resistance of Boscalid mainly prominent with pathogen succinate dehydrogenase SdhB subunit generation point
Become related, the most common mutational site is 225 sites (proline) and 272 sites (histidine), including P225L/F/T with
The mutation types such as H272Y/R/L, P225F, H272R, H272Y etc. are common resistant mutation type.
AS-PCR (Allele-specific PCR) is current detection pathogen in fungicide resistant mutation Molecular Detection
One of most common method.The principle of AS-PCR be by specific site at PCR primer 3 ' end with template completely and not exclusively
The amplification efficiency difference of pairing, determines the catastrophe of the specific site.The method has many advantages, such as simple, quick, accurate.
Based on this, one aspect of the present invention provides a kind of detection ash arrhizus bacteria to the primer sets of Boscalid resistance, packet
Include one of following primer combination or a variety of: primer combination 1, primer combination 2 and primer combination 3；
Wherein, primer combination 1 includes: primer shown in SEQ ID NO.1-3；
Primer combination 2 includes: primer shown in SEQ ID NO.4-7；
Primer combination 3 includes: primer shown in SEQ ID NO.8-11；
Preferably, the primer sets include primer combination 1；
Preferably, the primer sets include primer combination 1 and primer combination 2；
Preferably, the primer sets include primer combination 1 and primer combination 3.
Based on AS-PCR principle and combine Botrytis cinerea germ to the resistance mutation sites of Boscalid (on SdhB subunit
P225F (CCC sports TTC), N230I (AAC sports ATC), (CAC is mutated by H272R (CAC sports CGC) and H272Y
For TAC)), design for SdhB subunit 4 kinds of above-mentioned 3 mutational sites (225,230 and 272) of inventor are prominent
The primer combination 1 containing three primers for becoming type (P225F, N230I, H272R and H272Y) is used for the pyridine acyl bacterium of ash arrhizus bacteria
Amine resistance carries out Preliminary detection.
The primer combines 1
External primers Tri-EX-F:
5'-CTTCAACACACCGACCCAGC-3'(SEQ ID NO.1)；
Internal primer Tri-272-R:
5'-CCTCGAGCAGTTGAGAATAGACTG-3'(SEQ ID NO.2)；
Internal primer Tri-225-R10:
5’-CTCACTGTTGCACCAGTAGCAAGG-3’(SEQ ID NO.3)。
The band for using primer combination 1 that can not mutate with specific amplification at site, can distinguish wild sensitive strain
(without resistance) is used for with 4 kinds of mutant strains (P225F, N230I, H272R and H272Y) of Boscalid resistance
The Boscalid resistance of ash arrhizus bacteria carries out Preliminary detection.
The DNA profiling of P225F and N230I resistant mutant strains is only capable of amplifying a 282bp band, H272R and H272Y
Resistant mutant strains are only capable of amplifying a 141bp band, and wild-type sensitive germ can amplify 141bp and 282bp simultaneously
Band.
In addition, for specificity identification have Boscalid resistance mutant strain specific mutation type (be P225F,
N230I or H272R or H272Y), it can be identified using primer combination 2 and primer combination 3.
Primer combination 2 can be used for the detection of P225F (CCC sports TTC) resistant mutation, and primer combination 2 includes following 4
Primer:
External primers 225-EX-F6:
5'-CTTCAACACACCGACGCACC-3'(SEQ ID NO.4)；
External primers 225-EX-R:
5'-ACCGCCCAAAACACCACAAC-3'(SEQ ID NO.5)；
Internal primer 225-M-F9:
5'-CATGCTGCTCGACATCTAACTTC-3'(SEQ ID NO.6)；
Internal primer 225-S-R3:
5’-CCTCACTGTTCCACCAGTTGCAGG-3’(SEQ ID NO.7)。
When carrying out PCR amplification using primer combination 2, the item of 426bp can be amplified for the bacterial strain being mutated with P225F
The specific band of band and 330bp, for do not have P225F mutation bacterial strain amplify be 426bp band and 142bp it is big
Small specific band.Therefore it can distinguish whether ash arrhizus bacteria bacterial strain sample has pyridine by the stripe size and type that amplify
Acyl bacterium amine resistant mutation P225F.
Primer combination 3 can be used for the detection for H272R (CAC sports CGC) resistant mutation, and primer combination 3 includes
Following 4 primers:
External primers 272-EX-F:
5'-AGACGCTAAGCACGAAACGA-3'(SEQ ID NO.8)；
External primers 272-EX-R2:
5'-TAACCGCCCAAAACACGTCA-3'(SEQ ID NO.9)；
Internal primer 272-M-F2:
5'-AGCATGAGTTTGTACAGATCGCGC-3'(SEQ ID NO.10)；
Internal primer 225-S-R2:
5’-CCTCGAGCAGTTGAGAATAGACTG-3’(SEQ ID NO.11)。
When carrying out PCR amplification using primer combination 3, the item of 540bp can be amplified for the bacterial strain being mutated with H272R
The specific band of band and 192bp, for do not have H272R mutation bacterial strain amplify be 540bp band and 394bp it is big
Small specific band.Therefore it can distinguish whether ash arrhizus bacteria bacterial strain sample has pyridine by the stripe size and type that amplify
Acyl bacterium amine resistant mutation H272R.
Ash arrhizus bacteria easily generates resistance to Boscalid, so as to cause prevention and treatment failure, causes serious economic loss.And it passes
The method for sensitivity Detection of uniting, mycelial growth rate method or spore germination inhibit method, are required to cultivate pathogen, time-consuming
Longer, complex steps are not suitable for the detection of gross sample.Therefore, section of the foundation of resistance rapid detection method to Boscalid
Utilize, the efficient prevention and control of disease are of crucial importance.
Detection ash arrhizus bacteria provided by the invention passes through band using primer combination 1 to the primer sets of Boscalid resistance
Difference is quickly and efficiently identified the ash arrhizus bacteria of Boscalid resistance, and can further be examined using primer combination 2 for P225F
It surveys or is detected using primer combination 3 for H272R, two kinds of high frequency mutation types are identified, resistant strain is quickly obtained
Mutation type, the efficient prevention and control for the scientific utilization, gray mold fungus damage of Boscalid provide safeguard.
In addition, 3 ' ends are nearby provided with mismatch site in above-mentioned each internal primer in primer sets provided by the present invention,
It is greatly improved specificity when amplification.
On the other hand, the present invention provides a kind of detection ash arrhizus bacterias to the kit of Boscalid resistance comprising on
The primer sets stated.
Further, in some embodiments of the present invention, which further includes PCR reaction buffer；
The PCR reaction buffer contains: Taq archaeal dna polymerase, mg2+And dNTPs.
The kit can quickly and efficiently identify the ash arrhizus bacteria of Boscalid resistance, obtain the mutation class of resistant strain
Type has the characteristics that easy to operate, result is accurate, provides for the scientific utilization of Boscalid, the efficient prevention and control of gray mold fungus damage
It ensures.
In another aspect, the present invention provides a kind of detection ash arrhizus bacterias to the method for Boscalid resistance comprising as follows
Any one step in step:
Step (a): 1 pair of sample to be tested is combined using primer and carries out PCR；
Step (b): 2 pairs of samples to be tested are combined using primer and carry out PCR；
And step (c): 3 pairs of samples to be tested are combined using primer and carry out PCR；
Wherein, primer combination 1 includes: primer shown in SEQ ID NO.1-3；
Primer combination 2 includes: primer shown in SEQ ID NO.4-7；
Primer combination 3 includes: primer shown in SEQ ID NO.8-11；
Preferably, the method includes the steps (a)；
Preferably, the method includes successively carrying out the step of (a) and step (b)；
Preferably, the method includes successively carrying out the step of (a) and step (c).
Further, in some embodiments of the present invention, in step (a), when carrying out PCR, annealing temperature setting
It is 52-54 DEG C.
Further, in some embodiments of the present invention, in step (a), when carrying out PCR, recurring number is set as
30-34 circulation.
