KR101608402B1 - Diagnosis Marker Composition and Kit for Fusarium Head Blight caused by Fusarium graminearum species complex - Google Patents

Abstract

The present invention relates to an oligonucleotide marker composition and kit of an optimized test gene which can determine the infection of pathogens and the progression of diseases in the early stage, when fusarium head blight of rice and wheat, that is caused by pathogens of Fusarium graminearum species complex such as Fusarium graminearum, Fusarium asiaticum, and Fusarium boothii, is occurred. The present invention also relates to a marker composition and a kit which includes the same and is for detecting the above-described pathogens effectively. The marker composition contains oligonucleotide complementary to the normalized test gene that is used for qRT-PCR from RNA samples extracted under various plant growth conditions. According to the present invention, Fusarium graminearum, Fusarium asiaticum, and Fusarium boothii, which may cause fusarium head blight in grains, can be effectively detected from RNA samples of infected plants of host grains by using a quantitative reverse transcription polymerase chain reaction; a specific gene in a disease-developing stage which can be applied to qRT-PCR is found out; and the infection of pathogenic fungi and probability for disease progression can be more rapidly detected using a primer complementary to the specific gene.

Description

FIELD OF THE INVENTION [0001] The present invention relates to a marker composition and a kit for diagnosing a red fungus disease caused by a fusarium graminarum species complex,

The present invention relates to a marker composition for diagnosing the infection of Fusarium Head Blight (FHB), which occurs in cereals such as wheat, barley, rice and the like, and is a marker composition for diagnosing the infection of Fusarium glamenarum species The optimal assay gene for detecting the Fusarium graminearum species complex belonging species ( F. graminearum , F. asiaticum , F. boothii ) A diagnostic marker composition for effectively detecting an oligonucleotide complementary to a fusarium guminaloma variety complex hybridization test gene used in qRT-PCR under various conditions and a bacterium containing the oligonucleotide complementary thereto, .

The fungus belonging to the mushroom fungus, Fusarium glaminaeum, is one of the major plant pathogens. Fusarium head blight and ear rot disease in rice as well as barley, wheat, and wheat Cause. This fungus is a vast species complex, consisting of at least 16 phylogenetically distinct species (or lineage), distributed worldwide and phylogenetically.

These pathogens produce trichothecenes and zearalenone, the mycotoxins in infected plants, which not only promote disease development, but also cause mycotoxicoses (skin toxins, digestion, And bleeding within the circulatory system, diarrhea, vomiting, neurological disorders, refusal to feed, etc.). Due to this economic and industrial importance, the genome of the complex of red fungi was detoxified by several researchers. Through the comparative analysis of these genomes and transcripts, gene function studies on various major traits including disease development were actively carried out have.

Particularly, a fusarium Graminium room PH-1 strain ( Fusarium sp. graminearum PH-1), Fusarium asiaticum SCKO4 strain ( Fusarium asiaticum SCKO4), Fusarium bushii GWS2-6-3 strain ( Fusarium ( GWS2-6-3) were detoxified and pathogenesis, mycelia (H), sexual development (cd, kd), conidiation (C) , Toxin (T), and the like, by analyzing transcripts extracted from various transcription conditions and comparing them with each other. In addition, detailed analysis of gene expression by quantitative real-time PCR (qRT-PCR) and functional analysis of genes using methods such as targeted gene deletion, gene overexpression, and GFP tagging have.

The present invention has been proposed in order to solve the above-mentioned problems. The present invention provides a method for screening and expressing a Fusarium graminacea complex strain gene which is specifically expressed in the initial stage of infection with red mold spider blight in host plants through qRT-PCR analysis The present invention provides a molecular marker composition and a kit containing the same, which can be useful for diagnosis of red mold spider blight disease through analysis.

In order to accomplish the above object, the present invention provides a marker composition for diagnosing a red fungus disease caused by a fusarium glimenoirum species complex comprising a sequence of any one of SEQ ID NOS: 1 to 14 or an oligonucleotide complementary thereto have.

