KR20090011741A - Scar marker involving in powderly mildew resistance and selection method in melon thereof - Google Patents

Abstract

A method of breeding resistivity melon species using powdery mildew resistivity linkage SCAR molecular marker useful in melon is provided to introduce Powdery mildew resistance factor of the melon to the melon of which hybridization is performed smoothly and to be usefully used to develop the Powdery mildew resistivity melon plant body. A method of breeding resistivity melon species using powdery mildew resistivity linkage SCAR molecular marker useful in melon comprises steps of: authorizing a segregation population F2 using powdery mildew resistant strain and susceptibility system of the melon; separating gene fragment related to the powdery mildew resistivity; analyzing a base sequence of gene fragments and synthesizing a specific primer in the fraction; and using the powdery mildew resistivity linkage SCAR molecular marker of eight combinations.

Description

SCAR marker involving in powdery mildew resistance and melon varieties using melon and melon varieties {SCAR marker involving in powderly mildew resistance and selection method in melon

1 is resistant strains (PR), Susceptible strain (PS) using BSA (bulked segregant analysis) how to develop a molecular marker associated with the powdery mildew resistance in melon, resistant F ₂ bulk DNA (BR) and Susceptible F ₂ bulk Gel photograph showing the results of PCR on DNA (BS).

FIG. 2 shows the nucleotide sequence of the molecular marker CmPMR1 associated with powdery mildew resistance of the selected melon, and then re-synthesizes a primer specific for the marker to convert the SCAR molecular marker with high reproducibility and reliability. PCR was performed using the DNA of 16 primers contained in the primer, resistant system (PR), pathogenic system (PS), resistant F ₂ bulk DNA, and 16 pathogens included in pathogenic F ₂ bulk DNA. Taq Gel photograph showing the results of treatment of I.

Figure 3 shows the analysis of the nucleotide sequence of the molecular marker CmPMR3 associated with powdery mildew resistance of the selected melon, and then resynthesizing primers specific for the label to convert to SCAR molecular markers for easy analysis, high reproducibility and reliability. gel showing the results of performing PCR using the DNA of the Susceptible 16 object included in the resistance 16 objects and Susceptible F ₂ bulk DNA contained in the primers and resistant strains (PR), Susceptible strain (PS), resistance to F ₂ bulk DNA It is a photograph.

Figure 4 analyzes the nucleotide sequence of the molecular marker CmPMR6 associated with powdery mildew resistance of the selected melon, and then resynthesized primers specific to the label to convert to SCAR molecular markers for easy analysis, high reproducibility and reliability. gel showing the results of performing PCR using the DNA of the Susceptible 16 object included in the resistance 16 objects and Susceptible F ₂ bulk DNA contained in the primers and resistant strains (PR), Susceptible strain (PS), resistance to F ₂ bulk DNA It is a photograph.

FIG. 5 shows the analysis of the nucleotide sequence of the molecular marker CmPMR7 associated with powdery mildew resistance of the selected melon, and then re-synthesizing primers specific to the marker to convert the SCAR molecular marker with high reproducibility and reliability. PCR was performed using the DNA of 16 primers contained in the primer, resistant system (PR), pathogenic system (PS), resistant F ₂ bulk DNA, and 16 pathogens included in pathogenic F ₂ bulk DNA. Taq Gel photograph showing the results of treatment of I.

Figure 6 shows the analysis of the nucleotide sequence of the molecular marker CmPMR8 associated with powdery mildew resistance of the selected melon, and re-synthesized primers specific to the label to convert to SCAR molecular markers for easy analysis, high reproducibility and reliability. gel showing the results of performing PCR using the DNA of the Susceptible 16 object included in the resistance 16 objects and Susceptible F ₂ bulk DNA contained in the primers and resistant strains (PR), Susceptible strain (PS), resistance to F ₂ bulk DNA It is a photograph.

FIG. 7 illustrates the analysis of the nucleotide sequence of the molecular marker CmPMR9 associated with powdery mildew resistance of the selected melon, and then resynthesizing primers specific for the marker to convert the SCAR molecular marker with high reproducibility and reliability. PCR was performed using the DNA of 16 primers contained in the primer, resistant system (PR), pathogenic system (PS), resistant F ₂ bulk DNA, and 16 pathogens included in pathogenic F ₂ bulk DNA. Alu Gel photograph showing the results of treatment of I.