Further, in some embodiments of the present invention, in step (b), when carrying out PCR, annealing temperature setting
It is 54-56 DEG C.
Further, in some embodiments of the present invention, in step (b), when carrying out PCR, recurring number is set as
30-34 circulation.
Further, in some embodiments of the present invention, in step (c), when carrying out PCR, annealing temperature setting
It is 54-56 DEG C.
Further, in some embodiments of the present invention, in step (c), when carrying out PCR, recurring number is set as
30-34 circulation.
Further, in some embodiments of the present invention, in step (a), carry out PCR's using primer combination 1
Program includes: denaturation: 95 DEG C, 20s, and annealing: 53 DEG C, 20s extend: 72 DEG C, 30s, 32 circulations；
In step (b), the program using 2 progress PCR of primer combination includes: denaturation: 95 DEG C, 20s, is annealed: 55 DEG C,
20s extends: 72 DEG C, 30s, 32 circulations；
In step (c), the program using 3 progress PCR of primer combination includes: denaturation: 95 DEG C, 20s, is annealed: 55 DEG C,
20s extends: 72 DEG C, 30s, 32 circulations.
Detection ash arrhizus bacteria provided by the invention to the method for Boscalid resistance on the basis of designed primer sets,
The ash arrhizus bacteria and its mutation for Boscalid generating resistance resistant to Boscalid can quickly and efficiently be identified
Type.
Furthermore by the scientific optimization to PCR reaction condition, detection method provided by the invention also improves each primer sets
The specificity and amplification efficiency when carrying out PCR are closed, the brightness of band, is easy to observe when greatly improving electrophoresis detection.
To sum up, detection ash arrhizus bacteria provided by the invention has primer combination, kit and the method for Boscalid resistance
It has the advantage that
(1) detection range is wide: it is reported all to be related to the country, and studies the most of resistant gene having found in the world
Type.
(2) identify quick: completing detection time only needs 3-4 hours；Traditional Plating needs the time long, when needing 1 week or more
Between.
(3) specificity is good: can effectively distinguish sensitive strain and 4 kinds of resistant mutant strains.
(4) easy to operate: it is only necessary to conventional reagents needed for 1 PCR amplification instrument and pcr amplification reaction by the present invention.
Therefore primer sets, kit and detection method provided by the invention have very high practical value.
Detailed description of the invention
In order to illustrate the technical solution of the embodiments of the present invention more clearly, below will be to needed in the embodiment attached
Figure is briefly described, it should be understood that the following drawings illustrates only certain embodiments of the present invention, therefore is not construed as pair
The restriction of range for those of ordinary skill in the art without creative efforts, can also be according to this
A little attached drawings obtain other relevant attached drawings.
Fig. 1 is 2% agarose gel electrophoresis figure that Tri-primer PCR detects ash arrhizus bacteria Boscalid resistance, wherein M:
Marker；1,2:P225F resistant mutant strains；3,4:N230I resistant mutant strains；5,6:H272R resistant mutant strains；7,8:
H272Y mutant strain；9,10: wild-type sensitive bacterial strain.
Fig. 2 is 2% agarose gel electrophoresis figure of four primer P225F PCR identification systems, wherein M:Marker；1,2:
P225F resistant mutant strains；3,4:N230I resistant mutant strains；5,6:H272R resistant mutant strains；7,8:H272Y mutant bacteria
Strain；9,10: wild-type sensitive bacterial strain.
Fig. 3 is 2% agarose gel electrophoresis figure of four primer H272R PCR identification systems, wherein M:Marker；1,2:
P225F resistant mutant strains；3,4:N230I resistant mutant strains；5,6:H272R resistant mutant strains；7,8:H272Y mutant bacteria
Strain；9,10: wild-type sensitive bacterial strain.
Fig. 4 is 2% agarose gel electrophoresis figure of 272 site-specific primer screenings in Tri-primer PCR detection architecture.Wherein
In A~C, 1-2:P225F mutant strain；3-4:N230I mutant strain；5-6:H272R mutant strain；7-8:H272Y mutant bacteria
Strain.A: the amplification of primer Tri-EX-F and Tri-272-R；B: the amplification of primer Tri-EX-F and Tri-272-R2；
C: the amplification of primer Tri-EX-F and Tri-272-R3；
Fig. 5 is 2% agarose gel electrophoresis figure of Tri-primer PCR detection architecture specific primer screening.Wherein in A~G,
M:Marker；1-3:P225F resistant mutant strains；4-6:N230I resistant mutant strains；7~9:H272R resistant mutant strains；
10,11:H272Y resistant mutant strains；12~14: wild sensitive strain.Wherein in H~K, 1,2:P225F resistant mutation bacterium
Strain；3,4:N230I resistant mutant strains；5,6:H272R resistant mutant strains；7,8:H272Y resistant mutant strains；9,10: wild
Raw sensitive strain.A: the amplification of primer sets Tri-EX-F, Tri-272-R and Tri-225-R1；B: primer sets Tri-EX-
F, the amplification of Tri-272-R and Tri-225-R2；C: the expansion of primer sets Tri-EX-F, Tri-272-R and Tri-225-R3
Increase result；D: the amplification of primer sets Tri-EX-F, Tri-272-R and Tri-225-R4.E: primer sets Tri-EX-F, Tri-
The amplification of 272-R and Tri-225-R5；F: the amplification of primer sets Tri-EX-F, Tri-272-R and Tri-225-R6；
G: the amplification of primer sets Tri-EX-F, Tri-272-R and Tri-225-R7；H: primer sets Tri-EX-F, Tri-272-R with
The amplification of Tri-225-R8；I: the amplification of primer sets Tri-EX-F, Tri-272-R and Tri-225-R9；J: primer
The amplification of group Tri-EX-F, Tri-272-R and Tri-225-R11.K: primer sets Tri-EX-F, Tri-272-R and Tri-
The amplification of 225-R10.
Fig. 6 is 2% agarose gel electrophoresis figure of four primer P225F PCR identification system specific primers screening.Wherein A
In~T, M:Marker；1-3:P225F resistant mutant strains；4-6: wild sensitive strain.A: primer sets 225-EX-F, 225-
The amplification of EX-R, 225-M-F and 225-S-R.B: primer sets 225-EX-F2,225-EX-R, 225-M-F and 225-S-R2
Amplification.C: the amplification of primer sets 225-EX-F2,225-EX-R, 225-M-F2 and 225-S-R2.D: primer sets
The amplification of 225-EX-F2,225-EX-R, 225-M-F3 and 225-S-R2.E: primer sets 225-EX-F2,225-EX-R,
The amplification of 225-M-F4 and 225-S-R2.F: primer sets 225-EX-F2,225-EX-R, 225-M-F5 and 225-S-R3's
Amplification.G: the amplification of primer sets 225-EX-F2,225-EX-R, 225-M-F and 225-S-R3.H: primer sets 225-
The amplification of EX-F3,225-EX-R, 225-M-F6 and 225-S-R3.I: primer sets 225-EX-F3,225-EX-R, 225-M-
The amplification of F8 and 225-S-R3.The amplification knot of J: primer sets 225-EX-F4,225-EX-R2,225-M-F7 and 225-S-R4
Fruit.K: the amplification of primer sets 225-EX-F2,225-EX-R, 225-M-F9 and 225-S-R3.L: primer sets 225-EX-F2,
The amplification of 225-EX-R, 225-M-F8 and 225-S-R2.M: primer sets 225-EX-F3,225-EX-R, 225-M-F10 with
The amplification of 225-S-R3.N: the amplification of primer sets 225-EX-F3,225-EX-R, 225-M-F9 and 225-S-R3.O:
The amplification of primer sets 225-EX-F2,225-EX-R, 225-M-F8 and 225-S-R3.P: primer sets 225-EX-F4,225-
The amplification of EX-R, 225-M-F9 and 225-S-R3.Q: primer sets 225-EX-F5,225-EX-R, 225-M-F9 and 225-S-
The amplification of R3.R: the amplification of primer sets 225-EX-F2,225-EX-R, 225-M-F11 and 225-S-R3.S: primer
The amplification of group 225-EX-F6,225-EX-R, 225-M-F9 and 225-S-R3.T: primer sets 225-EX-F6,225-EX-R,
The amplification of 225-M-F10 and 225-S-R3.