In addition, the oligonucleotide is characterized by using a quantitative reverse transcription polymerase chain reaction to assay for a complex of pseudomonas sp.
The marker composition for the diagnosis of a red fungus disease is to detect whether it is an early development of a red mold disease, and comprises an oligonucleotide represented by any one of sequences selected from the group consisting of SEQ ID NOS: 3, 4, 5, 6, 11 and 12 Or more.
The oligonucleotide may be used as a primer in a quantitative RT-PCR, and may be used to test whether the host plant is in an early stage of infection with a fungal disease caused by a fusarium guminaloma variety complex.
The oligonucleotide represented by any one of SEQ ID NOs: 11 and 12 may be one that detects the initial stage of infection of Fusarium graminearum PH-1 ( Fusarium graminearum PH-1).
The marker composition for diagnosing a fungal disease may further comprise at least one oligonucleotide selected from the group consisting of SEQ ID NOS: 1, 2, 9, 10, 13 and 14.

In addition, the oligonucleotide is characterized by being 17 to 24 nucleotides in length.

The present invention also provides a kit for diagnosing a red fungus disease caused by a complex of pseudomonas aeruginosa including the marker composition for diagnosing red fungus disease.
The kit for diagnosing red fungus disease can detect whether or not red fungus disease occurs in the early stage.

By using the oligonucleotide of the present invention, it is possible to effectively detect a strain belonging to the fusarium guminalum species complex, which is an infectious pathogen in host plants (rice and wheat), at the early stage of development of red mold spider blight, And plant disease progression can be predicted quickly early on.

The present invention relates to a marker composition and a kit for diagnosing the infection of Fusarium Head Blight (FHB). The present invention relates to a marker composition and kit for diagnosing infection of Fusarium Head Blight (FHB) And to a diagnostic marker composition and a kit for effectively detecting the oligonucleotide and the bacteria containing the oligonucleotide. Hereinafter, the present invention will be described in detail with reference to examples.

[ Example  1: Type of bacteria and growth conditions]

The F. graminearum PH-1 strain used in this study (registered under NRRL 31084 in the US Department of Agriculture's ARS Strain Storage Center (http://nrrl.ncaur.usda.gov/cgi-bin/usda/process.html) Sequence analysis of the genome as a US-derived strain has already been completed (http://www.broadinstitute.org/annotatin/genome/fusariumgraminearum/Multihome.html). F. asiaticum SCK04 strain (strain accession number KACC NO: 46428) and F. boothii GWS2-6-3 (KACC NO: 46432) strain are native Korean red fungus species complex strains, and the present inventors have completed the nucleotide sequence analysis of the genome , And the strain is deposited with the National Institute of Agricultural Science and Technology, Rural Development Administration. All strains used in this study were stored frozen in 15% glycerol at -70 ° C.

The present inventors performed transcript analysis in five different culture conditions. For mycelial growth, cultivated in PDB (potato dextrose broth), a nutrient rich condition, for 6 days. For the induction of ovarian reproduction, the carrot culture was incubated for 7 days, then aerial mycelium was removed and cultured for additional 7 days to induce the formation of protoplasm. In order to accelerate the production of mycotoxins of trichothecenes (trichothecenes), they were cultured in a dark medium containing argmatine (Ag) for 7 days. For the generation of conidia, the cells were cultured in PDB liquid medium for 4 days and then cultured for 3 days in YEM (yeast malt agar) medium. In order to obtain a transcript for the pathogenesis stage in the host plants, flowers were inoculated or sprayed with mycelia or spores on rice seeds or rice plants and cultured in a greenhouse after wet treatment at 25 ° C for 3 days. The RNA extraction time at each growth condition is as follows. 3, 6 days after inoculation with PDB (H) medium; 4, 6 days after inoculation with carrot medium, 2, 4 days after induction of intracapsular formation in carrot medium (aerial mycelium removal); 3 and 6 days after inoculation with Ag medium; 3, 6 days in YEM medium; 3, 12, 28 days after plant pathogen inoculation.

[ Example  2: nucleic acid extraction and assay gene selection]

Fungal mycelia or perithecia, infected plants were collected on each selected date. The total RNA of the sample was extracted using a total RNA extraction kit (iNtRON Biotechnolgy, Korea) according to the manufacturer's protocol. All RNA samples were analyzed by agarose gel electrophoresis and quantified using a Nano Drop (Thermo Scientific NanoDrop Lite Spectrophotometer). The first strand of cDNA was synthesized from the whole using ReverTraAcc qPCR RT Kit (TOYOBO, Japan).