FIG. 8 analyzes the nucleotide sequence of the molecular marker CmPMR10 associated with powdery mildew resistance of the selected melon, and then resynthesizes primers specific for the marker to convert the SCAR molecular marker with high reproducibility and reliability. PCR was performed using the DNA of 16 primers contained in the primer, resistant system (PR), pathogenic system (PS), resistant F ₂ bulk DNA, and 16 pathogens included in pathogenic F ₂ bulk DNA. Rsa Gel photograph showing the results of treatment of I.

FIG. 9 analyzes the nucleotide sequence of the molecular marker CmPMR11 associated with powdery mildew resistance of the selected melon, and then resynthesizes primers specific for the label, and converts them to SCAR molecular markers for easy analysis, high reproducibility and reliability. gel showing the results of performing PCR using the DNA of the Susceptible 16 object included in the resistance 16 objects and Susceptible F ₂ bulk DNA contained in the primers and resistant strains (PR), Susceptible strain (PS), resistance to F ₂ bulk DNA It is a photograph.

FIG. 10 is a diagram showing the results of quantitative QTL mapping using molecular markers associated with powdery mildew resistance of selected melon.

11 is a gel showing the results of PCR in the 'NWPMR' resistant system (Sample No. 1) and the 17 species of melon (Samples No. 2 to 18) of the domestic seed company using the molecular label CmPMR7 closely related to resistance It is a photograph.

Figure 12 shows the restriction enzymes after PCR in 17 major melon varieties (Samples No. 2-18) of the 'NWPMR' resistance system (Sample No. 1) and domestic seed companies using the molecular label CmPMR7 closely related to resistance. Taq Gel photograph showing the results of treatment of I.

13 is a gel showing the results of PCR on the 'NWPMR' resistant system (sample No. 1) and 17 kinds of melon seeds (sample No. 2 to 18) of the domestic seed company using the molecular label CmPMR10 closely related to resistance. It is a photograph.

Figure 14 shows the restriction enzymes after PCR in the 'NWPMR' resistance system (Sample No. 1) and 17 kinds of melon seeds (Samples No. 2 to 18) of the domestic seed company using the molecular label CmPMR10 closely related to resistance. Rsa Gel photograph showing the results of treatment of I.

The present invention relates to a gene fragment associated with powdery mildew resistance of melon and a SCAR molecular label for selecting the powdery mildew resistance of melon or melon by using the nucleotide sequence of the gene fragment. The present invention relates to a SCAR molecular label designed by growing and cultivating the segregated group F ₂ to isolate gene fragments associated with powdery mildew resistance, analyzing the sequencing of the gene fragments, and synthesizing primers specific for the label.

Since it was first introduced to farms in the 1970s, the melon crops have been growing from about 550 ha in 1998 to about 1000 ha. Production is generally 3,570 kg / 10 ha. As people's tastes are diversified and awareness of melon is increasing, more popular consumption is expected in the future.

In melon cultivation, one of the biggest diseases is powdery mildew. The pathogen of melon powdery mildew is Sphaerotheca fuliginea , which overwinters in the form of asymptomatic, and spores are transmitted by wind or insects, making it difficult to control effectively. Cause.

Chemical control method and nature friendly control method are used to control powdery mildew. The chemical control method, which is widely used, that is, using fungicides, is reported to increase the likelihood of new pathogens having low control effects and resistance to drugs. It is becoming. In addition, there is a biological control method using natural microorganisms or live compounds as a natural control method, but it is difficult to find an effective control method at the present time because the efficiency is not high. In this situation, the most effective method for controlling powdery mildew is recognized as fostering resistant varieties, and the need for them is increasing.

Resistant assay methods have to be established to cultivate powdery mildew resistant varieties of melon, but the pathogens that multiply with sedative parasitic bacteria are difficult to develop, and in order to develop them, they must be induced under the natural environment of the field. It takes enormous effort and time to nurture them. However, when growing resistant varieties using molecular labels, there is no restriction on the influence of environmental factors or genetic patterns of the genes involved, so that accurate phenotyping can be selected and seedlings can be selected after flowering period such as powdery mildew. For onset traits, the economic effect is very high.

In addition, in the case of quantitative traits that are influenced by environmental factors and complex gene action, such as melon powder resistance, the development of molecular markers and fostering resistant varieties using them are reported as essential requirements. To cultivate, the development of molecular markers associated with resistance is required.

On the other hand, melons do not have powdery mildew resistance genes, and resistance factors in melon must be introduced by breeding. However, melons and melons are well-bred to introduce powdery mildew resistance genes in melon, but there is no problem in bioassay. As a result, it is difficult to assay for powdery mildew.

Accordingly, the present invention has been made in accordance with the above requirements, and an object of the present invention is to provide a SCAR molecular label associated with the powdery mildew resistance gene of melon, and to use this molecular label to grow a melon variety having resistance to powdery mildew. To provide.