Fig. 7 is 2% agarose gel electrophoresis figure of four primer H272R PCR identification system specific primers screening.Wherein A
In~C, M:Marker；1-3: wild sensitive strain；4-6:H272R resistant mutant strains.A: primer sets 272-EX-F, 272-
The amplification of EX-R, 272-M-F and 272-S-R.B: primer sets 272-EX-F2,272-EX-R3,272-M-F3 and 272-S-
The amplification of R3.C: the amplification of primer sets 272-EX-F, 272-EX-R2,272-M-F2 and 272-S-R2.
Fig. 8 is 2% agarose gel electrophoresis figure of Tri-primer PCR detection architecture amplification condition comparison.Wherein in A~I, 1,
2:P225F resistant mutant strains；3,4:N230I resistant mutant strains；5,6:H272R resistant mutant strains；7,8:H272Y resistance
Mutant strain；9,10: wild sensitive strain.A~I is all made of primer sets Tri-EX-F, Tri-272-R and Tri-225-R10
Expanded, amplification condition is 95 DEG C of initial denaturation 3min, 95 DEG C of denaturation 20s of 30~34 circulations, 51~57 DEG C of annealing 20s,
72 DEG C of extensions 30s, last 72 DEG C of extensions 5min.A~I uses different annealing temperature (Tm) and recurring number.Wherein A:Tm=51
DEG C, 30 circulations；B:Tm=51 DEG C, 32 circulations；C:Tm=53 DEG C, 30 circulations；D:Tm=53 DEG C, 32 circulations；E:Tm=53 DEG C, 34
Circulation；F:Tm=55 DEG C, 32 circulations；G:Tm=55 DEG C, 34 circulations；H:Tm=57 DEG C, 32 circulations；I:Tm=57 DEG C, 34 circulations.
Fig. 9 is 2% agarose gel electrophoresis figure of four primer P225F PCR identification system amplification conditions comparison.Wherein A~
In I, 1,2:P225F resistant mutant strains；3,4:N230I resistant mutant strains；5,6:H272R resistant mutant strains；7,8:
H272Y resistant mutant strains；9,10: wild sensitive strain.A~I is all made of primer sets 225-EX-F6,225-EX-R, 225-
M-F6 is expanded with 225-S-R3, and amplification condition is 95 DEG C of initial denaturations 3min, 95 DEG C of denaturation 20s, 51 of 30~34 circulations
~57 DEG C of annealing 20s, 72 DEG C of extensions 30s, last 72 DEG C of extensions 5min.A~I is using different annealing temperature (Tm) and circulation
Number.Wherein A:Tm=51 DEG C, 32 circulations；B:Tm=53 DEG C, 32 circulations；C:Tm=55 DEG C, 30 circulations；D:Tm=55 DEG C, 32 follow
Ring；E:Tm=55 DEG C, 34 circulations；F:Tm=57 DEG C, 32 circulations.
Figure 10 is 2% agarose gel electrophoresis figure of four primer H272R PCR identification system amplification conditions comparison.Wherein A
In~F, 1,2:P225F resistant mutant strains；3,4:N230I resistant mutant strains；5,6:H272R resistant mutant strains；7,8:
H272Y resistant mutant strains；9,10: wild sensitive strain.A~F uses primer sets 272-EX-F, 272-EX-R2,272-M-
F2 is expanded with 272-S-R2, and amplification condition is 95 DEG C of initial denaturation 3min, and 95 DEG C of denaturation 20s of 30~34 circulations, 51~
57 DEG C of annealing 20s, 72 DEG C of extensions 30s, last 72 DEG C of extensions 5min.A~F uses different annealing temperature (Tm) and recurring number.
Wherein A:Tm=51 DEG C, 32 circulations；B:Tm=53 DEG C, 32 circulations；C:Tm=55 DEG C, 30 circulations；D:Tm=55 DEG C, 32 circulations；
E:Tm=55 DEG C, 34 circulations；F:Tm=57 DEG C, 32 circulations.
Specific embodiment
It in order to make the object, technical scheme and advantages of the embodiment of the invention clearer, below will be in the embodiment of the present invention
Technical solution be clearly and completely described.The person that is not specified actual conditions in embodiment, according to normal conditions or manufacturer builds
The condition of view carries out.Reagents or instruments used without specified manufacturer is the conventional production that can be obtained by commercially available purchase
Product.
Feature and performance of the invention are described in further detail with reference to embodiments.
Embodiment 1
The acquisition of pathogenic strains, the measurement of resistant phenotype and resistant mutation determination
Botrytis cinerea germ is Shanghai City agricultural in isolated in 2017~2018 years Shanghai City grey mould fruit rot of strawberry disease fruits
Ecological environmental protection research institute of the academy of sciences saves.By spore liquid isolation by dilution method, single-ascospore strain is obtained.The specific steps are make
Hook up that disease fruit is mould to be placed in sterile water with sterile toothpick.Spore liquid concentration is adjusted to every milliliter 10 by blood counting chamber4With
It is interior.50 μ L spore suspension dilutions are taken to be coated on the potato glucose culture of streptomycin sulphate containing 50ppm and ampicillin
On base (PDA) plate.After 24 DEG C of culture 2d, a little end of the monospore bacterium colony grown on PDA plate is chosen using aseptic nipper
Mycelia is inoculated on new PDA culture medium plate.
Use the resistant phenotype of mycelial growth rate method measurement pathogen.Boscalid raw medicine is dissolved in acetone, is made into
The mother liquor of 50000 μ g/mL.According to trial test as a result, again being diluted mother solution gradient with acetone, be made into final concentration be respectively 0.1,
0.2, the drug containing PDA plate of 0.5,1,2 and 5 μ g/mL is measured for sensitive strain；Prepare final concentration be respectively 2,5,20,50 and
The drug containing PDA plate of 110 μ g/mL is measured for resistant strain, to add the PDA plate of equivalent acetone as blank control.?
The colony edge for cultivating 5d at 24 DEG C beats the bacteria cake for taking diameter 5mm, and the drug containing tablet for being inoculated into above-mentioned series of concentrations is central, and 24 DEG C
After dark is inverted culture 3d, colony diameter is measured with crossing method, each bacterial strain, each concentration are repeated 3 times.With Zhang etc.
The sensitivity base-line (1.07 ± 0.11 μ g/mL) of report is used as reference standard, calculates resistance level: resistance level=bacterial strain
EC50/1.07μg/mL.Assessment resistance standard: resistance level < 10 are sensitive (S)；Resistance level >=10 resistances (R).
Resistant strain and sensitive strain are chosen respectively, extract its mycelia DNA.DNA extraction step are as follows: 0.5g is ground
10mL urea extract (7mol/L Urea, 50mmol/L Tris-HCl pH 8.0,62.5mmol/L is added in mycelial samples
NaCl, 1%SDS), it shakes up, 12000r/min is centrifuged 5min, Aspirate supernatant, and supernatant 12000r/min is centrifuged 5min again,
Supernatant is moved into another new pipe, isometric phenol/chloroform/isoamyl alcohol (25:24:1, volume ratio) solution is added, firmly
Oscillation mixes for several times, and 12000r/min is centrifuged 5min；Take supernatant that isometric isopropanol and 1/10 volume are added into a new pipe
3mol/L NaAc (pH 5.2), -20 DEG C of placement 20min, 12000r/min are centrifuged 5min；Supernatant is abandoned, inversion makes tube wall liquid
Body is flow to end, and 70% dehydrated alcohol washes precipitating, is placed at room temperature for dry 5~10min, is dissolved in 200 μ L distilled waters, RNase A is added
(10 μ g/ μ L) 2 μ L, 37 DEG C of water-bath 30min, -20 DEG C save backup.