Seven species were selected from the transcript transcripts and analyzed by using the primer selection program (lasergene7) from the nucleotide sequence of the selected genes. The primers were Neoprobe, Daejeon, Korea) (Table 1). The name of the gene was the locus ID registered in the Fusarium genome database (http://www.broadinstitute.org/annotatin/genome/fusarium graminearum / Multihome.html).

number Amplified target gene primer The sequence (5'-3 ') of the primer Size of PCR amplification product
(bp) Annealing temperature
(° C) SEQ ID NO: 1 FGSG_00096 q96F2 TTACGTCAACGGAAAACCAATCA 186 57.0 SEQ ID NO: 2 q96R2 TCATCTGCCACATCGAAAAAGTC 58.8 SEQ ID NO: 3 FGSG_02059 q2059F2 CAAGGACGCCGGATACCAATACAT 164 62.7 SEQ ID NO: 4 q2059R2 TCACCGTAGAGACCAAACTTCAG 60.6 SEQ ID NO: 5 FGSG_03624 q3624F2 CAGCCTCCTTCCGGTCTTCTTGA 195 64.2 SEQ ID NO: 6 q3624R2 GAGCAGCACCGGGGTTCCATCC 67.7 SEQ ID NO: 7 FGSG_04699 q4699F CTTGGGGGAGGGTCACAGGAT 224 63.7 SEQ ID NO: 8 q4699R CACAGTTTGCGTTTTGCCGTTCAG 62.7 SEQ ID NO: 9 FGSG_11037 q11037F2 TCACTTACAGCGGTGACTACGAGC 182 64.4 SEQ ID NO: 10 q11037R2 AGTTGAAGTTGGTGACGGGGTTGG 64.4 SEQ ID NO: 11 FGSG_12085 q12085F2 TCCCGCTAGCGCTACAGACCA 148 63.7 SEQ ID NO: 12 q12085R2 GTTGCTCATAAGCGCTCATTTCAT 59.3 SEQ ID NO: 13 FGSG_13189 q13189F TGGCGCATGAAGGAAAGAGTT 177 57.8 SEQ ID NO: 14 q13189R TCGACATGCGCAGCTGAGGGAT 63.9

[ Example  3: Quantitative real time PCR  And candidate gene expression analysis]

qRT-PCR was performed with a real-time PCR system (Bio-Rad CFX96 system, USA) using SYBR Green Super Mix (Bio-Rad, USA). Gene expression was measured in two separate samples in each condition (biological repetition) and three separate reactions (mechanical repetition).

gene Estimation of gene function PCR efficiency SEQ ID NO: FGSG_00096 beta-galactosidase 1.09 SEQ ID NO: 15 FGSG_02059 alpha-galactosidase 1.06 SEQ ID NO: 16 FGSG_03624 endo-1,4-beta-xylanase 1.03 SEQ ID NO: 17 FGSG_04699 a hypothetical protein 0.93 - FGSG_11037 murein transglycosylase 0.97 SEQ ID NO: 18 FGSG_12085 a hypothetical protein 1.01 SEQ ID NO: 19 FGSG_13189 glycoside hydrolase 1.01 -

[ Example  4: Experimental Results Infection Diagnosis Marker  Expression Analysis of Candidate Gene]

The qRT-PCR primers generated amplicons of 140-230 bp (Table 1). Since the PCR efficiency of the primers ranged from 0.9 to 1.1, the amplification of all genes was confirmed to be specific (Table 2) (9). The relative expression level of each gene was determined by comparing the H3 condition of the PH-1 strain to 1.0 (Table 3). In addition, a single peak was observed in real time melting curve analysis of all genes (data not shown). As a result, the primer combination of all the genes except the FGSG_04699 gene specifically amplified the transcript of the corresponding gene in the early stages of host plant development of the PH-1, SCK04, and GWS2-6-3 strains.

In particular, the expression of FGSG_02059 and FGSG_03624 was relatively increased at the early stage of the disease and decreased at the late stage of the disease. However, in the remaining conditions, mycelial growth stage, oily growth stage, silent spore generation stage, and toxin production stage, it was expressed to a very slight level. On the other hand, FGSG_12805 showed a specific expression pattern only in PH-1, a Fusarium graminearum strain, in the host plants. This can be estimated as a gene specifically expressed in the pathogenesis stage only in the PH-1 strain. FGSG_13189 was specifically expressed in early stages of plant infection, but gene expression was minimal compared to other candidate genes (Table 3).

FGSG_00096 FGSG_02059 FGSG_03624 PH-1 SCK04 GWS263 PH-1 SCK04 GWS263 PH-1 SCK04 GWS263 Wheat3 80.6 116.0 178.9 165.5 80.8 118.5 1266.1 510.9 646.1 Rice12 112.3 184.8 972.4 Rice28 18.2 22.4 210.6 T3 2.3 5.3 0.9 0.8 0.4 0.6 0.6 3.2 0.6 T6 0.1 3.9 0.4 0.4 0.6 1.7 0.1 1.1 0.6 C3 3.7 5.7 2.3 1.0 1.5 2.1 1.0 3.2 2.3 C6 4.7 5.3 0.2 2.1 2.0 1.9 0.6 3.1 0.6 H3 1.0 3.4 2.8 1.0 0.2 2.2 1.0 0.4 0.2 H6 16.2 20.3 0.0 6.0 7.2 0.7 3.1 9.2 0.1 cd4 33.2 52.2 16.3 2.6 16.2 0.9 2.5 21.2 1.5 cd6 7.8 43.3 2.0 1.1 3.4 1.1 2.9 4.8 1.9 kd2 6.4 3.8 1.5 2.0 0.9 1.7 2.4 1.0 0.5 kd4 2.8 20.5 1.7 2.7 0.7 2.4 1.3 0.7 0.5 FGSG_04699 FGSG_11037 FGSG_12085 PH-1 SCK04 GWS263 PH-1 SCK04 GWS263 PH-1 SCK04 GWS263 Wheat3 0.9 0.0 0.0 201.0 166.9 130.0 16.4 0.0 1.2 Rice12 0.2 38.9 7.8 Rice28 0.0 106.3 5.0 T3 0.1 0.6 0.3 4.2 13.6 7.5 0.2 0.4 0.1 T6 0.0 0.0 0.1 2.1 14.0 11.5 0.1 0.0 0.3 C3 0.1 0.1 0.2 3.4 46.7 11.7 0.1 1.6 1.0 C6 1.1 0.1 0.0 5.3 5.1 5.2 0.1 0.4 0.6 H3 1.0 0.1 0.0 12.8 38.8 23.3 1.0 0.1 0.2 H6 0.8 0.0 0.0 1.8 19.4 9.5 2.9 2.5 0.0 cd4 0.3 0.1 0.3 1.5 7.8 1.6 0.3 0.0 0.5 cd6 0.6 0.1 1.1 1.3 2.3 9.9 0.5 0.0 0.5 kd2 0.3 0.1 0.2 2.0 0.4 0.6 0.2 0.0 0.2 kd4 0.2 0.1 0.3 1.8 1.0 0.9 0.2 0.0 0.5 FGSG_13189 PH-1 SCK04 GWS263 Wheat3 5.9 6.3 8.0 Rice12 0.0 Rice28 0.2 T3 0.0 0.2 0.1 T6 0.0 2.0 0.2 C3 0.0 0.7 0.1 C6 0.2 0.1 0.1 H3 1.0 0.2 0.1 H6 0.3 1.0 0.1 cd4 0.3 6.2 0.2 cd6 0.5 0.8 0.6 kd2 0.4 0.1 0.1 kd4 0.2 0.0 0.2

The embodiments presented above are illustrative and those skilled in the art will be able to make various modifications and alterations to the disclosed embodiments without departing from the technical spirit of the present invention. The scope of the present invention is not limited by these variations and modifications.

<110> Soonchunhyang University Industry Academy Cooperation Foundation <120> Diagnosis Markers and Kit for Fusarium Head Blight caused by          Fusarium graminearum species complex <130> P-2014-003 <160> 19 <170> Kopatentin 2.0 <210> 1 <211> 23 <212> DNA <213> Fusarium graminearum <220> <221> prim_transcript <222> (1) (23) <223> q96F2 <400> 1 ttacgtcaac ggaaaaccaa tca 23 <210> 2 <211> 23 <212> DNA <213> Fusarium graminearum <220> <221> prim_transcript <222> (1) (23) <223> q96R2 <400> 2 tcatctgcca catcgaaaaa gtc 23 <210> 3 <211> 24 <212> DNA <213> Fusarium graminearum <220> <221> prim_transcript <222> (1) <223> q2059F2 <400> 3 caaggacgcc ggataccaat acat 24 <210> 4 <211> 23 <212> DNA <213> Fusarium graminearum <220> <221> prim_transcript <222> (1) (23) <223> q2059R2 <400> 4 tcaccgtaga gaccaaactt cag 23 <210> 5 <211> 23 <212> DNA <213> Fusarium graminearum <220> <221> prim_transcript <222> (1) (23) <223> q3624F2 <400> 5 cagcctcctt ccggtcttct tga 23 <210> 6 <211> 22 <212> DNA <213> Fusarium graminearum <220> <221> prim_transcript <222> (1) (22) <223> q3624R2 <400> 6 gagcagcacc ggggttccat cc 22 <210> 7 <211> 21 <212> DNA <213> Fusarium graminearum <220> <221> prim_transcript <222> (1) <223> q4699F <400> 7 cttgggggag ggtcakhga t 21 <210> 8 <211> 24 <212> DNA <213> Fusarium graminearum <220> <221> prim_transcript <222> (1) <223> q4699R <400> 8 cacagtttgc gttttgccgt tcag 24 <210> 9 <211> 24 <212> DNA <213> Fusarium graminearum <220> <221> prim_transcript <222> (1) <223> q11037F2 <400> 9 tcacttacag cggtgactac gagc 24 <210> 10 <211> 24 <212> DNA <213> Fusarium graminearum <220> <221> prim_transcript <222> (1) <223> q11037R2 <400> 10 agttgaagtt ggtgacgggg ttgg 24 <210> 11 <211> 21 <212> DNA <213> Fusarium graminearum <220> <221> prim_transcript <222> (1) <223> q12085F2 <400> 11 tcccgctagc gctacagacc a 21 <210> 12 <211> 24 <212> DNA <213> Fusarium graminearum <220> <221> prim_transcript <222> Complement ((1) (24)) <223> q12085R2 <400> 12 gttgctcata agcgctcatt tcat 24 <210> 13 <211> 21 <212> DNA <213> Fusarium graminearum <220> <221> prim_transcript <222> (1) <223> q13189F <400> 13 tggcgcatga aggaaagagt t 21 <210> 14 <211> 22 <212> DNA <213> Fusarium graminearum <220> <221> prim_transcript <222> (1) <223> q13189R <400> 14 tcgacatgcg cagctgaggg at 22 <210> 15 <211> 3061 <212> DNA <213> Fusarium graminearum <220> <221> gene Complement ((1) .. (3061)) <223> FGSG_00096 <400> 15 atgtcggttg gtgcattccc aggcgctctg cccgactgga caaacctcaa cgtcctccaa 60 cgcaatactc tccctcctag agctcatttc tactcttacc ccgaccaaga gtcagcactc 120 tccttcaacc gggaccaaag cctttttcac agtcttaatg ggacatggaa attccactac 180 gacccaagcc ctctcgatgc cccaatctgg gagactgcca acaccacttc atgggatgac 240 attgaagtcc caggtatgtg gcagctccag ggctatgggg ctcctcacta caccaatatc 300 gactacccat tctcggtgac gccacctaat gtctcctacg ttaacccaac tggctcttac 360 tggcgtcagt ttgaggttcc tgaggattgg gaaggcgacc agatccgatt gaggtttgaa 420 ggtgttgata gtgcgttcca tgtacgagta aatggtgagg atgtgggcta cgcgcaaggt 480 agtcgtaatc ctcatgagtt cgacattacg gactatctct cttctgacaa ggctaatgaa 540 ctggccgtgc gcgtctacca gtggtctgat gggtcttaca tcgaagatca agatcaatgg 600 tggctctctg gtatctttcg cgacgtttat ctcatcccgt tttctgaatc ctcaatcatt 660 gactaccaag ttgactctga gctgagcgac tcttttgatc aaggctccat caaggtcaat 720 gtcaccgttc aaggccaaga aggcgattta gccattaacc tgctctctgc aaatggttca 780 acaattgacg aatggaaagg atcgtcgtcc gagatataca agaaacaaat ctctggcgac 840 gactttcatc tctggtctgc cgagacgcct tacctctaca ctctactcat cacctacaac 900 ggccgaacaa taagtcaaaa ggctgggctt cgacgcgttg agatgaaggg tcccaacttt 960 tacgtcaacg gaaaaccaat catcatttac ggtgtcaata gacatgagca ccatcatctc 1020 acgggccgca cagtcagcta cgagaacatg cgaaaagatc ttatccttat gaagaaatcc 1080 aacatcaacg ccatccgtgc agctcatcag cctcaccacc ctgacttttt cgatgtggca 1140 gatgaactcg ggttctacat catcggcgag gccgatcttg agtgtcatgg tttcaggtcc 1200 tttgaagata ctgaggaaaa ggcagcagag tggttgtcca ataacccgga ctgggaagac 1260 gcatatatcg acagagcccg tcagcttgtt gagcgataca agaaccatgc ctccattatc 1320 atctggtctc ttggcaacga gtgtttctat ggtcagaacc acgctgccat gagtaagtgg 1380 attcgagagc gagatccaag tcgtattata cactatgagc aggatcatga ggccaaatcg 1440 acggatatgt acagtcagat gtatactact cctgactatg tccgacaatt cattaaggac 1500 cacggtgaca agccagttct cctttgcgag tttgctcagt aagtcagctc tgtcgatcat 1560 caccttgcga agctaatatc gttacagtgc tatgggtaac ggccccggcg gtcttgtgga 1620 gtacattgac atgttcagaa ccgagccgct ttctcaaggt ggtcttgtct gggaatggag 1680 taaccatgga atcctcaagg aagagggcaa tgtcacttac tatgcctatg gtggtgattt 1740 tggcgaccat cctaatgacg cagactttat catggatggt ttgactttgt ccgaccactc 1800 acccatgcct tctctcagag agtatgccaa agtgattcag ccagtgtcag tcttgctggc 1860 aaagaatggc agtgcgataa ccatcacgaa ccattacgac ttcctggatc tgagccacct 1920 tgatgcttcg tggcacgtgg ttgcagatgg tgtcaagact gatccccaga gtctttcttt 1980 gcctcgtgta ccaccaggcg aaaacagaac tctggctatt ccatctgtcg agaacataac 2040 tacaggcgat tgttgggtta ctttggagtt caaactcaaa gaggataccc tttgggctac 2100 cgagggacat cttatcgctt gggaccaact tcacatcgag cgacccgctt cagcatctaa 2160 gaacgcggcg tctctcaccc gccgtgctaa cacctccgaa tttgaaagaa agggcacaag 2220 tcttagctac aagaatggag actcctcctt tgggttcgat ctcctccaag gcaatgtcac 2280 atggaccaaa aatggtgttg atatcttcca acgcggccca gagctctcct tctaccgcgc 2340 cctgacacag aacgatgctt ctggatcagg cgatggccca atgtgggacc gagctagaat 2400 cccaatgata taccctcaag tcagagacgt gacatggaag actgacgaag acggcgcgac 2460 cgtccactac aaagtttggg tcggcgtcaa gacacaagcg tggggtatcg aggcagacat 2520 gatctacaaa atcccctcct caggtccaga gcttcagctt caagccagcg gcgaatttat 2580 cggcaagaac tcctctcata cgattcctcg catcggtctc atggctgttc taccagaatc 2640 ctttgacgac gtatcatggt tcggtcgtgg tccaggcgag agctacaaag actccaaaca 2700 agcaggtcgc attggagaat acagttctaa cgtgccggat ctgtttacac actacgatta 2760 cccacaagag aatggtaacc gagaagatct gcgttggctc aagatcggca acaaggacgc 2820 cgcgcttgat gcaaggcggg caaagggcga gacattcact tttacggcca gaagatacat 2880 gccttttgat ttggatgacg ccaagcaccc tcatgacttg aagcccttga acatgacagt 2940 cttgcatctg gattatgata gcaatggact gggcagtgcg actgttgctg tgaggccgtt 3000 tgagcagcat aggtgttaca tgaaggcttt tgactttaca tttgacttta gcattgttta 3060 g 3061 <210> 16 <211> 1392 <212> DNA <213> Fusarium graminearum <220> <221> gene Complement ((1) .. (1392)) <223> FGSG_02059 <400> 16 atgctcttct ctcaatctat cggagttgtg gctcttgcca cattgaccac tgctgccccg 60 gagcgaaaga ctctcgcaac ccgtgaagtt ggaagactcc cagctttggg atggaacggc 120 tgggtaagct actcacatta aagttgaaaa gtctcgatcg atcactaaca tcatcaacag 180 aaccaaggac aatgcaatgc agccagcgag aaggttgctt tggccacggc caagaccttc 240 atcgatctgg gcctcaagga cgccggatac caatacatca acattgacga ttgctggtct 300 acgagacagc gtgactcaaa gggcaacctt gtacccgacc ccagcaagtg gccaagaggt 360 atcaagcccg tcgtcgatga gatccataaa atgggcctga agtttggtct ctacggtgac 420 agaggtgtca agacttgtgc cggatttccc ggaagtcagg gtcatgagaa gcaagatgcc 480 gacttgcttg ccagctgggg tgtcgactac tggaagtacg acaactgtta cacgccatgc 540 tacaacggca accaagccga catccagaca tgccccatcg gcaagggtcc tagctccaga 600 cccggttacg aattgatgag agacatgctc cgcaacacag gaaaggacat cctctactcc 660 ctctgcaact ggggctggga tgaggtctgg acttggggtg cttccgtcgg ccacatgtgg 720 cgtatgagtg ttgataactg gggtaaatgg gacgatgttg tgcgaattgc caaccaggct 780 gcacctatcc tcaagtacac ccagcctggt cgttacaacg atctcgacat gatggtgagt 840 ttgagccccc tgtgtctgtc aacgaaaaac aatgggactg atggaagttt agattcttgc 900 caatggtgct ctgacaccag ctgaggagcg aactcacttc gcaatttggg ccatcaccaa 960 gtcccccatt attctcggca cagacatgac caagatcaac agcgctgaga tcaagctcat 1020 caccaacaag gtaacttgag acctatcttc caccgtagac atagactaat cacacctttg 1080 cagggcctcc tcgcggtcaa ccaagactca ctgtcaaagc ctgccgtgcc tttcacccct 1140 cccggaaccc ctgccaaagc cagcaacgag atctaccctt actggtcagg acctctggcg 1200 tccggaaccg ttgtcgccat tgtcgcaagc aagggcaacc tcgacactac tctgagcctc 1260 tcacaagttc ccggactgaa ggaccaggac tactcatgga ctgagctctt gactggtgcc 1320 aagggcagag gtagaactgt tcaggccaag ttggagaagc atgacattgc tgttttccga 1380 attgacaact ag 1392 <210> 17 <211> 742 <212> DNA <213> Fusarium graminearum <220> <221> gene <222> Complement ((1) .. (742)) <223> FGSG_03624 <400> 17 atggtctcct tcacctacct tctcgccgct gtctcggccg tcactggcgc cgtcgctgct 60 cccaacccta ccaaggttga tgctcagcct ccttccggtc ttcttgagaa gcgcaccagc 120 cctacaactg gtgtcaacaa tggcttttac ttctccttct ggaccgatac ccccagcgct 180 gtcacctaca ccaacggcaa cggtggtcag ttcagcatga actggaacgg caaccgtggt 240 aaccacgtcg gtggtaaggg atggaacccc ggtgctgctc ggtaagatac catcataaac 300 tagtccatat agaacttttg ctaaccatcc cttcagcacc atcaagtact ctggtgacta 360 ccgccccaac ggcaacagct acctcgctgt ttacggctgg acccgcaacc ctctcgttga 420 gtactacatc gtcgagaact tcggcaccta caacccctct tccggtgctc agaagaaggg 480 tgagatcaac atcgatggat ccatctacga cattgctgtc agcactcgca actgtgctcc 540 ttccatcgag ggtgactgca agaccttcca gcagtactgg tccgtccgcc gcaacaaacg 600 atccagcgga tccgtcaaca ccggtgctca cttcaacgcc tgggcccagg ctggtctccg 660 cctcggaagc cacgactacc agatccttgc tgttgagggt taccagagct ctggccaggc 720 taccatgact gtctctggat aa 742 <210> 18 <211> 817 <212> DNA <213> Fusarium graminearum <220> <221> gene &Lt; 222 > Complement ((1) .. (817)) <223> FGSG_11037 <400> 18 atgaaggcct ctgtcggatt cctcgccgcg ttcctcgcac cagttacact ggcccagtct 60 ctctgcgacc agtactccta ctacgctaac ggcggttacg agttcaacaa caaccgctgg 120 ggccaaggct ctggctctgg ttctcagtgc acttacattg actggaccaa cagcaacggt 180 gctggctggc acaccgactg gacctggtcc ggtggccaag acaatgttaa ggcctacccc 240 aactctggtc ttcagatcag caacaagcgc ctcctcagct ccatcagcaa catgcagtcc 300 gccgctgctt ggtcttacag cggaaccaac gttcgcgcca acgttgctta cgatcttttc 360 actgcctctg accctaacca cgtcacttac agcggtgact acgagctgat gatctggtaa 420 gtgagccacg acaacattgt gaatttatgc taatactttc caggctcgga cgatatggtg 480 gcgtgcagcc cattggctcc aaggtcggca atgccaacgt cgagggccgc acttgggagc 540 tctggagcgg catgaacggt agcatgcgag tctacagctt cgtcgccccc aaccccgtca 600 ccaacttcaa ctctgacgtc aagcaattct ggaactacct tgccaacacc cagggatacc 660 ctgccagcaa gcaatacctt cttagtacgt ttatatgtgc cctggtcatc tgtcacatgc 720 taattatatc tcaacagcct tccagttcgg taccgagcct ttcaccggaa gcggtgctca 780 gttcaaggtt accaacttca acgctcacat caactaa 817 <210> 19 <211> 366 <212> DNA <213> Fusarium graminearum <220> <221> gene Complement ((1) .. (366)) <223> FGSG_12085 <400> 19 atgattatgt caagtctctc gtttgcagcc atgctcggct atgcctccta tatttaccac 60 aaatttcgca aaggcaccct tataagccag tttcccgcta gcgctacaga ccaacttgta 120 ttacaagata catcaaatgc aggacaccca tataactgca tcgaccaaca ccagcagcca 180 ttaacatcac tttccacgag ctacagtcac gataagcatg aaatgagcgc ttatgagcaa 240 ccactgaccg aactcgacgg tcatcaccgc aataagccat atgcaggaag aagcgagctc 300 ttcgctgcgc acactcctgc gacagagata tatgagatgt atacgccaga tacaaaacgt 360 gtatag 366

Claims (5)

A marker composition for the diagnosis of a red fungus disease, which comprises at least one oligonucleotide selected from the group consisting of SEQ ID NOS: 3, 4, 5, 6, 11 and 12, . The method according to claim 1,
Wherein the oligonucleotide is used as a primer in a quantitative RT-PCR and is used to test whether the host plant is in an early stage of infection with a red fungus disease caused by a fusarium guminaloma clomidum complex strain. Diagnostic marker composition. The method according to claim 1,
The oligonucleotide selected from the group consisting of SEQ ID NOs: 11 and 12 is an oligonucleotide selected from the group consisting of a marker for the diagnosis of a fungal disease, which detects an early stage of infection of the Fusarium graminearum PH-1 strain ( Fusarium graminearum PH-1) Composition. The method according to claim 1,
Wherein the marker composition for diagnostic of a red fungus disease further comprises at least one oligonucleotide selected from the group consisting of SEQ ID NOs: 1, 2, 9, 10, 13 and 14. A kit for diagnosing a red fungus disease, comprising a marker composition for diagnosing a red fungus disease according to any one of claims 1 to 4, for detecting whether or not an early development of a red fungus disease occurs.