Another object of the present invention is to provide a method for selecting powdery mildew resistant strains in melon and melon strains.

In order to achieve the above object, the present invention relates to a SCAR molecular label for detecting powdery mildew resistance derived from melon.

In addition, the present invention relates to a primer pair having a characteristic base sequence for amplifying the SCAR molecular label.

The present invention also relates to a method for selecting a powdery mildew resistant strain of melon using the SCAR molecular label.

The present invention also relates to a method for cultivating powdery mildew resistant melon varieties using the SCAR molecular label.

The present invention also relates to powdery mildew resistant melon varieties identified as resistant genotypes using the SCAR molecular label.

Hereinafter, the present invention will be described in detail.

In the present invention, the F ₁ obtained by crossing the strain resistant strains of melon and the strain showing strains to foster the F ₂ by self-modification, 16 individuals emerged as completely resistant from the separated group F ₂ , 16 individuals emerged as fully pathogenic After bulk DNA was pooled to make bulk DNA, the molecular markers associated with powdery mildew resistance were searched by using bulk segregant analysis (BSA) technology using DNA fingerprinting.

The present invention has the advantage that molecular markers are useful for identifying genotypes having various resistance genes, and can be selected based on genotypes without environmental interference. Molecular markers can also be useful when screening for pathogenic traits in areas where pathogens are difficult to obtain due to biology or quarantine.

First, F ₁ obtained by crossing the lines resistant to powdery mildew and the lines showing pathogenicity was self-corrected to develop isolated group F ₂ . Powdery mildew resistance was tested in both parental systems and F ₁ and F ₂ populations. After planting the parents and F ₁ and F ₂ plants, powdery mildew was developed in the natural environment of the plastic house packaging. After one month, the disease was divided into five stages. As a result, since the ratio obtained through the onset index is close to the ratio of 1: 2: 1, it can be estimated that the melon powdery mildew resistant trait is controlled by one main gene having an incomplete dominant effect.

Bulk DNA from 16 individuals with complete resistance and 16 with complete pathogenicity in isolated group F ₂ was made into bulk DNA, and then subjected to bulk segregant analysis (BSA) using DNA fingerprinting. The molecular markers associated with powdery mildew resistance were explored. BSA (bulked segregant) using primers prepared from random primers, ISSR primers, and nucleotide sequences specific to NBS (nucleotide binding site) domains commonly present in plant disease resistance genes to select molecular markers associated with powdery mildew resistance In the analysis, the powdered segregant analysis (BSA) method using AFLP (amplified fragment length polymorphism) technique was also searched for the powdery mildew resistance marker. As a result, eight primer combinations were selected which showed differences in the resistant bulk DNA and the pathogenic bulk DNA. Secondary tests were performed on the resistant line, the pathogenic line, the resistant bulk, and the pathogenic bulk to confirm that the primers showed reproducible differences. It was found to be reproducible, and then cloned and named them CmPMR1, CmPMR3, CmPMR6, CmPMR7, CmPMR8, CmPMR9, CmPMR10, CmPMR11, respectively.

Since it is difficult in terms of efficiency and accuracy to directly use molecular markers selected by using a combination of redundant primers, random primers, and AFLP primers prepared from NBS (nucleotide binding site) -domain sequences In order to convert to DNA markers for easy analysis, cloned DNA fragments suspected to be related to resistance were analyzed for sequencing, and the primers specific to the labels were resynthesized to make the analysis easy and reproducible and reliable. SCAR (Sequence Characterized Amplified) Region) was converted to molecular labeling.

The converted SCAR molecular markers were identified from individual F ₂ isolates that were used to make bulk DNA and identified for association with resistance genes, and then applied to the entire F ₂ isolates used for powdery mildew assay. The QTL was analyzed by creating a genetic map using the MapMaker program (V 3.0). As a result, when selecting individuals with genotypes RR of the CmPMR7 and CmPMR10 markers, 95% were able to select resistant individuals and the remaining 5% were moderately resistant individuals.

In addition, as a result of the correlation analysis, the usefulness of the SCAR molecular label of the present invention for the selection of powdery mildew against the major melon 17 varieties and resistance systems of domestic seed companies sold in Korea using the SCAR markers, CmPMR7 and CmPMR10 that are most closely related to resistance It was. As a result, it was confirmed that markers associated with powdery mildew resistance isolated by the present invention can be usefully used in developing varieties having powdery mildew resistance by introducing melon without resistance gene of powdery mildew.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

Example 1 Isolation and Fatigue Assay for Separated Group F ₂ Using Resistant Lineages and Pathogenic Lineages

To self modify the F ₁ obtained by mating the strains showing resistance against powdery mildew pathogens in melons 'NWPMR' and the system looks Susceptible 'NWPMS' were grown for segregating population F _2. Powdery mildew resistance was tested in both parental systems and F ₁ and F ₂ populations. Parents and F ₁ and F ₂ plants were planted, and powdery mildew was developed in the natural environment of the plastic house packaging. After one month, the disease was divided into five stages (Table 1).