Succinate dehydrogenase B subunit coding gene is carried out to the germ mycelium genomic DNA that said extracted obtains
(SdhB) PCR amplification of sequence.PCR system is 20 μ L systems, each 0.25 μ of 2 × PCR SuperMix, primer containing 1/2 volume
Mol and DNA profiling 20ng.
Amplimer sequence are as follows:
SdhB-F:5 '-TCGAACCTACTCGCCCTATCCAATT-3 ', SdhB-R:5 '-
GACTTCTTAGAAAGCCATTTCCTTC-3’。
PCR amplification condition are as follows:
95 DEG C of 3min of initial denaturation；95 DEG C of 20s, 55 DEG C of 20s and 72 DEG C of 30s of 32 circulations；Extend 5min at last 72 DEG C.
The PCR product commission Shanghai Sheng Gong bioengineering Co., Ltd sequencing that above-mentioned amplification is obtained, using the website NCBI
The BLAST n tool of (https: //www.ncbi.nlm.nih.gov) carries out sensitive and resistant strain SdhB subunit sequence
It compares, obtains resistant mutation type.
The sequence of wild type succinate dehydrogenase B subunit coding gene (SdhB) is as follows:
Atggctgctctccgcacaggtgcccgcagtgcacgcgcgatattcgccgcatcacgaccagctttcag
aactcagatgcgaaccatggcatcagtcgacagctcagtacctgaaagtcctaccgtttctccatcccgtcctgtc
gaatctgcttccaagacctccactgtcaaggaacctgctgccgactcggagtctttgatcaagacattcaacattt
acagatggaacccagatgagccaaccagcaagccccgcatgcaatcttacactttggatctcaacaagactggacc
tatgatgttggatgcgcttattagaatcaagaatgaggtcgaccctacccttacattcagaagatcttgcagagaa
ggtatctgcggcagttgtgcaatgaacattgatggagtaaacacattggcttgcttgtgtatgttaatcaactatt
caatattaaaacacatttgctgaccatttattctacaggccgcattccaagagacgctaagcacgaaacgaagatc
tacccactaccccacacctatgtcgtcaaggatattgttccagatttgacacaattctacaagcaatacaagtcca
ttaagccatatcttcaacacaccgacccagcaccagaaggaaaagaatacttgcaatctaaggaggatcgtaagaa
gcttgatggactttacgaatgtattctctgcgcatgctgctcgacatcttgcccctcctactggtggaacagtgag
gagtacttgggaccagctatcttgttgcagagttacagatggcttgcagattcccgtgatcagaagaaggaagaac
gtaaggcagctttggataacagcatgagtttgtacagatgtcacactattctcaactgctcgaggacatgtccgaa
gggattgaatcctggtttggcaattgcggagattaagaaggaaatggctttctaa。
Coding gene sequence with P225F mutation is as follows:
Atggctgctctccgcacaggtgcccgcagtgcacgcgcgatattcgccgcatcacgaccagctttcag
aactcagatgcgaaccatggcatcagtcgacagctcagtacctgaaagtcctaccgtttctccatcccgtcctgtc
gaatctgcttccaagacctccactgtcaaggaacctgctgccgactcggagtctttgatcaagacattcaacattt
acagatggaacccagatgagccaaccagcaagccccgcatgcaatcttacactttggatctcaacaagactggacc
tatgatgttggatgcgcttattagaatcaagaatgaggtcgaccctacccttacattcagaagatcttgcagagaa
ggtatctgcggcagttgtgcaatgaacattgatggagtaaacacattggcttgcttgtgtatgttaatcaactatt
caatattaaaacacatttgctgaccatttattctacaggccgcattccaagagacgctaagcacgaaacgaagatc
tacccactaccccacacctatgtcgtcaaggatattgttccagatttgacacaattctacaagcaatacaagtcca
ttaagccatatcttcaacacaccgacccagcaccagaaggaaaagaatacttgcaatctaaggaggatcgtaagaa
gcttgatggactttacgaatgtattctctgcgcatgctgctcgacatcttgcttctcctactggtggaacagtgag
gagtacttgggaccagctatcttgttgcagagttacagatggcttgcagattcccgtgatcagaagaaggaagaac
gtaaggcagctttggataacagcatgagtttgtacagatgtcacactattctcaactgctcgaggacatgtccgaa
gggattgaatcctggtttggcaattgcggagattaagaaggaaatggctttctaa。
Coding gene sequence with N230I mutation is as follows:
Atggctgctctccgcacaggtgcccgcagtgcacgcgcgatattcgccgcatcacgaccagctttcag
aactcagatgcgaaccatggcatcagtcgacagctcagtacctgaaagtcctaccgtttctccatcccgtcctgtc
gaatctgcttccaagacctccactgtcaaggaacctgctgccgactcggagtctttgatcaagacattcaacattt
acagatggaacccagatgagccaaccagcaagccccgcatgcaatcttacactttggatctcaacaagactggacc
tatgatgttggatgcgcttattagaatcaagaatgaggtcgaccctacccttacattcagaagatcttgcagagaa
ggtatctgcggcagttgtgcaatgaacattgatggagtaaacacattggcttgcttgtgtatgttaatcaactatt
caatattaaaacacatttgctgaccatttattctacaggccgcattccaagagacgctaagcacgaaacgaagatc
tacccactaccccacacctatgtcgtcaaggatattgttccagatttgacacaattctacaagcaatacaagtcca
ttaagccatatcttcaacacaccgacccagcaccagaaggaaaagaatacttgcaatctaaggaggatcgtaagaa
gcttgatggactttacgaatgtattctctgcgcatgctgctcgacatcttgcccctcctactggtggatcagtgag
gagtacttgggaccagctatcttgttgcagagttacagatggcttgcagattcccgtgatcagaagaaggaagaac
gtaaggcagctttggataacagcatgagtttgtacagatgtcacactattctcaactgctcgaggacatgtccgaa
gggattgaatcctggtttggcaattgcggagattaagaaggaaatggctttctaa。
With H272R (coding gene sequence of mutation is as follows:
Atggctgctctccgcacaggtgcccgcagtgcacgcgcgatattcgccgcatcacgaccagctttcag
aactcagatgcgaaccatggcatcagtcgacagctcagtacctgaaagtcctaccgtttctccatcccgtcctgtc
gaatctgcttccaagacctccactgtcaaggaacctgctgccgactcggagtctttgatcaagacattcaacattt
acagatggaacccagatgagccaaccagcaagccccgcatgcaatcttacactttggatctcaacaagactggacc
tatgatgttggatgcgcttattagaatcaagaatgaggtcgaccctacccttacattcagaagatcttgcagagaa
ggtatctgcggcagttgtgcaatgaacattgatggagtaaacacattggcttgcttgtgtatgttaatcaactatt
caatattaaaacacatttgctgaccatttattctacaggccgcattccaagagacgctaagcacgaaacgaagatc
tacccactaccccacacctatgtcgtcaaggatattgttccagatttgacacaattctacaagcaatacaagtcca
ttaagccatatcttcaacacaccgacccagcaccagaaggaaaagaatacttgcaatctaaggaggatcgtaagaa
gcttgatggactttacgaatgtattctctgcgcatgctgctcgacatcttgcccctcctactggtggaacagtgag
gagtacttgggaccagctatcttgttgcagagttacagatggcttgcagattcccgtgatcagaagaaggaagaac
gtaaggcagctttggataacagcatgagtttgtacagatgtcgcactattctcaactgctcgaggacatgtccgaa
gggattgaatcctggtttggcaattgcggagattaagaaggaaatggctttctaa。
With H272Y (coding gene sequence of mutation is as follows:
Atggctgctctccgcacaggtgcccgcagtgcacgcgcgatattcgccgcatcacgaccagctttcag
aactcagatgcgaaccatggcatcagtcgacagctcagtacctgaaagtcctaccgtttctccatcccgtcctgtc
gaatctgcttccaagacctccactgtcaaggaacctgctgccgactcggagtctttgatcaagacattcaacattt
acagatggaacccagatgagccaaccagcaagccccgcatgcaatcttacactttggatctcaacaagactggacc
tatgatgttggatgcgcttattagaatcaagaatgaggtcgaccctacccttacattcagaagatcttgcagagaa
ggtatctgcggcagttgtgcaatgaacattgatggagtaaacacattggcttgcttgtgtatgttaatcaactatt
caatattaaaacacatttgctgaccatttattctacaggccgcattccaagagacgctaagcacgaaacgaagatc
tacccactaccccacacctatgtcgtcaaggatattgttccagatttgacacaattctacaagcaatacaagtcca
ttaagccatatcttcaacacaccgacccagcaccagaaggaaaagaatacttgcaatctaaggaggatcgtaagaa
gcttgatggactttacgaatgtattctctgcgcatgctgctcgacatcttgcccctcctactggtggaacagtgag
gagtacttgggaccagctatcttgttgcagagttacagatggcttgcagattcccgtgatcagaagaaggaagaac
gtaaggcagctttggataacagcatgagtttgtacagatgttacactattctcaactgctcgaggacatgtccgaa
gggattgaatcctggtttggcaattgcggagattaagaaggaaatggctttctaa。
It wherein, is base mutation position at underscore.
