KR20120045917A - Specific primers for rapid detection of bakanae disease pathogen(fusarium fujikuroi) and method for detection using the same - Google Patents

Abstract

PURPOSE: A specific primer for detecting Fusarium fujikuroi and a detection method using the same are provided to enable species-specific detection. CONSTITUTION: A specific primer for detecting Fusarium fujikuroi is denoted by sequence number 1 or 2. A method for detecting Fusarium fujikuroi using the specific primer comprises: a step of isolating genome DNA from Oriza sativa seeds; a step of performing PCR using the genome DNA as a template and forward and reverse primers; and a step of detecting PCR product.

Description

Specific Primers For Rapid Detection Of Bakanae Disease Pathogen (Fusarium fujikuroi) And Method For Detection Using The Same}

The present invention relates to a specific primer capable of quickly and accurately detecting species specific to Fusarium fujikuroi , and a bacterium detection method using the same.

Seed transmission is one of the ways of spreading plant diseases. Seeds infected with pathogens not only act as infectious agents in the field, but also cause new outbreaks in disease-free areas, declining commodity value, and severe to humans or animals due to the secretion of pathogens. It can also cause illness.

Dwarf leg disease is a representative seed infectious disease caused by Fusarium fujikuroi Nirenberg. It was first discovered in Japan in 1828, and was named Bakanae disease because of its abnormally growing symptom. Dwarf leg disease has not been a problem since the development of effective seed disinfectants since the late 1990s, but recently, the incidence of this disease is increasing due to various factors such as temperature rise and environmentally-friendly cultivation. Has been questioned. In general, in order to control fumigation leg disease, it is necessary to use healthy seeds in addition to disinfection of seeds, and it is very difficult to investigate the infection of key leg disease before use. Therefore, accurate and rapid diagnosis of seeds before sowing is very important for the control and management of the disease.

Representative methods for investigating the detection rate of various pathogens in seeds are the blotter method (wet method), Fusarium bacteria selection medium is also used. However, there are some difficulties in investigating the detection rate of kidney disease by this method. First, bacteriological expertise is needed to distinguish other Fusarium bacteria that are morphologically similar to the kidney disease. Secondly, you should be familiar with how to use it because you need to investigate using a microscope. Third, it takes at least 7 days to seed and culture the seed. Fourth, the accuracy depends on the morphological characteristics of the bacteria.

With recent advances in molecular biology techniques, we attempted to diagnose the infection of D. coli bacteria by identifying species at the DNA level. In general, the most widely used method for identifying species at the genetic level is DNA fingerprinting. This method is further divided into restriction fragment fragment polymorphism (RFLP) analysis, analysis using differences in ribosome-constituting nucleic acid sequences, and PCR (polymerase chain reaction) analysis using specific primers. Here, the PCR method is annealing the genomic DNA to analyze a specific DNA fragment (primer) consisting of 10 ~ 20mer, add DNA polymerase and repeat the synthesis reaction When amplified, the region to which the primer is bound is rapidly amplified, and the PCR amplification product is electrophoresed on an agarose gel or an acrylamide gel, and ethidium bromide and silver dye ( It is a diagnostic method that detects DNA polymorphism of species such as the presence or absence of DNA bands or differences in form after DNA staining with silver stain).

Therefore, in order to solve the conventional problems, there is a need for a rapid and accurate diagnosis of dystrophy, thus developing a specific primer capable of detecting species-specific pathogens and a method for detecting bacteria in rice seeds using the same. do.

The present invention is to solve the above problems, an object of the present invention is to solve the conventional problems and can detect species-specific strains showing the symptoms of Kidari disease in rice without reacting with strains without pathogenicity The present invention provides a primer for rapid detection of dysfunctional bacteria, and a method for detecting dysfunctional bacteria using the same.

In order to achieve the above object, the present invention uses a primer represented by SEQ ID NO: 1 or primer represented by SEQ ID NO: 2 for the rapid detection of Fusarium fujikuroi for diagnosing the infection of D. Provide specific primers.

In addition, the present invention using a forward primer represented by SEQ ID NO: 1 and a reverse primer represented by SEQ ID NO: 2 as a set of rapid detection of D. coli bacteria to detect D. coli bacteria in rice seeds Provide a primer for.