[Table 1] Development of powdery mildew in Melon F ₂ isolated group under natural outbreak conditions

Incidence Index (D.I) NWPMR NWPMS F ₁ F ₂ One 2 0 0 3 2 8 0 0 72 3 0 0 6 60 4 0 2 4 55 5 0 8 0 72 Total 10 10 10 262

In other words, the incidence was divided into five stages of disease index (DI) in resistant, pathogenic, and F ₁ and F ₂ isolates, with D.I1 representing no symptoms and D.I5 powdery mildew. The values of D.I2 ~ D.I4, in which spores completely cover more than 75% of leaves, were marked differently in the order of many individuals in those with less spore generation on the leaf surface.

Seen that some disease symptoms appear in the F ₁ powdery mildew resistance gene in melon, as shown in Table 1 may appear to act as incomplete dominance. In the F ₂ separation group, the plants represented by D.I1 and D.I2 are judged to be resistant, the individuals represented by D.I3 and D.I4 are incompletely resistant, and the individuals represented by D.I5 are considered pathogenic. The ratio of resistant and pathogenic individuals appears in the ratio of 75: 126: 76, which is close to the ratio of 1: 2: 1 (Χ ² = 2.43). Melon powdery-resistant traits are caused by a single main gene with an incomplete dominant effect. It can be presumed to be dominant.

Example 2 Development of Relevant Molecular Labels Using BSA Technology

16 groups of complete resistance from stage 1 to stage 2 and stage 2 from stage 2 of stage ₂ of the disease index were pooled in the separation group F ₂ , and then subjected to DNA fingerprinting. The molecular markers associated with powdery mildew resistance were explored using bulked segregant analysis (BSA) techniques.

To isolate the entire gene, 400 µl of nail-sized sample, tungsten bead, DNA extraction buffer (0.5M NaCl, 0.5% SDS, 50mM EDTA, 0.1M Tris-Cl) in a 1.5ml microtube 4 μl of 2-mercaptoethanol and grind finely using a Qiagen grinding machine, and incubate at 65 ° C. for 1 hour while shaking the sample every 10 minutes. (incubation). After removing the tungsten beads from the tube using a magnet, 130 μl of 5 M potassium acetate (KOAc) was added thereto, mixed lightly, and left at 4 ° C. for 10 minutes. After centrifugation at 13,000 rpm for 10 minutes, 100 μl of the supernatant was transferred to a new microtube, and 100 μl of isopropanol was added thereto and mixed. It was left at room temperature for 10 minutes and centrifuged for 2 minutes at 13,000 rpm. After leaving only the precipitate and discarded all the supernatant, 1ml of 70% ethanol (ethanol) was added and shaken well, ethanol was removed and the precipitate was dried. The isolated DNA was dissolved in 200 μl of tertiary distilled water containing ribonuclease (RNase), and then used as a template DNA in a polymerase chain reaction (PCR).

10-mer random primer 520 combination purchased from Operon Technology for screening powdery mildew associated markers, 100 combination of 10-mer random primer purchased from University of British Columbia (UBC, Canada), inter-simple sequence repeat amplication) BSA-RAPD using a combination of 100 primers and 56 primers prepared from nucleotide sequences specific to nucleotide binding site (NBS) domains that are typically present in plant pathogenic genes. The experiment was performed by a bulky segregant analysis-randomly amplified polymorphic DNA sequence. Meanwhile, for the analysis of AFLP, experiments were performed using the combination of Eco R I and Xba I prime 1008.

Polymerase chain reaction conditions for RAPD analysis included 5 μl of template DNA (approximately 30 ng), primers 10 pmole, 0.25 mM dNTP, 1 × PCR buffer, and 0.5 U Taq DNA polymerase (Takara Ex Taq) in a total 25 μl reaction solution. . The reaction solution was reacted 35 times at 94 ° C. for 30 seconds, at 37 ° C. for 30 seconds, and at 72 ° C. for 1 minute and 30 seconds using an Eppendorf PCR machine. After the reaction, the amplified product was subjected to 1.2% agarose gel. The reaction product was confirmed by electrophoresis on (agarose gel).