Embodiment 2
225 (Phe, CCC) of SdhB subunit and 272 sites (His, CAC) are separately positioned on primer 3 ' to hold, are tentatively obtained
Two specific downstream primers wherein being in the 3 ' primer sequences held including 230 sites (Asn, AAC) with 225 sites, and are screened
With a upstream primer similar in downstream primer annealing temperature.To improve primer specificity, draw in the downstream of two Preliminary designs
Different additional mismatch sites is arranged in 225,230 and 272 location proximates in object, is tested.Firstly, under at 272 sites
(Fig. 4) is screened in trip primer (Tri-272-R~Tri-272-R3).When 272 sites, unmutated bacterial strain can amplify 282bp item
Band, and when H272R and H272Y resistant mutant strains cannot amplify band or obviously darker band, it is believed that the primer specificity
Higher (Fig. 4-A).Again on this basis, in upstream primer EX-F and 272 special primer systems, 225 and 230 sites are added
Special downstream primer (Tri-225-R1~Tri-225-R11), is screened (Fig. 5).Only when P225F and N230I resistant mutation
The DNA profiling of bacterial strain amplifies a 282bp band, H272R and H272Y resistant mutant strains amplify a 141bp band,
And wild-type sensitive germ when can amplify 141bp and 282bp band simultaneously, it is believed that the primer group-specific is higher (Fig. 5-K).
The PCR system of primer screening is 20 μ L systems, 2 × PCR SuperMix (full Shi Jinsheng in Beijing containing 1/2 volume
Object), each 0.25 μm of ol and DNA profiling 20ng of primer.PCR program are as follows: 95 DEG C of 3min of initial denaturation；95 DEG C of 20s, 55 of 32 circulations
DEG C 20s and 72 DEG C of 30s；Extend 5min at last 72 DEG C.PCR product carries out 2% agarose gel electrophoresis.
Test primer sequence difference used is as follows:
Tri-EX-F:CTTCAACACACCGACCCAGC (SEQ ID NO.1)；
Tri-272-R:CCTCGAGCAGTTGAGAATAGACTG (SEQ ID NO.2)；
Tri-272-R2:CCTCGAGCAGTTGAGAATAGAGTG；
Tri-272-R3:CCTCGAGCAGTTGAGAATAGGTTG；
Tri-225-R1:CCTCACTGTTCCACCAGTTGCAGG；
Tri-225-R2:CTCACTGTACCACCAGTTGCAGGG；
Tri-225-R3:CTCACTGTACGACCAGTTGCAGGG；
Tri-225-R4:CTCACTGTACGACCAGAACGTGGG；
Tri-225-R5:CTCACTGTGACACCAGGAGGAAGG；
Tri-225-R6:CTCACTTTGAGACCAGTAGCAAGG；
Tri-225-R7:CTCACTTTGACACCTGTAGCAAGG；
Tri-225-R8:CTCACTTTGACACCAGTAGCAAGG；
Tri-225-R9:CTCACTCTTGCACCAGTAGCAAGG；
Tri-225-R10:CTCACTGTTGCACCAGTAGCAAGG (SEQ ID NO.3)；
Tri-225-R11:CTCACTGTTCCACCAGTAGCAAGG.
Embodiment 3
The PCR annealing temperature and recurring number of three-primer system are optimized into test.It is tested according to above-mentioned primer screening, choosing
More excellent primer combination (Tri-EX-F, Tri-272-R and Tri-225-R10) is selected to be tested.According to primer Tm, setting annealing
Test temperature is respectively 51 DEG C, 53 DEG C, 55 DEG C and 57 DEG C, therefrom selects more excellent temperature；And according to band brightness, to recurring number point
It Wei not be tested when 30,32 and 34, therefrom choose optimal amplification condition and establish detection method (Fig. 8).Condition optimizing test knot
Fruit can not amplify correct band (Fig. 8-H, Fig. 8-I) when annealing temperature is 57 DEG C.When annealing temperature is 55 DEG C, 141bp item
Band is relatively fuzzy or shallower, and often has band trailing phenomenon (Fig. 8-F, Fig. 8-G).When annealing temperature is 53 DEG C, stripe size is correct,
Non-specific band is unobvious, and system specificity is higher；Wherein when 32 circulation (Fig. 8-D), specificity is compared with 34 higher (Fig. 8-of circulation
E), when band brightness is compared with 30 circulation brighter (Fig. 8-C).When annealing temperature is 51 DEG C, non-specific band is more apparent, easily influences inspection
It surveys result (Fig. 8-A, Fig. 8-B).Therefore, primer Tri-EX-F, Tri-272-R and Tri-225-R10 is 53 in annealing temperature
DEG C, when PCR cycle number is 32, specificity height is detected, product band is most bright (Fig. 8-D).
Embodiment 4
The foundation of Tri-primer PCR detection architecture
Tri-primer PCR detection architecture primer are as follows: Tri-EX-F, Tri-272-R and Tri-225-R10；Amplification system are as follows: 20
μ L, 2 × PCR SuperMix (the full formula gold biology in Beijing), each 0.25 μm of ol and DNA 20ng of primer containing 1/2 volume.Expand item
95 DEG C of part 3min 1 circulation；95 DEG C of 20sec, 53 DEG C of 20sec, 72 DEG C of 30sec, 32 circulations；72 DEG C of 5min 1 circulations.
Under this Tri-primer PCR system, can successfully detect 4 kinds of resistant mutation types in 3 mutational sites, P225F and
The DNA profiling of N230I resistant mutant strains is only capable of amplifying a 282bp band, H272R and H272Y resistant mutant strains are only
A 141bp band can be amplified, and wild-type sensitive germ can amplify 141bp and 282bp band (Fig. 1, Fig. 8-simultaneously
D)。
Embodiment 5
The design of primers and screening of four primer PCR P225F resistant mutation detection architectures
For four primer PCR methods of P225F (CCC sports TTC) resistant mutation detection, it is based on AS-PCR principle, respectively
By the mutating alkali yl (CC) in 225 sites and unmutated base (TT) be arranged in internal upstream and downstream primer 3 ' end, and screen with it is interior
Outer-portion upstream similar in portion's primer annealing temperature and downstream primer.To improve primer specificity, in the inside of two Preliminary designs
Additional mismatch site is nearby arranged in 3 ' ends in primer, is tested to screen internal specific primer (225-M-F~225-M-
F9；225-S-R~225-S-R 4), and according to the luminance difference of control stripes band and specific band, it is arranged on external primers
Mismatch site is tested (225-EX-F~225-EX-F6) (Fig. 6).Only when P225F bacterial strain (CCC) can amplify 426bp and
330bp, and when wild-type strain (TTC) can amplify 426bp and 142bp band, it is believed that the higher (Fig. 6-of the primer group-specific
S)。
The PCR system of primer screening is 20 μ L systems, 2 × PCR SuperMix (full Shi Jinsheng in Beijing containing 1/2 volume
Object), each 0.25 μm of ol and DNA 20ng of primer.PCR program are as follows: 95 DEG C of 3min of initial denaturation；95 DEG C of 20s of 32 circulations, 55 DEG C
20s and 72 DEG C of 30s；Extend 5min at last 72 DEG C.PCR product carries out 2% agarose gel electrophoresis.