In addition, the present invention provides a method for detecting bacteria using a specific primer for rapid detection of D. coli bacteria to species-specifically detecting the D. pylori bacteria in rice by using the primer for rapid detection of D. coli bacteria. More specifically, as a method of detecting rice limb disease in rice,

(S1) extracting genomic DNA from rice seeds;

(S2) amplifying a target sequence by using the genomic DNA as a template and performing PCR using SEQ ID NO: 1 as a forward primer and SEQ ID NO: 2 as a reverse primer;

(S3) provides a method for detecting a bacterium foot disease comprising a; detecting the amplified product.

The primer for rapid detection of the bacteriophage bacterium according to the present invention is designed not to react with the strain without pathogenicity, and is similar to the bacteriophage bacterium so that it does not react with other Fusarium species that are difficult to distinguish microscopically. Germs can be detected species-specific. In addition, the bacterium detection method using the primer for rapid detection of the bacteriophage bacterium according to the present invention solves the problem of microscopic observation by the blotter method and the selection medium used to investigate the detection of the pathogen in rice seeds. More convenient and accurate diagnosis is possible, and the time required for diagnosing the pathogen infection in rice seeds is significantly reduced.

Figure 1 shows a gibberellic acid (GA) biosynthetic gene cluster (S. Malonek et al., 2005) selected as a diagnostic gene of the present invention.
Figure 2 shows the results of PCR analysis of 18 sets of primers for the detection of D. coli bacteria designed in Table 2 using eight Fusarium bacteria isolated from rice seeds as a template. Here, M represents a 100 bp DNA molecular weight marker, 1 to 5 are pathogenic strains, and 6 to 8 are non-pathogenic strains.
Figure 3 shows the results of PCR diagnostics of F. fujikuroi using SEQ ID NO: 1 (BFsp F) and SEQ ID NO: 2 (BFsp R) primers. Here, as a template, respectively, 1: F. annulatum , 2-5: F. fujikuroi, 6-7: F. nygamai, 8-11: F. proliferatum , 12: F. sacchari , 13: F. subglutinans , 14: F thapsinum, 15-16: F. verticillioides , 17: F. concolor , 18-19: F. globosum, 20: F. nisikadoi, 21-22: F. asiaticum. The genome DNA was used.
Figure 4 is a PCR analysis result according to the annealing temperature of the Dakki foot bacteria specific primer of the present invention. (A): Domestic strain, (B): US ARS collection center was used for the strain.
Figure 5 shows a schematic diagram of the bacteria detection method in the rice seeds using the rice cake bacteria specific primer of the present invention.

The present invention provides a specific primer for rapid detection of Fusarium fujikuroi , which diagnoses infection of D. coli by using a primer represented by SEQ ID NO: 1 or a primer represented by SEQ ID NO: 2. More preferably, using a forward primer represented by SEQ ID NO: 1 and a reverse primer represented by SEQ ID NO: 2 as a set, rapid detection of D. dystrophy bacteria for detecting Kidari disease in rice seeds It relates to a specific primer for.

The specific primer for rapid detection of D. coli bacteria can be diagnosed by infection of D. coli bacteria by species-specific detection of Fusarium fujikuroi in rice.

Dye bacterium is known to produce gibberellic acid (GA) and exhibits a symptom. Species that are highly taxonomically related to the bacterium are known to contain all or part of a gibberellic biosynthetic gene cluster. Among them, only the bacteriophage bacteria express the gibberellin biosynthesis gene and form gibberellin. Therefore, the specific primer developed for the rapid detection of Fusarium fujikuroi of the present invention is designed to analyze the nucleotide sequence of the gibberellin biosynthetic gene cluster to design the primer and to check whether it matches the pathogenicity assay results. It was designed to detect strains showing symptoms and not to react with non-pathogenic strains. It was also designed to not react with 11 Fusarium species that are closely related or morphologically related to D. aureus.