For reactions using primer combinations specific to ISSR primers and NBS-domains, all conditions are the same as for RAPD assay, but only the temperature conditions of the polymerase chain reaction (PCR) are modified to be 30 seconds at 94 ° C and 30 at 50 ° C. The reaction was carried out 35 times in 2 minutes at 72 ° C.

Experimental methods for the AFLP analysis, first, after cutting the genomic DNA with Eco RⅠ and Xba Ⅰ cally, Eco RⅠ and Xba Ⅰ adapter attachment (ligation) to (adaptor), unique primers for the adapter (adaptor) as follows: (selective primer) using the Eco RI-N and Xba I-N as a preamplification, diluted and subjected to PCR with Eco RI-NNNN and Xba I-NNNN primer combination to 2% agarose gel ( Agarose gel) was used for electrophoresis to detect the association markers.

As a result, we selected 8 primer combinations that showed differences in resistant bulk DNA and pathogenic bulk DNA. Secondly, we confirmed secondary primers in resistant strains, pathogenic strains, resistant bulk, and pathogenic bulk to determine whether these primers showed reproducible differences. It was confirmed to be reproducible (FIG. 1). Then, PCR bands showing differences were cloned and named as CmPMR1, CmPMR3, CmPMR6, CmPMR7, CmPMR8, CmPMR9, CmPMR10, and CmPMR11, respectively. The base sequence of the primer used in the PCR reaction of Figure 1 is as follows.

[Table 2] Primer sequencing used to search for association label by BSA method

Markers Forward primer (5 '→ 3') Reverse primer (5 '→ 3') Tm CmPMR1  UBC846: CACACACACACACACAGT (SEQ ID NO: 1)  L08: GNNTNGGNAARACNACTCT (SEQ ID NO: 2) 48 ℃ CmPMR3  UBC846: CACACACACACACACAGT (SEQ ID NO: 3)  L16: GNNTNGGNAARACNACCCT (SEQ ID NO: 4) 48 ℃ CmPMR6  GL27: CCAGANGGNGANCGNGACAG (SEQ ID NO: 5)  MS39: AGTGTGTGTGTGTGTG (SEQ ID NO: 6) 48 ℃ CmPMR7  L18: GNNATNGGNAARTAYTAYATN (SEQ ID NO: 7)  MS85: VDVCTCTCTCTCTCTCT (SEQ ID NO: 8) 48 ℃ CmPMR8  x04: GACTGCGTACCAATTCATG (SEQ ID NO: 9)  e26: TGAGTCCTGAGCTAGATCT (SEQ ID NO: 10) 56 ℃ CmPMR9  x05: GACTGCGTACCAATTCACA (SEQ ID NO: 11)  e20: TGAGTCCTGAGCTAGATAG (SEQ ID NO: 12) 56 ℃ CmPMR10  x07: GACTGCGTACCAATTCACC (SEQ ID NO: 13)  e02: TGAGTCCTGAGCTAGAAAT (SEQ ID NO: 14) 56 ℃ CmPMR11  x18: GACTGCGTACCAATTCTCT (SEQ ID NO: 15)  e23: TGAGTCCTGAGCTAGATTC (SEQ ID NO: 16) 56 ℃

Example 3 Conversion to SCAR Labeling of DNA Fragments Presumed to be Associated with Resistance

Since it is difficult to use molecular markers selected using random primers as selection markers for breeding breeding, analysis to specifically amplify specific regions of the selected bands to improve the instability is difficult. We tried to convert it into a simple DNA molecule label. In other words, by cloning DNA fragments presumed to be related to powdery mildew resistance, the nucleotide sequence was analyzed, and then the primers specific for the label were resynthesized to convert to a SCAR (sequence characterized amplified region) label for easy analysis and high reproducibility. Was intended.

Eight DNA fragments estimated to be relatively closely related to the resistance gene were recovered from the agarose gel, attached to the pGEM-T vector (Promega), and transformed into E. coli host cells (DH5α). The transformed E. coli was incubated for 12 hours in a medium containing 50 μg / mL of ampicillin, X-gal, and IPTG, respectively, and transformants were selected to isolate plasmid DNA. The separated plasmids were digested with Eco RI and subjected to electrophoresis on 1.4% agarose gel to obtain recombinant clones cloned with DNA fragments of the expected size, and these were commissioned by Macrogen to analyze the sequence. Based on the nucleotide sequences analyzed in this way, primers with SCAR labels based on nucleotide sequences corresponding to both ends were synthesized.

The restriction enzymes used to express the primer sequences and polymorphisms of the newly synthesized SCAR label to distinguish resistance and pathogenicity by comparing the nucleotide sequences of the resistance-associated markers in powdery mildew and pathogenic strains are as follows.

[Table 3] Primer sequencing of newly prepared powdery mildew-resistant SCAR label

Marker Forward primer (5 '→ 3') Reverse primer (5 '→ 3') Tm Restriction enzymes CmPMR1 CCTTACACGTGCAGAAAATGTC (SEQ ID NO: 17) TACTTTGGTCTTTTGCCTCGAT (SEQ ID NO: 18) 55 ℃ Taq I CmPMR3 AGCCGAYCCCTAAATGTAGTTGT (SEQ ID NO: 19) ACCATCTCATCAAATGCTCCATA (SEQ ID NO: 20) 55 ℃ - CmPMR6 GACAGATGAAGGAAGCCAGAAT (SEQ ID NO: 21) TGGCTTCTGTCTGTACTCTCAA (SEQ ID NO: 22) 55 ℃ - CmPMR7 GGTAACGCCCACGAAAACT (SEQ ID NO: 23) CCAAAGTCGACCGTCTTGAT (SEQ ID NO.24) 54 ℃ Taq I CmPMR8 CAGTTGCTAATTGCTGCCTC (SEQ ID NO: 25) GAGGATAGGCATATTGGCTTCG (SEQ ID NO.26) 55 ℃ - CmPMR9 GCTTGATTTATCTAAGTTGAACAGG (SEQ ID NO: 27) TCGAGAGGCAGTGAAGCATTTC (SEQ ID NO: 28) 55 ℃ Alu I CmPMR10 GTAGTTGAGTGAAGCAAAGATACG (SEQ ID NO: 29) AGTTAAGCAAATGAGATTGTTTGATA (SEQ ID NO: 30) 55 ℃ Rsa I CmPMR11 CAAATTTTTGCATCATACTTCTATG (SEQ ID NO: 31) ATTCTGCAACTTGTAGAAAATTTC (SEQ ID NO: 32) 55 ℃ -

In order to test the usefulness of SCAR markers for the selection of powdery mildew-resistant individuals, the use of the markers was analyzed by using the newly prepared primers in the resistant, pathogenic, and isolated groups F ₂ .

PCR reaction conditions for assaying the converted SCAR label were 5 μl of template DNA (about 30 ng), 25 pm each of primer, 10 pmole of primer, 0.25 mM dNTP, 1 × PCR buffer, 0.5 U Taq DNA polymerase (Prime Taq). polymerase, Genet Bio). The reaction solution was reacted 35 times at 94 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 30 seconds using an Eppendorf PCR machine. After the reaction, the amplified product was electrophoresed on a 2% agarose gel or In order to show polymorphism, the reaction product was identified by treating restriction enzymes (FIGS. 2 to 9).

Example 4 Correlation with Resistance Genes of Converted SCAR Labels

SCAR markers presumed to be associated with resistance genes were tested in the entire F ₂ isolate that tested for powdery mildew to see how these molecular markers were actually associated with resistance genes. Using the eight SCAR marker that is estimated to be associated with the powdery mildew resistance to powdery mildew were separated by a black onset degree group F ₂ recorded for the analyzed object 262 associated with the map and QTL analysis (Table 4 to Table 11, FIG. 10). As a result, the closest marker associated with the resistance gene was CmPMR7. Using these SCAR markers to calculate the accuracy of determining the level of resistance, the mean onset index (DI) of 64 F ₂ 64 genes with RR genotype of CmPMR7 SCAR marker was 2.01 and F ₂ 126 with genotype Rr. the average onset of object index (DI) is 3.34, it showed a 4.96 average outbreak index (DI) of the object 72 F ₂ genotype rr. When the genotype of the marker was selected as RR, 95% were able to select resistant individuals and the remaining 5% were moderately resistant individuals.

TABLE 4 Molecular label CmPMR1 assay results for 262 individuals in isolated group F ₂

        Genotype onset index RR Rr rr Total One 3 0 0 3 2 51 19 One 71 3 5 53 2 60 4 4 47 4 55 5 0 9 63 72 Total 63 128 70 261

TABLE 5 Molecular label CmPMR3 assay results for 262 individuals in isolated group F ₂

        Genotype onset index RR Rr rr Total One 3 0 0 3 2 51 20 0 71 3 6 53 2 61 4 4 47 4 55 5 0 11 61 72 Total 64 131 67 262

TABLE 6 Molecular label CmPMR6 assay results for 262 individuals in isolated group F ₂

        Genotype onset index RR Rr rr Total One 2 One 0 3 2 53 18 0 71 3 4 52 4 60 4 2 50 3 55 5 2 7 63 72 Total 63 128 70 261

Table 7 Molecular label CmPMR7 assay results for 262 individuals in isolated group F ₂

        Genotype onset index RR Rr rr Total One 3 0 0 3 2 58 14 0 72 3 2 57 One 60 4 One 53 One 55 5 0 2 70 72 Total 64 126 72 262

TABLE 8 Molecular label CmPMR8 assay results for 262 individuals in isolated group F ₂

        Genotype onset index RR Rr rr Total One 3 0 0 3 2 56 16 0 72 3 2 57 One 60 4 0 54 One 55 5 0 6 66 72 Total 61 133 68 262

TABLE 9 Molecular label CmPMR9 assay results for 262 individuals in isolated group F ₂

        Genotype onset index RR Rr rr Total One 3 0 0 3 2 52 19 One 72 3 3 55 2 60 4 4 49 2 55 5 0 8 64 72 Total 62 131 69 262

TABLE 10 Molecular label CmPMR10 assay results for 262 individuals in isolated group F ₂

        Genotype onset index RR Rr rr Total One 3 0 0 3 2 56 16 0 72 3 2 57 One 60 4 0 54 One 55 5 0 6 66 72 Total 61 133 68 262

Table 11 F ₂ segregating population for molecular marker objects 262 CmPMR11 test results

        Genotype onset index RR Rr or rr Total One 3 0 3 2 55 17 72 3 2 58 60 4 0 55 55 5 0 72 72 Total 60 202 262

Example 5 Correlation with Resistance Genes of Converted SCAR Labels

In order to evaluate the availability and usefulness of the selection of the SCAR markers obtained in Examples 3 and 4, after inoculating powdery mildew against the 17 varieties of melon and the resistance system 'NWPMR' of domestic seed companies sold in Korea Assays were obtained with the SCAR labels obtained in Examples 3 and 4. All 17 kinds of melon varieties showed pathogenicity against powdery mildew, and the results of analysis using the 8 SCAR markers specified in Example 4 using these varieties were shown in Table 12 and FIGS. 11 to 14.

Table 12 Results of powdery mildew and SCAR marker test of major melon varieties in Korea

kind Powdery mildew Cm PMR1 Cm PMR3 Cm PMR6 Cm PMR7 Cm PMR8 Cm PMR9 Cm PMR10 Cm PMR11 1. NWPMR Resistance R R R R R R R R 2. Gold Wrap Byung Sung Lee R R R S R R S S 3. Super Gold Byung Sung Lee R R R S R R S S 4. Gold Nod Byung Sung Lee R R R S R R S S 5. Golden Byung Sung Lee R R R S R R S S 6. Genuine Plus Byung Sung Lee R R R S R R S S 7. King Jackpot Byung Sung Lee R R R S R R S S 8. Hwang Jin-yi Byung Sung Lee R R R S R R S S 9. Super Royal Jelly Byung Sung Lee R R R S R R S S 10. Yellow Honey Byung Sung Lee R R R S R R S S 11. Yellow Honey Byung Sung Lee R R R S R R S S 12. Pure Gold Byung Sung Lee R R R S R R S S 13. Diamond Byung Sung Lee R R R S R R S S 14. Geumdoling Byung Sung Lee R R R S R R S S 15. Crispy Honey Byung Sung Lee R R R S R R S S 16. Mandara Byung Sung Lee R R R S R R S S 17. Gaya Honey Byung Sung Lee R R R S R R S S 18. Brass Byung Sung Lee R R R S R R S S

After PCR using molecular marker CmPMR7 primer and resistance system and 17 kinds of melon DNA, which are most closely associated with powdery mildew resistance of melon (Fig. 11), restriction enzyme Taq When treated with I, all melon varieties were found to show a different band pattern than the melon powdery mildew resistant strain (Fig. 12). In addition, after PCR using the molecular marker CmPMR10 primer and resistance system and 17 kinds of melon DNA, which are closely related to powdery mildew resistance of melon (Fig. 13), restriction enzyme Rsa When treated with I, all melon varieties were found to show a different band pattern than the melon powdery mildew resistant strain (Fig. 14).

As described above, the present invention isolates a gene fragment associated with powdery mildew resistance of melon, and developed a SCAR marker for detecting powdery mildew resistance. The SCAR molecular label for detecting powdery mildew resistance of the present invention is useful for effectively selecting resistant varieties of melon or melon strains, and can be usefully used to develop new varieties by separating resistant varieties. In addition, it was evaluated to be useful for the development of powdery mildew resistant melon plants by introducing melon powdery mildew resistant factor in well-bred melons.

<110> NONG WOO BIO CO., LTD <120> SCAR marker involving in powderly mildew resistance and selection          method in melon <160> 32 <170> KopatentIn 1.71 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 cacacacaca cacacagt 18 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 gnntnggnaa racnactct 19 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 cacacacaca cacacagt 18 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gnntnggnaa racnaccct 19 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ccaganggng ancgngacag 20 <210> 6 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 agtgtgtgtg tgtgtg 16 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 gnnatnggna artaytayat n 21 <210> 8 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 vdvctctctc tctctct 17 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 gactgcgtac caattcatg 19 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 tgagtcctga gctagatct 19 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 gactgcgtac caattcaca 19 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 tgagtcctga gctagatag 19 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 gactgcgtac caattcacc 19 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 tgagtcctga gctagaaat 19 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 gactgcgtac caattctct 19 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 tgagtcctga gctagattc 19 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 ccttacacgt gcagaaaatg tc 22 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 tactttggtc ttttgcctcg at 22 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 agccgayccc taaatgtagt tgt 23 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 accatctcat caaatgctcc ata 23 <210> 21 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 gacagatgaa ggaagccaga at 22 <210> 22 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 tggcttctgt ctgtactctc aa 22 <210> 23 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 ggtaacgccc acgaaaact 19 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 ccaaagtcga ccgtcttgat 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 cagttgctaa ttgctgcctc 20 <210> 26 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 gaggataggc atattggctt cg 22 <210> 27 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 gcttgattta tctaagttga acagg 25 <210> 28 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 tcgagaggca gtgaagcatt tc 22 <210> 29 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 gtagttgagt gaagcaaaga tacg 24 <210> 30 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 agttaagcaa atgagattgt ttgata 26 <210> 31 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 caaatttttg catcatactt ctatg 25 <210> 32 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 attctgcaac ttgtagaaaa tttc 24  

Claims (13)

SCAR molecular label associated with powdery mildew resistance of melon and melon, characterized by consisting of 16 primers having the nucleotide sequences of SEQ ID NOs: 1-16. Selected from SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, SEQ ID NO: 7 and 8, SEQ ID NO: 9 and 10, SEQ ID NO: 11 and 12, SEQ ID NO: 13 and 14, SEQ ID NO: 15 and 16 SCAR molecular label for powdery mildew resistance detection of melon and melon, characterized in that consisting of one or more primer combinations. A primer pair having the nucleotide sequences of SEQ ID NO: 17 and SEQ ID NO: 18 used to amplify the SCAR molecular label for detecting powdery mildew resistance of melon and melon of claim 2. Amplification primer pair having a nucleotide sequence of SEQ ID NO: 19 and SEQ ID NO: 20 used to amplify the SCAR molecular label for detecting powdery mildew resistance of melon and melon of claim 2. Amplification primer pair having a nucleotide sequence of SEQ ID NO: 21 and SEQ ID NO: 22 used to amplify the SCAR molecular label for detecting powdery mildew resistance of melon and melon of claim 2. Amplification primer pair having a nucleotide sequence of SEQ ID NO: 23 and SEQ ID NO: 24 used to amplify the SCAR molecular label for detecting powdery mildew resistance of melon and melon of claim 2. Amplification primer pair having a nucleotide sequence of SEQ ID NO: 25 and SEQ ID NO: 26 used to amplify the SCAR molecular label for detecting powdery mildew resistance of melon and melon of claim 2. Amplification primer pair having a nucleotide sequence of SEQ ID NO: 27 and SEQ ID NO: 28 used to amplify the SCAR molecular marker for detecting powdery mildew resistance of melon and melon of claim 2. Amplification primer pair having a nucleotide sequence of SEQ ID NO: 29 and SEQ ID NO: 30 used to amplify the SCAR molecular marker for detecting powdery mildew resistance of melon and melon of claim 2. Amplification primer pair having a nucleotide sequence of SEQ ID NO: 31 and SEQ ID NO: 32 used to amplify the SCAR molecular label for detecting powdery mildew resistance of melon and melon of claim 2. A method of selecting a powdery mildew resistant strain of melon or melons using the SCAR molecular label for detecting powdery mildew resistance of claim 2. Method for growing powdery mildew resistant melon or melon varieties using the SCAR molecular label for powdery mildew resistance detection of claim 2. A powdery mildew resistant melon variety identified as a resistant genotype by the SCAR molecular label for resistance detection according to any one of claims 5 to 9.

Images