Test primer sequence difference used is as follows:
225-EX-F:CTTCAACACACCGACCCAGC；
225-EX-F2:CTTCAACACACCGAGCGAGC；
225-EX-F3:CTTCAACACACCGTGCGAGC；
225-EX-F4:GCCATATCTTCAACACACCGTGCGAGC；
225-EX-F5:CTTCAACACACCGACGCTGC；
225-EX-F6:CTTCAACACACCGACGCACC (SEQ ID NO.4)；
225-EX-R:ACCGCCCAAAACACCACAAC (SEQ ID NO.5)；
225-EX-R2:GCAATAACCGCCCAAAACACCACAAC；
225-M-F:CATGCTGCTCGACATCTTGCTTC；
225-M-F2:CATGCTGCTCGACATCTCACTTC；
225-M-F3:CATGCTGCTCGACATCTTGGCTT；
225-M-F4:TGCTGCTCGACATCTTTCCTTTC；
225-M-F5:TGCTGCTCGACATCTTGGCTTTC；
225-M-F6:CTGCTCGACATCTTGGCTTTCC；
225-M-F7:GGGGCGGGCGCTCGACATCTTGGCTTTCC；
225-M-F8:CATGCTGCTCGACATCTTACTTC；
225-M-F9:CATGCTGCTCGACATCTAACTTC (SEQ ID NO.6)；
225-M-F10:CATGCTGCTCGACATCGAACTTC；
225-M-F11:CATGCTGCTCGACATCAAGCTTC；
225-S-R:CCTCACTCTTCCACCAGTAGGAGG；
225-S-R2:CCTCACTGTTCCACCAGTAGCAGG；
225-S-R3:CCTCACTGTTCCACCAGTTGCAGG (SEQ ID NO.7)；
225-S-R4:GGGGCGGGGCACTGTTCCACCAGTTGCAGG.
Embodiment 6
The condition optimizing of four primer PCR P225F resistant mutation detection architectures
PCR annealing temperature and recurring number to four primer PCR P225F resistant mutation detection architectures optimize test (figure
9).It is tested according to above-mentioned primer screening, more excellent primer is selected to combine (225-EX-F6,225-EX-R, 225-M-F9 and 225-S-
R3 it) is tested.According to primer Tm, it is respectively 51 DEG C, 53 DEG C, 55 DEG C and 57 DEG C that annealing test temperature, which is arranged, is therefrom selected
Optimal Temperature；And according to band brightness, tested when being respectively 30,32 and 34 to recurring number, therefrom choose optimum combination and
Amplification condition establishes detection method.
When annealing temperature is 57 DEG C, band is darker, can not clearly recognize specific band (Fig. 9-F).Annealing temperature is 55
DEG C when, specificity is high and band is relatively bright；(Fig. 9-C) is bright when wherein (Fig. 9-D) band is compared with 30 circulation when 32 circulation, and 34 follow
(Fig. 9-E) is easier to miscellaneous band occur when ring.Annealing temperature is 53 DEG C and (Fig. 9-A and Fig. 9-B) at 51 DEG C, and having can not amplify greatly
Small correct band.Therefore, primer sets 225-EX-F6,225-EX-R, 225-M-F9,225-S-R3 is 55 DEG C in annealing temperature,
When PCR cycle number is 32, specific highest is detected, product band is most bright (Fig. 9-D).
Embodiment 7
The foundation of four primer PCR P225F resistant mutation detection architectures
Four primer PCR P225F resistant mutation detection architecture primers are as follows: 225-EX-F6,225-EX-R, 225-M-F9,
225-S-R3；Amplification system are as follows: 20 μ L, 2 × PCR SuperMix (the full formula gold biology in Beijing), primer containing 1/2 volume are each
0.25 μm of ol and DNA 20ng.95 DEG C of amplification condition 3min 1 circulation；95 DEG C of 20sec, 55 DEG C of 20sec, 72 DEG C of 30sec, 32
Circulation；72 DEG C of 5min 1 circulations.
Under this four primer PCRs system, ash arrhizus bacteria can amplify the positive control band of 426bp, P225F mutant bacteria
Strain energy specific amplification goes out 330bp band, and the 225 unmutated bacterial strain energy specific amplifications in (and 230) site go out 142bp band.And
225 or 230 other mutation (N230I) bacterial strain in addition to P225F is only capable of amplifying positive control 426bp band, and without it
Its specific band.This system is capable of the generation of specific detection ash arrhizus bacteria P225F resistant mutation as a result,.
Embodiment 8
The design of primers and screening of four primer PCR H272R resistant mutation detection architectures
For four primer PCR methods of H272R (CAC sports CGC) resistant mutation detection, it is based on AS-PCR principle, respectively
By the mutating alkali yl (G) in 225 sites and unmutated base (A) be arranged in internal upstream and downstream primer 3 ' end nearby, and screen and
Outer-portion upstream similar in internal primer annealing temperature and downstream primer.To improve primer specificity, in two Preliminary designs
Additional mismatch site is nearby arranged in 3 ' ends in portion's primer, is tested to screen internal specific primer (272-M-F~272-
M-F4；272-S-R~272-S-R 2), and according to control stripes band (band that 2 external primers amplify) and specific band
Luminance difference, mismatch site is set on external primers, is tested (272-EX-F~272-EX-F 2) (Fig. 7).Only when
H272R can amplify 540bp and 192bp, and when wild-type strain can amplify 540bp and 394bp band, it is believed that the primer sets
Specific higher (Fig. 7-C).
The PCR system of primer screening is 20 μ L systems, 2 × PCR SuperMix (full Shi Jinsheng in Beijing containing 1/2 volume
Object), each 0.25 μm of ol and DNA 20ng of primer.PCR program are as follows: 95 DEG C of 3min of initial denaturation；95 DEG C of 20s of 32 circulations, 55 DEG C
20s and 72 DEG C of 30s；Extend 5min at last 72 DEG C.PCR product carries out 2% agarose gel electrophoresis.
Test primer sequence difference used is as follows:
272-EX-F:AGACGCTAGCACGAAACGA (SEQ ID NO.8)；
272-EX-F2:CATTCCAAGAGACGCTAAGCACGAAACGA；
272-EX-R:TAACCGCCCAAAACACCACA；
272-EX-R2:TAACCGCCCAAAACACGTCA (SEQ ID NO.9)；
272-EX-R3:CGATTCAATAACCGCCCAAAACACGTCA；
272-M-F:AGCATGAGTTTGTACAGATGACGC；
272-M-F2:AGCATGAGTTTGTACAGATCGCGC (SEQ ID NO.10)；
272-M-F3:GGGGCGAGCATGAGTTTGTACAGATCGCGC；
272-S-R:CCTCGAGCAGTTGAGAATAGAGTG；
272-S-R2:CCTCGAGCAGTTGAGAATAGACTG (SEQ ID NO.11)；
272-S-R3:GGGGCGCCTCGAGCAGTTGAGAATAGACTG.
Embodiment 9
The condition optimizing of four primer PCR H272R resistant mutation detection architectures
PCR annealing temperature and recurring number to four primer PCR H272R resistant mutation detection architectures optimize test (figure
10).It is tested according to above-mentioned primer screening, more excellent primer is selected to combine (272-EX-F, 272-EX-R2,272-M-F2,272-S-
R2 it) is tested.According to primer Tm, it is respectively 51 DEG C, 53 DEG C, 55 DEG C and 57 DEG C that annealing test temperature, which is arranged, is therefrom selected
Optimal Temperature；And according to band brightness, tested when being respectively 30,32 and 34 to recurring number, therefrom choose optimum combination and
Amplification condition establishes detection method.