As used herein, the term “primer” refers to a single strand, ie oligonucleotide sequence, complementary to a particular gene sequence, and may serve as a starting point for the synthesis of primer extension products. The length and sequence of the primer should allow to start the synthesis of the extension product, and the specific length and sequence of the primer will depend on the primer utilization conditions such as temperature and ionic strength as well as the complexity of the required DNA or RNA target. Can be.

In addition, the present invention provides a bacterium detection method using a specific primer for rapid detection of D. coli bacteria, which uses a specific primer for rapid detection of D. coli bacteria of the present invention.

As a bacterium detection method using a specific primer for rapid detection of bacteria

(S1) extracting genomic DNA from rice seeds;

(S2) amplifying a target sequence by using the genomic DNA as a template and performing PCR using SEQ ID NO: 1 as a forward primer and SEQ ID NO: 2 as a reverse primer;

(S3) detecting the amplified product.

The method of extracting genomic DNA from the rice of step (S1) may use a conventional method known in the art, for example, seed of rice at a temperature of 25 to 30 ℃ in PDB (potato dextrose broth) medium After culturing for 1 to 3 days, grinding, it is preferable to extract DNA using an extraction buffer.

Reagents for performing PCR in the step (S2) may include dNTPs, DNA polymerase, buffer and the like. In the step (S2), the annealing temperature of the PCR reaction conditions using the primer of the present invention can be diagnosed in a wide range of temperature, but is preferably 50 to 62 ℃, more preferably 54 to 58 ℃, It is most preferable that it is 58 degreeC.

In addition, the detection of the amplification product may be performed by one or more methods selected from capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement and phosphorescence measurement, but is not limited thereto. Method of Detecting Amplification Products As one of the cautions, capillary electrophoresis can be performed. Capillary electrophoresis can use, for example, an ABi sequencer. In addition, gel electrophoresis may be performed, and gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product.

Hereinafter, the present invention will be described in more detail with reference to Examples.

However, the following examples are provided to illustrate the present invention, and the present invention is not limited to the following examples and may be variously modified and changed.

Example 1 Dwarf Leg Bacteria ( Fusarium fujikuroi ) Design of the primer for detection

a. Selection of Target Genes for Detection of Dung Bacteria

Dye bacterium is known to produce gibberellic acid (GA) and exhibits a symptom, and species that are highly taxonomically related to D. aeruginosa are known to contain all or part of GA biosynthetic gene clusters. Among them, only D. aureus expresses the GA biosynthetic gene and forms GA. Therefore, in this experiment, GA biosynthetic gene cluster (cluster) was selected as a gene for diagnosis (Fig. 1).

b. Baked Leg Bacteria ( Fusarium fujikuroi ) Design of the primer for detection

Primer for detecting D. coli was designed to detect strains showing stinging on the rice by designing genes related to gibberellin production. Therefore, as shown in Table 1 below, the primer sequences for detecting the bacterium were designed to have 9 forward primers and 13 reverse primers at the gibberellin biosynthetic gene cluster site.

primer Sequence (5'-3 ') Length
(bp) Tm value
(℃) Forward GfIGS F1 TCGGCAGAGAGAACTCACTT 20 57.3 GfSMT F1 TCGGTTCATTCTTGGTAGGA 20 55.3 Ffsp F1 TCGGCAGAGAGAACTCACTT 20 68.0 Gfcpsintron3 F AGAATAGTTAGCGAGTGCT 19 52.4 Gfcpsexon4 F ACTGTCGTTCCAGAGCTTCG 20 59.4 GfDesIGS F TGCTTCGGTCACTGATGATG 20 59.7 GfP4504IGS F TCGGCAGAGAGAACTCACTTA 21 57.9 Ffsp F TGGGCTATGAGTTTGCTCAGT 21 59.9 BFsp F TGAGACTTGTGTCTGAGAGCT 21 55.2 Reverse GfIGS R1 GCGGAACGTCTGAAATGCCT 20 59.4 GfIGS R2 GATAGACAAGAGAGGATAGT 20 53.2 GfSMT R1 CGTTCCTCATCGTCATCATC 20 57.0 Ffsp R2 ACTGTGATAACATCATAACT 20 54.0 Ffsp R3 GCGGAACGTCTGAAATGCCT 20 75.0 Ffsp R1 GATAGACAAGAGAGGATAGT 20 54.0 Gfcpsexon 2R CGCGGCTTGTCAACTATAC 19 56.7 Gfcpsexon 4R AGGACAACAGTCGCTTCTCC 20 59.4 GfDes R AGACTCCGGATGAGGTTCTC 20 59.4 GfDesIGS R TTGTTCCAGGTGCTGACTTG 20 57.3 GfP4504IGS R GTCCTAGTCAATTGCCGTGTC 21 59.8 Ffsp R TAACTCCTGCGGTTCATTCA 20 59.3 BFsp R GATAACATCATAACTCCTGCG 21 54.9

c. PCR amplification product of the designed primer

Using the primers designed in Table 1, 13 primer sets were prepared as shown in Table 2, and the sizes of the PCR amplification products for this are shown in Table 2.

Set number primer prediction
Amplification Product (bp) Forward Reverse (A) GfIGS F1 GfIGS R1 400 (B) GfIGS F1 GfIGS R2 413 (C) GfSMT F1 GfSMT R1 450 (D) Ffsp F1 Ffsp R2 537 (E) Ffsp F1 Ffsp R3 318 (F) Ffsp F1 Ffsp R1 255 (G) Gfcpsintron3 F Gfcpsexon2 R 430 (H) Gfcpsexon4 F Gfcpsexon 4R 440 (I) GfDesIGS F GfDes R 472 (J) GfDesIGS F GfDesIGS R 160 (K) GfP4504IGS F GfP4504IGS R 640 (L) Ffsp F Ffsp R 446 (M) BFsp F BFsp R 547

Example 2 Selection of Primer for Detection of Streptococcus Bacteria

a. Primary selection using strains with confirmed pathogenicity

In order to examine the PCR amplification characteristics of the 13 primer sets designed as shown in Table 2, eight Fusarium bacteria isolated from rice were first tested in 2006. As a result of the pathogenicity assay of the eight strains, five strains were identified as pathogenic strains showing typical symptoms, and three strains were identified as non-pathogenic strains. Genomic DNA (genomic DNA) was extracted from these strains and polymerase chain reaction (PCR) was performed. Looking at the results of Figure 2 shows that using the BFsp F / BFsp R primer ((M) set) is consistent with the results of the pathogenic assay, this primer was first selected as a primer for detecting the bacteriophage bacteria (Fig. 2).

b. Secondary Selection Using Standard Strains

For the second confirmation of the first selected BFsp F / BFsp R primer set was used strains sold in the US ARS collection center. Table 3 below shows the Fusarium strain name and host used for the identification of the primer for the detection of D. coli bacteria. Genomic DNAs of 12 Fusarium bacteria isolated from rice grains including rice were extracted and PCR assayed using the selected primers (BFsp F / BFsp R primer set). The results are shown in Fig. As a result, bands appeared only in lanes 2, 3, 4, and 5, and it was confirmed that the selected BFsp F / BFsp R primers were not amplified by other bacteria except F. fujikuroi .

number Species Host number Species Host One Fusarium annulatum rice plant 12 Fusarium sacchari Sorghum 2 Fusarium fujikuroi rice plant 13 Fusarium subglutinans corn 3 Fusarium fujikuroi rice plant 14 Fusarium thapsinum Sorghum 4 Fusarium fujikuroi rice plant 15 Fusarium verticillioides rice plant 5 Fusarium fujikuroi rice plant 16 Fusarium verticillioides corn 6 Fusarium nygamai rice plant 17 Fusarium concolor Pulse 7 Fusarium nygamai Sorghum 18 Fusarium globosum wheat 8 Fusarium proliferatum corn 19 Fusarium globosum corn 9 Fusarium proliferatum Sorghum 20 Fusarium nisikadoi wheat 10 Fusarium proliferatum corn 21 Fusarium asiaticum barley 11 Fusarium proliferatum wheat 22 Fusarium asiaticum wheat

Example 3 Establishment of PCR Conditions for Selected Primers

In order to optimize the PCR reaction conditions of the primers selected in the present invention, the PCR reaction according to the annealing temperature of the selected primers BFsp F / BFsp R was investigated. At this time, the template used domestic strain (pathogenic strain CF283 collected from Sangju-si, Gyeongsangbuk-do) and US ARS collection center distribution strain ( Fusarium fujikuroi NRRL21010), respectively, the PCR analysis results are described in FIG. As shown in FIG. 4, the BFsp F / BFsp R primer set was found to be diagnosed over a wide temperature range, and the optimum annealing temperature was about 54-58 ° C.

Example 4 Establishment of a Bacterial Detection Method in Rice Seeds Using Selected Primers

The selected primers were applied to establish a method for investigating the infection of D. coli in rice seeds. One seed was incubated for 2 days in 50 μl of PDB (potato dextrose broth) medium (Potato Starch 4g, Dextrose 20g), finely ground and extracted with 200 mM Tris-HCl (pH8.0), 300 mM NaCl, 25 mM EDTA (200 mM). pH 8.0), 1% Sodium dodecylsulfate) to extract the DNA. PCR amplification using BFsp F (5'-TGAGACTTGTGTCTGAGAGCT-3 ') and BFsp R (5'-GATAACATCATAACTCCTGCG-3') as a selection primer resulted in an 81.3% detection rate in the artificially inoculated diseased seeds. In the healthy seed used as a control, the bacterial detection rate was 2.1% (FIG. 5).

Through the above process and finally using the BFsp F / BFsp R as a set primer to complete the specific primer for detecting the bacteriophage bacteria of the present invention and the bacteria detection method using the same. The properties of the selected primer sets of the present invention are shown in Table 4.

SEQ ID NO: division primer Base sequence (5′-3 ′) Length prediction
product Optimal response
Temperature One Forward BFspF TGAGACTTGTGTCTGAGAGCT 21 547 bp 58 ℃ 2 Reverse BFspR GATAACATCATAACTCCTGCG 21

Therefore, PCR can be performed using the specific primer for detecting the bacteriophage bacterium to quickly and accurately detect whether the rice seed is infected with the rice seed bacillus.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Specific Primers For Rapid Detection Of Bakanae Disease          Pathogen (Fusarium fujikuroi) And Method For Detection Using The          Same <160> 2 <170> KopatentIn 1.71 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Specific Primers For Rapid Detection Of Bakanae Disease          Pathogen (Fusarium fujikuroi)-bfspf <400> 1 tgagacttgt gtctgagagc t 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Specific Primer For Rapid Detection Of Bakanae Disease          Pathogen (Fusarium fujikuroi)-bfspr <400> 2 gataacatca taactcctgc g 21

Claims (8)

Specific primer for detecting Fusarium fujikuroi represented by SEQ ID NO: 1. Specific primer for detecting Fusarium fujikuroi represented by SEQ ID NO: 2. A specific primer for rapid detection of D. coli bacteria, characterized by detecting D. zygote bacteria in rice seeds using a forward primer represented by SEQ ID NO: 1 and a reverse primer represented by SEQ ID NO: 2 as a set Combination. A bacterium detection method using the specific primer for detecting the bacteriophage bacterium according to claim 1 to 3. (S1) extracting genomic DNA from rice seeds;
(S2) amplifying a target sequence by using the genomic DNA as a template and performing PCR using SEQ ID NO: 1 as a forward primer and SEQ ID NO: 2 as a reverse primer;
(S3) microorganism detection method using a specific primer for rapid detection of the bacteriophage bacteria, characterized in that it comprises a; detecting the amplified product. The method according to claim 5, wherein the step (S1) is to incubate the seed of rice in PDB (potato dextrose broth) medium at 25 to 30 ℃ temperature for 1 to 3 days, after grinding, to extract DNA using an extraction buffer Bacterial detection method using specific primers for rapid detection of dystrophy. The method of claim 5, wherein the annealing (annealing) temperature of the PCR reaction conditions in the step (S2) is a bacteria detection method using a specific primer for rapid detection of D. coli bacteria, characterized in that 50 to 62 ℃. The method of claim 5, wherein the detection of the amplification product is performed by at least one method selected from capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement and phosphorescence measurement.

Images