When annealing temperature is 57 DEG C (Figure 10-F), 192bp band is darker, and is easier to non-specific band occur.It moves back
When fiery temperature is 55 DEG C, specificity is preferably and band is bright；Wherein when 34 circulation (Figure 10-E), H272Y mutant strain has brighter
Aobvious 394bp band (the unmutated characteristic bands in 272 sites), and when 30 circulation (Figure 10-C), band is darker, 32 circulation (figures
Amplification 10-D) is most ideal.At 53 DEG C and 51 DEG C (Figure 10-A and Figure 10-B), amplification is incorrect.Therefore, four draw
Object group 272-EX-F, 272-EX-R2,272-M-F2,272-S-R2 is 55 DEG C in annealing temperature, when PCR cycle number is 32, detection
Specific highest, product band are most bright (Figure 10-D).
Embodiment 10
The foundation of four primer PCR H272R resistant mutation detection architectures
The primer of four primer PCR H272R resistant mutation detection architectures are as follows: 272-EX-F, 272-EX-R2,272-M-F2,
272-S-R2；Amplification system are as follows: 20 μ L, 2 × PCR SuperMix (the full formula gold biology in Beijing), primer containing 1/2 volume are each
0.25 μm of ol and DNA 20ng.95 DEG C of amplification condition 3min 1 circulation；95 DEG C of 20sec, 55 DEG C of 20sec, 72 DEG C of 30sec, 32
Circulation；72 DEG C of 5min 1 circulations.
Under this four primer PCRs system, ash arrhizus bacteria can amplify the positive control band of 540bp, H272R mutant bacteria
Strain (CGC) energy specific amplification goes out 192bp band, and the unmutated bacterial strain in 272 sites (CAC) energy specific amplification goes out 394bp band.
H272Y mutant strain (TAC) is only capable of amplifying positive control 540bp band (have sometimes extremely weak 394bp band).As a result,
This system is capable of the generation of specific detection ash arrhizus bacteria H272R resistant mutation.
Above-mentioned experimental result explanation: Tri-primer PCR Resistance detecting system of the invention can effectively distinguish Boscalid resistance
And sensitive ash arrhizus bacteria.Four primer P225F detection architectures or H272R detection architecture are further used, is able to verify that as a result, simultaneously
Further clarify the resistant mutation type of resistant strain.Four primer P225F detection architectures or H272R detection architecture is used alone,
The resistant mutation of (two at mutantional hotspot) can be then effectively detected at 225 (230) or 272 sites respectively.
It should be noted that those skilled in the art have been after having read above-mentioned lectured content of the invention, it can be right
Above-mentioned 3 groups of primer sequences carry out the modification or extension of number of base, carry out PCR amplification, can obtain 3 groups of primer institutes of the invention
The effect of acquirement, these equivalent forms also fall within the scope of the appended claims of the present application those skilled in the art
In technology of the invention.
The foregoing is only a preferred embodiment of the present invention, is not intended to restrict the invention, for the skill of this field
For art personnel, the invention may be variously modified and varied.All within the spirits and principles of the present invention, made any to repair
Change, equivalent replacement, improvement etc., should all be included in the protection scope of the present invention.
SEQUENCE LISTING
<110>Academy of Agricultural Sciences, Shanghai City
<120>primer combination, kit and method of a kind of detection ash arrhizus bacteria to Boscalid resistance
<160> 11
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
cttcaacaca ccgacccagc 20
<210> 2
<211> 24
<212> DNA
<213>artificial sequence
<400> 2
cctcgagcag ttgagaatag actg 24
<210> 3
<211> 24
<212> DNA
<213>artificial sequence
<400> 3
ctcactgttg caccagtagc aagg 24
<210> 4
<211> 20
<212> DNA
<213>artificial sequence
<400> 4
cttcaacaca ccgacgcacc 20
<210> 5
<211> 20
<212> DNA
<213>artificial sequence
<400> 5
accgcccaaa acaccacaac 20
<210> 6
<211> 23
<212> DNA
<213>artificial sequence
<400> 6
catgctgctc gacatctaac ttc 23
<210> 7
<211> 24
<212> DNA
<213>artificial sequence
<400> 7
cctcactgtt ccaccagttg cagg 24
<210> 8
<211> 19
<212> DNA
<213>artificial sequence
<400> 8
agacgctagc acgaaacga 19
<210> 9
<211> 20
<212> DNA
<213>artificial sequence
<400> 9
taaccgccca aaacacgtca 20
<210> 10
<211> 24
<212> DNA
<213>artificial sequence
<400> 10
agcatgagtt tgtacagatc gcgc 24
<210> 11
<211> 24
<212> DNA
<213>artificial sequence
<400> 11
cctcgagcag ttgagaatag actg 24
Claims (10)
1. a kind of detection ash arrhizus bacteria is to the primer sets of Boscalid resistance, which is characterized in that it includes in following primer combination
It is one or more: primer combination 1, primer combination 2 and primer combination 3；
Wherein, primer combination 1 includes: primer shown in SEQ ID NO.1-3；
Primer combination 2 includes: primer shown in SEQ ID NO.4-7；
Primer combination 3 includes: primer shown in SEQ ID NO.8-11；
Preferably, the primer sets include primer combination 1；
Preferably, the primer sets include primer combination 1 and primer combination 2；
Preferably, the primer sets include primer combination 1 and primer combination 3.
2. a kind of detection ash arrhizus bacteria is to the kit of Boscalid resistance, which is characterized in that it includes described in claim 1
Primer sets.
3. a kind of detection ash arrhizus bacteria is to the method for Boscalid resistance, which is characterized in that its include the following steps in it is any
One step:
Step (a): 1 pair of sample to be tested is combined using primer and carries out PCR；
Step (b): 2 pairs of samples to be tested are combined using primer and carry out PCR；
And step (c): 3 pairs of samples to be tested are combined using primer and carry out PCR；
Wherein, primer combination 1 includes: primer shown in SEQ ID NO.1-3；
Primer combination 2 includes: primer shown in SEQ ID NO.4-7；
Primer combination 3 includes: primer shown in SEQ ID NO.8-11；
Preferably, the method includes the steps (a)；
Preferably, the method includes successively carrying out the step of (a) and step (b)；
Preferably, the method includes successively carrying out the step of (a) and step (c).
4. detection ash arrhizus bacteria according to claim 3 is to the method for Boscalid resistance, which is characterized in that in step
(a) in, when carrying out PCR, annealing temperature is set as 52-54 DEG C.
5. detection ash arrhizus bacteria according to claim 4 is to the method for Boscalid resistance, which is characterized in that in step
(a) in, when carrying out PCR, recurring number is set as 30-34 circulation.
6. detection ash arrhizus bacteria according to claim 3 is to the method for Boscalid resistance, which is characterized in that in step
(b) in, when carrying out PCR, annealing temperature is set as 54-56 DEG C.
7. detection ash arrhizus bacteria according to claim 6 is to the method for Boscalid resistance, which is characterized in that in step
(b) in, when carrying out PCR, recurring number is set as 30-34 circulation.
8. detection ash arrhizus bacteria according to claim 3 is to the method for Boscalid resistance, which is characterized in that in step
(c) in, when carrying out PCR, annealing temperature is set as 54-56 DEG C.
9. detection ash arrhizus bacteria according to claim 8 is to the method for Boscalid resistance, which is characterized in that in step
(c) in, when carrying out PCR, recurring number is set as 30-34 circulation.
10. method of the detection ash arrhizus bacteria to Boscalid resistance according to claim 5,7 or 9, which is characterized in that
In step (a), the program using 1 progress PCR of primer combination includes: denaturation: 95 DEG C, 20s, and annealing: 53 DEG C, 20s prolong
It stretches: 72 DEG C, 30s, 32 circulations；
In step (b), the program using 2 progress PCR of primer combination includes: denaturation: 95 DEG C, 20s, and annealing: 55 DEG C, 20s prolong
It stretches: 72 DEG C, 30s, 32 circulations；
In step (c), the program using 3 progress PCR of primer combination includes: denaturation: 95 DEG C, 20s, and annealing: 55 DEG C, 20s prolong
It stretches: 72 DEG C, 30s, 32 circulations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811345216.6A CN109338004B (en) | 2018-11-12 | 2018-11-12 | Primer combination, kit and method for detecting resistance of botrytis cinerea to boscalid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811345216.6A CN109338004B (en) | 2018-11-12 | 2018-11-12 | Primer combination, kit and method for detecting resistance of botrytis cinerea to boscalid |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109338004A true CN109338004A (en) | 2019-02-15 |
| CN109338004B CN109338004B (en) | 2021-06-22 |
Family
ID=65314591
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811345216.6A Active CN109338004B (en) | 2018-11-12 | 2018-11-12 | Primer combination, kit and method for detecting resistance of botrytis cinerea to boscalid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109338004B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115786560A (en) * | 2022-08-12 | 2023-03-14 | 上海市农业科学院 | Primer group, kit and method for detecting B subunit point mutation type of succinate dehydrogenase of botrytis cinerea |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103725776A (en) * | 2013-12-08 | 2014-04-16 | 北京工业大学 | ARMS-based method for detecting botryis cinerea SdhB gene H272Y mutation |
| CN103789409A (en) * | 2013-11-15 | 2014-05-14 | 中国农业大学 | Molecular detection method for identifying insecticide resistance of Botrytis cinerea on zoxamide |
| CN105154432A (en) * | 2015-09-17 | 2015-12-16 | 北京工业大学 | Method for amplifying four genes of Botrytis cinerea and multiplex PCR (polymerase chain reaction) primer set thereof |
| CN106191205A (en) * | 2016-09-14 | 2016-12-07 | 江苏丘陵地区镇江农业科学研究所 | A kind of ash arrhizus bacteria method for quick drug-fast to various medicaments |
| KR20180054000A (en) * | 2016-11-14 | 2018-05-24 | 대한민국(농촌진흥청장) | Selective medium for isolation of Botyrtis cinerea and Use Thereof |
-
2018
- 2018-11-12 CN CN201811345216.6A patent/CN109338004B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103789409A (en) * | 2013-11-15 | 2014-05-14 | 中国农业大学 | Molecular detection method for identifying insecticide resistance of Botrytis cinerea on zoxamide |
| CN103725776A (en) * | 2013-12-08 | 2014-04-16 | 北京工业大学 | ARMS-based method for detecting botryis cinerea SdhB gene H272Y mutation |
| CN105154432A (en) * | 2015-09-17 | 2015-12-16 | 北京工业大学 | Method for amplifying four genes of Botrytis cinerea and multiplex PCR (polymerase chain reaction) primer set thereof |
| CN106191205A (en) * | 2016-09-14 | 2016-12-07 | 江苏丘陵地区镇江农业科学研究所 | A kind of ash arrhizus bacteria method for quick drug-fast to various medicaments |
| KR20180054000A (en) * | 2016-11-14 | 2018-05-24 | 대한민국(농촌진흥청장) | Selective medium for isolation of Botyrtis cinerea and Use Thereof |
Non-Patent Citations (6)
| Title |
|---|
| DOLORES FERNANDEZ-ORTUNO 等: "Resistance to Pyraclostrobin and Boscalid in Botrytis cinerea Isolates from Strawberry Fields in the Carolinas", 《PLANT DIS》 * |
| SOTIRIOS KONSTANTINOU 等: "Population Structure, Fungicide Resistance Profile, and sdhB Mutation Frequency of Botrytis cinerea from Strawberry and Greenhouse-Grown Tomato in Greece", 《PLANT DIS》 * |
| THOMAS VELOUKAS 等: "Detection and Molecular Characterization of Boscalid-Resistant Botrytis cinerea Isolates from Strawberry", 《PLANT DIS》 * |
| 刘欣 等: "上海地区草莓灰霉病菌对啶酰菌胺的敏感性检测及抗性机制分析", 《农药学学报》 * |
| 张晓柯: "灰葡萄孢菌（Botrytis cinerea）对两种呼吸抑制剂烯肟菌胺和氟吡菌酰胺的抗性风险评估", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
| 肖婷 等: "江苏省句容市灰霉病菌对啶酰菌胺的抗药性", 《江苏农业学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115786560A (en) * | 2022-08-12 | 2023-03-14 | 上海市农业科学院 | Primer group, kit and method for detecting B subunit point mutation type of succinate dehydrogenase of botrytis cinerea |
| CN115786560B (en) * | 2022-08-12 | 2024-03-22 | 上海市农业科学院 | Primer group, kit and method for detecting B subunit point mutation type of succinate dehydrogenase of Botrytis cinerea |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109338004B (en) | 2021-06-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Baldi et al. | Xylella fastidiosa: host range and advance in molecular identification techniques | |
| Bent et al. | Root-associated ectomycorrhizal fungi shared by various boreal forest seedlings naturally regenerating after a fire in interior Alaska and correlation of different fungi with host growth responses | |
| Dubey et al. | Molecular diversity analysis of Rhizoctonia solani isolates infecting various pulse crops in different agro-ecological regions of India | |
| Bakker et al. | Isolation of cultivation-resistant oomycetes, first detected as amplicon sequences, from roots of herbicide-terminated winter rye | |
| CN103243093B (en) | Nucleic acid, method for identifying pathotype of fungus strain and kit | |
| CN103789306A (en) | SNP (Single Nucleotide Polymorphism) molecular marker of rice blast resistance gene Pia, and detection method and application of SNP molecular marker | |
| CN108588249B (en) | Primer pair for detecting sweet potato stem rot bacteria and detection method thereof | |
| CN111961749B (en) | KASP primer for detecting tomato yellow leaf curl virus disease-resistant genes Ty-3 and Ty-3a and application thereof | |
| Vassilakos et al. | Genetic determinism and evolutionary reconstruction of a host jump in a plant virus | |
| CN103243092B (en) | Nucleic acid, method for identifying pathotype of fungus strain and kit | |
| Puławska et al. | Identification and characterization of bacteria isolated from crown galls on stone fruits in Poland | |
| CN104593502A (en) | Loop-mediated isothermal amplification primer composition capable of detecting colletotrichum truncatum and application thereof | |
| CN110241245A (en) | Detect KASP primer and its application of cucumber bacterial angular leaf spot gene | |
| Dees et al. | Species' identification and microarray‐based comparative genome analysis of Streptomyces species isolated from potato scab lesions in Norway | |
| CN103255136B (en) | Nucleic acid, and method and kit used for identifying fungal strain pathogenic type | |
| CN109338004A (en) | A kind of detection ash arrhizus bacteria is to the combination of the primer of Boscalid resistance, kit and method | |
| CN102329858B (en) | Sugarcane smut bacteria nest type polymerase chain reaction (PCR) quick detection method | |
| CN102796825B (en) | Specificity polymerase chain reaction (PCR) method for detecting heterodera elachista ohshima | |
| CN111961751A (en) | KASP primer for detecting tomato root-knot nematode resistance gene Mi-1.2 and application thereof | |
| Atkins et al. | Use of real‐time quantitative PCR to investigate root and gall colonisation by co‐inoculated isolates of the nematophagous fungus Pochonia chlamydosporia | |
| WARGHANE et al. | Diversity and characterization of Citrus tristeza virus and Candidatus Liberibacter asiaticus associated with citrus decline in India | |
| CN112176080B (en) | Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma | |
| Hudec et al. | Seasonal Dynamics of Various Scab-Causing Streptomyces Genotypes Among Potato Fields on Prince Edward Island | |
| Bhose et al. | Comparative analysis of 16S/23S intergenic region of Candidatus Liberibacter asiaticus associated with citrus greening disease in different citrus cultivars of Assam | |
| CN103290000A (en) | SCAR marker of biocontrol Hypocrea virens, its application and quantitative detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |