CN106893776A - A kind of method for detecting Ustilaginoidea virens cyp51 gene nucleotides mutational site - Google Patents
A kind of method for detecting Ustilaginoidea virens cyp51 gene nucleotides mutational site Download PDFInfo
- Publication number
- CN106893776A CN106893776A CN201710090910.7A CN201710090910A CN106893776A CN 106893776 A CN106893776 A CN 106893776A CN 201710090910 A CN201710090910 A CN 201710090910A CN 106893776 A CN106893776 A CN 106893776A
- Authority
- CN
- China
- Prior art keywords
- ustilaginoidea virens
- mutational site
- cyp51
- strain
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of detection Ustilaginoidea virenscyp51The method in gene nucleotide mutational site, belongs to technical field of molecular biology.It is related to for detecting Ustilaginoidea virenscyp51The primer in gene nucleotide mutational site, its sequence is as shown in SEQ ID No.1 and SEQ ID No.2.The detection Ustilaginoidea virens that the present invention is provided develop immunity to drugs the method in mutational site to Tebuconazole, the characteristics of with high sensitivity, simple and quick, good stability, wide applicability, sensitive strain and drug-fast strain can be effectively distinguished, for detecting resistance generation, development trend of the field rice ustilaginoidea virens to Tebuconazole.The molecular detecting method that the present invention is provided, for the drug-fast early warning of Ustilaginoidea virens and the rational plant disease management scheme of formulation, the development of drug resistance of effectively control disease has great importance.
Description
Technical field
The present invention relates to a kind of method for detecting Ustilaginoidea virens cyp51 gene nucleotides mutational site.Belong to molecule
Biology techniques field.
Background technology
Rice green smut（False smut of rice）Blue or green powder disease, black ball disease, paddy blossom disease are commonly called as, are a kind of Rice Panicle
Fungal disease, often all occurs in paddy rice a year of abundance, therefore is also referred to as " good harvest disease ".False smut takes place mostly in the maturity period
Rice Panicle.The Perfect stage of the pathogen is（Villosiclava virens）Belong to Ascomycota Ascomycetes Claviceps,
Invisible element is（Ustilaginoidea virens）Belong to the green pyrenomycetes category of Fungi Imperfecti door Coelomycetes.Since the eighties, with China
Hybrid paddy rice, erect type and dense cluster type high-yield rice kind widely popularize and farmland fertility raising, false smut is from Minor diseases
Rise to the Major Diseases in China's Rice Production, the infected seed on the field of morbidity each sick fringe is generally 1-10, meeting more
30-50 is reached, disease tassel yield is more in 5-20%, has had a strong impact on the yield and quality of paddy rice.
For a long time, rice green smut is Minor diseases, does not cause enough attention, lacks corresponding disease-resistant variety, is changed
It is still the Main Means for controlling false smut to learn preventing and treating, and the wherein Tebuconazole in DMIs series bactericidal agents is prevent and treat false smut main
Chemical agent.Tebuconazole（Tebuconazole）It is a kind of triazole type that Bayer A.G develops in phase late 1990s
Bactericide, containing aromatic heterocycle, belongs to 14- α demethylating reaction inhibitor（14 α-de Methylation inhibitors,
DMIs）In an important class, obtain registration and extensive use in more than 50 country and 60 various crops.With other DMIs mono-
Sample, Tebuconazole is mainly to the ergosterol biosynthesis on pathogen cell membrane inhibitory action, so as to show pathogen
Go out bacteriostasis, Inner is then shown to plant and inhales therapeutic action.A large amount of due to Tebuconazole use, the existing many phytopathies in field
Opportunistic pathogen generates different degrees of resistance, such as grape anthracnose [Chen Dan, 2013] to the medicament（Colletotrichum
gloeosporioides）, Botryosphaeria berengeriana f. sp [model elder brother etc., 2013]（Botryosphaeria dothidea）, longan it is burnt rotten
Germ [Pereira et al, 2012]（Lasiodiplodia theobromae）Deng all generating certain level to Tebuconazole
The resistance to the action of a drug.
At present, Tebuconazole is one medicament of sales volume highest in triazole bactericidal agent, to the anti-tool of rice green smut
There is important meaning.This research department has obtained the rice green smut flat to water resistant in Tebuconazole generation by the method for fungicide tame
Bacteria strain, and the existence grade of fit of partial resistance bacterial strain is higher, shows there is resistance risk higher.Therefore, penta is being used
Drug-fast generation should be avoided during azoles alcohol preventing and treating rice green smut disease, strengthens detection and early warning Ustilaginoidea virens to penta
There is development in the resistance of azoles alcohol, help to instruct the scientifical use of Tebuconazole, delay drug-fast occurrence and development, extend
The service life of medicament.
Traditional Resistance detecting method includes：Mycelial growth rate method, dry mycelial weight determination method, spore germination determination method
Deng.These traditional assay methods are required to prepare the culture medium of pastille, calculate concentration in effectively suppressing, and the consuming time is long, work
Work amount is big, and sensitivity is low.With the development of Protocols in Molecular Biology, for the resistance that single base mutation causes, AS-PCR and
CAPS methods are successfully used for the Molecular Detection of resistant strain, with detection the time required to it is short, the advantages of sensitivity is high, therefore quilt
Perfected process as field drug-fastness early diagnosis.
The content of the invention
It is an object of the invention to provide a kind of method for detecting Ustilaginoidea virens cyp51 gene nucleotides mutational site
And its primer special.
Primer for detecting Ustilaginoidea virens cyp51 gene nucleotides mutational site, the primer is: Uv137F1：
TTCACTGGTTCCCCTTTATCGG（SEQ ID No.1）；Uv137DR：GGCGTTGGGGCAATCGCG（SEQ ID No.2）.
Detection provided by the present invention or auxiliary detection Ustilaginoidea virens cyp51 genes whether there is the side in mutational site
Method, comprises the following steps：
Genomic DNA with Ustilaginoidea virens to be measured as template, with the primer shown in SEQ ID No.1 and SEQ ID No.2
Enter performing PCR amplification, if 391 bp bands can be amplified, cyp51 genes exist or wait in the Ustilaginoidea virens to be measured
There is mutational site in choosing；
The mutational site refers to that the genome sequence of Ustilaginoidea virens cyp51 genes the 543rd nucleotides from 5 ' ends is C.
The genome sequence of the cyp51 genes the 543rd nucleotides from 5 ' ends is last from 5 ' in SEQ ID No.4
The 543rd nucleotides is held.
In said process, in the PCR amplifications, annealing temperature is 51.6 DEG C.
It is a further object to provide the mutational site of cyp51 genes or albumen in Ustilaginoidea virens.
One mutational site of Ustilaginoidea virens cyp51 genes provided by the present invention, in being Ustilaginoidea virens
The genome sequence of cyp51 genes the 543rd nucleotides from 5 ' ends is C.The genome sequence of the cyp51 genes is from 5 '
End rise the 543rd nucleotides be in SEQ ID No. 4 from 5 ' ends the 543rd nucleotides.
A mutational site of CYP51 albumen in Ustilaginoidea virens provided by the present invention, in being Ustilaginoidea virens
The 137th amino acids from N-terminal of CYP51 albumen are histidine.The 137th amino acids from N-terminal of the CYP51 albumen are
In SEQ ID No. 3 from N-terminal the 137th amino acids.
Application of any of the above-described mutational site in the Ustilaginoidea virens resistance to the action of a drug is identified falls within guarantor of the invention
Shield scope：The described resistance to the action of a drug is anti-Tebuconazole.
In above-mentioned application, exist the mutational site Ustilaginoidea virens have or candidate there is the resistance to the action of a drug.
The method in the mutational site that the detection Ustilaginoidea virens that the present invention is provided develop immunity to drugs to Tebuconazole, antagonism
Bacterial strain carries out high sensitivity, simple and quick Molecular Detection, and resistance to the action of a drug occurrence dynamics are understood in time, prevents formulating rational disease
Strategy is controlled, the development of effectively control resistance to the action of a drug disease is significant.
The method in mutational site that the detection Ustilaginoidea virens that the present invention is provided develop immunity to drugs to Tebuconazole with it is existing
Technology is compared, and is had the following advantages that and good effect：
1st, it is simple and quick：Traditional Bioassay method needs to determine sensitiveness of a large amount of Ustilaginoidea virens to Tebuconazole,
Base-line sensitivities of the Ustilaginoidea virens to Tebuconazole are set up, and then evaluates resistance water of the Ustilaginoidea virens to be measured to Tebuconazole
It is flat.Ustilaginoidea virens mycelial growth is slow, needs one month or so time, and due on rice curve miscellaneous bacteria it is many, varied bacteria growing speed
Degree is far above germ mycelial growth, and Ustilaginoidea virens are contaminated easily in being separately cultured, and the successful probability of separation is extremely low, because
This, to the resistance level of Tebuconazole some months at least, just may be used at most 1 year using traditional biological method measure Ustilaginoidea virens
With complete, workload is big, the cycle is long, and the present invention detection both can be carried out to rice green smut bacteria strain can also be directly to field
Between rice curve detected, from extract DNA to PCR only need 1 day time just to complete, simple and convenient, time and labour saving.
2nd, accuracy is high：The present invention set up molecular detecting method to Ustilaginoidea virens sensitive strain, drug-fast strain,
Rice curve, the equal energy of rice curve of resistant strain Inoculated Rice plant morbidity generation that the morbidity of sensitive strain Inoculated Rice plant is produced
Accurately distinguish and come, result reliability is guaranteed.
3rd, applicability is wide, applicability is good：The present invention can both be detected to Ustilaginoidea virens mycelium, it is also possible to directly right
Field rice curve detection, is capable of achieving the anti-Tebuconazole monitoring of field false smut.
Brief description of the drawings
Fig. 1 is that the sequence of the cyp51 gene DNAs of the rice green smut bacteria strain and sensitive strain of anti-Tebuconazole compares discovery
A mutational site related to resistance.Wherein, F10-338, JY13107, NH13018, SX13035, NH13052 are that field is quick
Sense bacterial strain, F10-338C and F10-338D is resistant strain.
Fig. 2 is to carry out thermograde PCR amplification electrophoretograms using different AS-PCR primers.S：Sensitive strain；R：Resistance bacterium
Strain；Reverse primer is followed successively by Uv137AR, Uv137BR, Uv137CR, Uv137DR from top to bottom, and forward primer is Uv137F1.
Fig. 3 is the Ustilaginoidea virens bacterium using primer Uv137F1 and Uv137DR of the present invention sensitive and resistances to Tebuconazole
The electrophoretogram of strain specific amplification.M：DNA Marker；Swimming lane 1-5 be respectively sensitive strain JY13107, NH13018,
SX13035、NH13052、F10-338；Swimming lane 6-7 is respectively resistant strain F10-338C, F10-338D；CK is negative control.
Fig. 4 is the electricity of the DNA specific amplifications to being extracted in rice curve using primer Uv137F1 and Uv137DR of the present invention
Swimming figure.M：DNA Marker；Swimming lane 1 is the rice curve that anti-Tebuconazole bacterial strain F10-338C Inoculated Rices plant produces, and swimming lane 2 is
The rice curve that anti-Tebuconazole bacterial strain F10-338D Inoculated Rices plant produces, swimming lane 3 is planted for sensitive strain F10-338 Inoculated Rices
The rice curve that strain is produced, swimming lane 4 is the rice curve that sensitive strain JY13107 Inoculated Rices plant produces, and swimming lane 5 is sensitive strain
The rice curve that NH13018 Inoculated Rices plant produces, swimming lane 6 is that the rice that sensitive strain SX13035 Inoculated Rices plant produces is bent
Ball.
Specific embodiment
Experimental technique used in following embodiments is conventional method unless otherwise specified.
Material used, reagent etc. in following embodiments, unless otherwise specified, commercially obtain.
" resistant strain " refers both to the Ustilaginoidea virens to Tebuconazole resistance in text；" sensitive strain " refers both to quick to Tebuconazole
The Ustilaginoidea virens of sense；
The Ustilaginoidea virens used in following embodiments are：Resistant strain F10-338C and F10-338D；Sensitive strain is
F10-338、JY13107、NH13018、SX13035、NH13052。
From the Rice Resistance characteristic of disease identification garden collection rice green smut sample of the nearly 20 years unused bactericide in Fujian different regions,
Above-mentioned sensitive strain is obtained through the purifying of PSA culture mediums single spore separation.Resistant strain F10-338C and F10-338D pass through medicament
The method of domestication is obtained, and parent strain is F10-338.Identify that all bacterial strains are by the method for morphology and molecular biology
Ustilaginoidea virens.Above-mentioned each bacterial strain carries out resistance to the action of a drug checking by colony growth performance rate method.
The rice curve used in following embodiments is：Resistant strain F10-338C, F10-338D distinguish Inoculated Rice plant
The rice curve of generation；The rice that sensitive strain F10-338, JY13107, NH13018, SX13035 difference Inoculated Rice plant produce
Curve.
The discovery in cyp51 genes and CYP51 protein mutations site in embodiment 1, Ustilaginoidea virens.
1st, bacterial strain：Resistant strain be F10-338C and F10-338D, sensitive strain be F10-338, JY13107,
NH13018、SX13035、NH13052。
2nd, method：
1）Strain culturing：By bacterial strain on PSA culture mediums in being cultivated 5-7 days at 28 DEG C, beat and take that bacteria cake 7-10 is individual to be trained in PSB liquid
Concussion and cultivate 5 days in foster base, by mycelium pellet suction filtration, removes nutrient solution, and freeze drier freezing is put in -20 DEG C of preservations after draining.
2）The genomic DNA of resistant strain and sensitive strain is extracted respectively.
3）The geneome RNA of resistant strain and sensitive strain is extracted respectively.
4）RNA reverse transcriptions.
5）The PCR amplifications of 14 α of lanosterol-demethylase cyp51 genes
14 α of lanosterol of table 1-demethylase cyp51 gene cloning primers
Primer is using the S-4/A-3 in table 1.
Using high-fidelity enzyme（KOD-Plus-Neo）Enter performing PCR reaction.
PCR reaction systems are as follows：The reaction system of 25 μ L includes：0.5µL KOD-Plus-Neu（1U/µL）, 2.5 μ L
The 25 mM MgSO4 of mM dNTPs, 1.5 μ L of 10 × PCR buffer, 2.5 μ L 2,0.75 μ L sense primers, under 0.75 μ L
Trip primer, 2 μ L template DNAs, 14.5 μ L ddH2O。
PCR reaction conditions：Predegeneration 94 DEG C of 3min, 98 DEG C of 10s, 59.6 DEG C of 30s, 68 DEG C of 80s, 36 circulations, most
Extend 10min at 68 DEG C afterwards.Amplified production is detected in 1% agarose gel electrophoresis.
6）The PCR amplifications of the cDNA of 14 α of lanosterol-demethylase cyp51 genes
Primer is using the S-2/A-2 in table 1.
PCR reaction systems are with 5）.
PCR reaction conditions：Predegeneration 94 DEG C of 3min, 98 DEG C of 10s, 59.6 DEG C of 30s, 68 DEG C of 1min, 36 circulations, most
Extend 10min at 68 DEG C afterwards.Amplified production is detected in 1% agarose gel electrophoresis.
7）Sequencing
PCR primer is sequenced.The bp of full-length genome 1827 of the cyp51 genes of resistant strain, sequence such as SEQ ID
Shown in No.4, wherein the intron sequences comprising 240 bp, cDNA 528 amino acid of coding, sequence such as SEQ ID No.3 institutes
Show.
8）Sequence alignment
Compare the cyp51 genes and protein sequence of sensitive strain and resistant strain.Result is as follows：
In sensitive strain, PROTEIN C YP51 the 137th amino acids from N-terminal are tyrosine（Tyr, Y）, the genome of gene cyp51
Sequence the 543rd nucleotides from 5 ' ends is T（Fig. 1）；
In resistant strain, PROTEIN C YP51 the 137th amino acids from N-terminal are histidine（His, H）, the genome of gene cyp51
Sequence the 543rd nucleotides from 5 ' ends is C（Fig. 1）.
PCR primer sequencing result shows that resistant strain to be undergone mutation at 543 and sport C by T, analyzes the crest line of sequencing
Figure, it is found that the site crest line figure is clear single clear and definite, and show the site sports homozygous mutation.Speculate the mutation in the site with
The resistance that Ustilaginoidea virens are produced to Tebuconazole is related.
The detection in mutational site in embodiment 2, Ustilaginoidea virens
Experiment one, design of primers
Primer such as table 2.
The AS-PCR of table 2. detects Ustilaginoidea virens to the primer that is used in the Tebuconazole resistance to the action of a drug
This method is consistent with mutant (table 2, primer Uv137AR) in last base of anti-sense primer, penultimate alkali
Base introduces base mismatch（Table 2, primer Uv137BR, Uv137CR, Uv137DR）, and expanded with reference to different annealing temperatures,
Improve the specificity of primer.Reaction condition is as follows：
PCR reaction systems are as follows：The reaction system of 25 μ L includes：0.5 μ L Taq archaeal dna polymerases（2.5 U/μL）, 2.5
μL 10×PCR buffer（Containing Mg2+）, 2.0 μ L 10mM dNTPs, every μ L of primer 0.5,1 μ L template DNAs, 18 μ L
ddH2O。
PCR reaction conditions：Predegeneration 94 DEG C of 3min, 98 DEG C of 10s, 44-56 DEG C of 30s, 68 DEG C of 45s, 36 circulations, most
Extend 10min at 68 DEG C afterwards.Amplified production electrophoresis detection in 1% Ago-Gel.
Result is as shown in Fig. 2 primer Uv137AR and Uv137F1 can be from resistant strain and sensitivity at a temperature of 44-56 DEG C
Fragment is amplified in the DNA of bacterial strain；Primer Uv137BR and Uv137F1 expands at a temperature of 44-56 DEG C from the DNA of resistant strain
Increase and nonspecific fragment；Primer Uv137CR and Uv137F1 are at a temperature of 44-56 DEG C from resistant strain and sensitive strain
Faint band is amplified in DNA；Show that this 3 pairs of primers can not be for detecting mutational site.And primer Uv137DR and Uv137F1
At 51.6 DEG C, sensitive strain can not amplify 391 bp bands, and resistant strain can amplify 391 bp bands.Therefore select
The primer that Uv137F1/Uv137DR is detected as resistance locus, annealing temperature is 51.6 DEG C.
Primer Uv137F1/Uv137DR amplified productions are 170-560 nucleotides in SEQ ID No.4.
The experiment two, detection in mutational site
With Ustilaginoidea virens genomic DNA to be measured as template, expanded with primer Uv137F1/Uv137DR, if amplification
Go out 391 bp fragments, then judge that detected Ustilaginoidea virens are resistant strain；If 391 bp fragments can not be amplified, sentence
Disconnected detected Ustilaginoidea virens are sensitive strain.
PCR amplification system and reaction condition are consistent with experiment one, and annealing temperature is 51.6 DEG C.
Test strains are：Resistant strain F10-338C and F10-338D, sensitive strain F10-338, JY13107,
NH13018、SX13035、NH13052。
Result is as shown in Figure 3.Result shows that primer Uv137F1/Uv137DR is only capable of from the water for showing Tebuconazole resistance
Rice ustilaginoidea virens bacterial strain（F10-338C and F10-338D）Specific band is amplified, and can not be from sensitive strain（F10-338、
JY13107、NH13018、SX13035、NH13052）Any band is amplified, shows that the primer can be used for specific detection water
Whether rice ustilaginoidea virens generates the resistance to the action of a drug to Tebuconazole.
The Ustilaginoidea virens detection of embodiment 3, anti-Tebuconazole
PCR amplification system and reaction condition are consistent with the experiment one in embodiment 2, and annealing temperature is 51.6 DEG C.
Rice curve to be measured is：The rice curve that resistant strain F10-338C, F10-338D difference Inoculated Rice plant produce；It is quick
The rice curve that sense bacterial strain F10-338, JY13107, NH13018, SX13035 difference Inoculated Rice plant produces.Rice curve is used
Liquid nitrogen grinds rapidly, then extracts the DNA molecular in rice curve using DNA extraction kit.
Result is as shown in Figure 4.Result shows that primer Uv137F1/Uv137DR is only capable of from the bacterium for showing Tebuconazole resistance
Specific 391 bp bands are amplified in the rice curve that strain Inoculated Rice plant produces（Swimming lane 1,2）, and can not be from sensitive strain
Specific 391 bp bands are amplified in the rice curve that Inoculated Rice plant produces（Swimming lane 3,4,5,6）.Show, the primer can be with
For specific detection field rice ustilaginoidea virens to the resistance to the action of a drug of Tebuconazole.
SEQUENCE LISTING
<110>Inst. of Plant Protection, fujian Academy of Agricultural Science
<120>A kind of method for detecting Ustilaginoidea virens cyp51 gene nucleotides mutational site
<130> 11
<160> 11
<170> PatentIn version 3.3
<210> 1
<211> 22
<212> DNA
<213>Artificial sequence
<400> 1
ttcactggtt cccctttatc gg 22
<210> 2
<211> 18
<212> DNA
<213>Artificial sequence
<400> 2
ggcgttgggg caatcgcg 18
<210> 3
<211> 528
<212> PRT
<213>Artificial sequence
<220>
<221>misc_feature
<222>（137）
<223>
<400> 3
Met Gly Val Leu Gln Asp Val Ala Gly His Pro Leu Ala Gln His Leu
1 5 10 15
Gln Ala Leu Asp Leu Ala Ser Gln Ile Ala Leu Ala Leu Thr Ala Phe
20 25 30
Val Val Leu Ser Ile Ala Leu Asn Val Ala Asn Gln Phe Leu Phe Ala
35 40 45
Asn Pro Asn Glu Pro Pro Val Val Phe His Trp Phe Pro Phe Ile Gly
50 55 60
Ser Thr Ile Thr Tyr Gly Ile Asp Pro Leu Lys Phe Leu His Glu Asn
65 70 75 80
Arg Ala Lys Phe Gly Asp Val Phe Thr Phe Val Leu Leu Gly Lys Lys
85 90 95
Thr Thr Val Ala Leu Gly Leu Ala Gly Asn Glu Phe Ile Leu Asn Gly
100 105 110
Lys Leu Lys Asp Val Asn Ala Glu Glu Ile Tyr Thr Val Leu Thr Thr
115 120 125
Pro Val Phe Gly Arg Asp Val Val His Asp Cys Pro Asn Ala Lys Leu
130 135 140
Met Glu Gln Lys Lys Phe Met Lys Ile Ala Leu Thr Thr Glu Ala Phe
145 150 155 160
Arg Ser Tyr Val Pro Ile Ile Ser Ala Glu Val Gln Ser Tyr Phe Lys
165 170 175
Arg Asp Pro Asp Phe Lys Gly Arg Ser Gly Val Val Asp Ile Thr Lys
180 185 190
Lys Met Ala Glu Ile Thr Ile Phe Thr Ala Ser His Ala Leu Gln Gly
195 200 205
Ser Ala Ile Arg Ser Lys Phe Asp Glu Ser Leu Ala Ala Leu Tyr His
210 215 220
Asp Leu Asp Met Gly Phe Thr Pro Ile Asn Phe Thr Leu His Trp Ala
225 230 235 240
Pro Leu Pro Trp Asn Arg Lys Arg Asp His Ala Gln Arg Thr Val Ala
245 250 255
Lys Ile Tyr Met Asp Thr Ile Arg Glu Arg Arg Ala Gln Gly Asp Ser
260 265 270
Asp Lys Glu Leu Asp Ile Met Lys His Leu Met Asn Ser Thr Tyr Lys
275 280 285
Asn Gly Thr Arg Val Pro Asp His Glu Val Ala His Met Met Ile Ala
290 295 300
Leu Leu Met Ala Gly Gln His Ser Ser Ser Ser Thr Ser Ser Trp Ile
305 310 315 320
Met Leu Arg Leu Ala Gln Asn Pro His Ile Val Glu Glu Leu Tyr Gln
325 330 335
Glu Gln Val Thr Ser Leu Gly Ala Asp Leu Pro Ala Leu Thr Tyr Glu
340 345 350
Asp Leu Ala Lys Leu Pro Leu Ser Gln Ala Ile Val Lys Glu Thr Leu
355 360 365
Arg Met His Ala Pro Ile His Ser Ile Met Arg Ala Val Lys Gln Pro
370 375 380
Met Pro Val Pro Gly Thr Lys Tyr Val Ile Pro Pro Thr His Thr Leu
385 390 395 400
Leu Ala Ser Pro Thr Ile Ser Ala Tyr Asp Ala Ala Phe Phe Pro Asn
405 410 415
Pro Glu Val Trp Asp Pro His Arg Trp Glu Ala Asp Ser Pro Asn Ala
420 425 430
Pro Thr Met Ala Arg Asn Ala Thr Ala Glu Glu Glu Glu Lys Val Asp
435 440 445
Tyr Gly Tyr Gly Leu Val Ser Lys Gly Ala Ala Ser Pro Tyr Leu Pro
450 455 460
Phe Gly Ala Gly Arg His Arg Cys Ile Gly Glu Gln Phe Ala Tyr Val
465 470 475 480
Gln Leu Gln Thr Ile Val Ala Glu Val Val Arg Leu Leu Lys Leu Arg
485 490 495
Asn Val Asp Gly Gly Asn Ser Ile Ile Gly Thr Asn Tyr Ala Ser Leu
500 505 510
Phe Ser Arg Pro Leu Glu Pro Ala Asn Ile Phe Trp Glu Arg Arg Asp
515 520 525
<210> 4
<211> 1827
<212> DNA
<213>Artificial sequence
<220>
<221>misc_feature
<222>（543）
<223>
<400> 4
atgggcgtcc ttcaagacgt tgcgggccat ccactcgctc agcatctcca agccttagat 60
ttggcatcgc aaattgcatt ggccttgacc gccttcgttg ttctctctat tgctctcaat 120
gtagccaacc agtttctctt tgcgaatcct aacgagcctc ccgtggtctt tcactggttc 180
ccctttatcg gcagcaccat tacatatggc attgatcctc tcaagttctt gcatgaaaat 240
cgcgccaagg taattaatga agaaggaatt ctttgtttta tctttttccc tccttctttt 300
tatccttcca caacgtcctt taccctgttc cttagtcgtt gccggctgtt cgctgccggc 360
tgttcgctta cgttcgtttc cagttcggag atgtcttcac ctttgtcctc ctcggcaaga 420
agacgactgt cgcccttggt cttgcaggaa acgaattcat tctgaatgga aaactcaaag 480
acgtcaacgc cgaggaaata tacactgttt tgacgacccc agtctttggc cgagacgtcg 540
tccacgattg ccccaacgcc aagttgatgg agcagaaaaa ggtaaccccg agccctgctg 600
cgttgcttct tcttttctct cctctccgaa aaagtgcgcg ccacaaaagg aaaaccccgc 660
tcatgcaaga ctgttgtggg tttgtagttt atgaagattg ctttgacaac cgaggctttc 720
cggtcgtacg ttcccatcat ctctgccgaa gtacaatcct acttcaagag ggacccggat 780
ttcaaaggca gatccggcgt tgtcgacatc accaagaaga tggccgaaat cacaatcttc 840
accgcctccc atgccctcca gggcagtgcc atccgcagca agttcgacga gtctctggcc 900
gctctctacc atgatttgga catgggcttc acccccatca acttcacgct gcactgggcg 960
cctcttcctt ggaaccgcaa gcgcgaccac gcccagcgga ctgttgccaa gatttacatg 1020
gataccatcc gggaacgtcg agcgcaaggc gattcggaca aggaactcga catcatgaag 1080
catctgatga actcgactta caagaacgga actcgcgtgc ctgaccatga ggtagcccac 1140
atgatgattg ccttgctcat ggctggccag cactcctcgt cttccactag ctcgtggatc 1200
atgcttcgac ttgcgcagaa ccctcacatc gtcgaggagc tgtaccaaga gcaagtcacg 1260
tctctgggtg ccgacctccc tgcgctcaca tacgaagacc tagccaagct gccgctgagt 1320
caggccattg tcaaggaaac tctccgaatg cacgctccca tccactccat catgcgagct 1380
gtcaagcagc ccatgccggt tcctggcacc aagtatgtca ttcctccaac tcacacgctt 1440
ctcgcttctc ccaccatcag cgcctacgat gccgcctttt ttccgaaccc cgaagtctgg 1500
gatccccacc gatgggaagc agactctccc aatgcgccca ccatggctcg caacgccacc 1560
gccgaggagg aggaaaaggt cgactacgga tacggcctgg tcagcaaggg tgctgcatcg 1620
ccgtatcttc cctttggtgc gggtcgtcat cgatgcattg gcgagcagtt tgcctacgtg 1680
cagctgcaga ccatcgttgc cgaggttgtc cgtctgttga agctgcgcaa tgttgatggt 1740
ggcaatagca tcatcggcac caactacgcc tctctctttt cacgacccct cgagcctgcc 1800
aacattttct gggaacgacg agattag 1827
<210> 5
<211> 22
<212> DNA
<213>Artificial sequence
<400> 5
aaccttcctt ttccccaata gc 22
<210> 6
<211> 22
<212> DNA
<213>Artificial sequence
<400> 6
atgggcgtcc ttcaagacgt tg 22
<210> 7
<211> 22
<212> DNA
<213>Artificial sequence
<400> 7
gccgttaccc gctctattat tc 22
<210> 8
<211> 25
<212> DNA
<213>Artificial sequence
<400> 8
ctaatctcgt cgttcccaga aaatg 25
<210> 9
<211> 18
<212> DNA
<213>Artificial sequence
<400> 9
ggcgttgggg caatcgtg 18
<210> 10
<211> 18
<212> DNA
<213>Artificial sequence
<400> 10
ggcgttgggg caatcgag 18
<210> 11
<211> 18
<212> DNA
<213>Artificial sequence
<400> 11
ggcgttgggg caatcggg 18
Claims (5)
1. a kind of primer for detecting Ustilaginoidea virens cyp51 gene nucleotides mutational site, it is characterised in that：Detection is drawn
Thing is: Uv137F1：TTCACTGGTTCCCCTTTATCGG；Uv137DR：GGCGTTGGGGCAATCGCG.
2. a kind of method for detecting Ustilaginoidea virens cyp51 gene nucleotides mutational sites, it is characterised in that：Including following step
Suddenly：Genomic DNA with Ustilaginoidea virens to be measured enters performing PCR and expands as template, with the primer pair described in claim 1,
If 391 bp bands can be amplified, cyp51 genes are present or candidate has mutational site in the Ustilaginoidea virens to be measured；
In described PCR amplifications, annealing temperature is 51.6 DEG C；Described mutational site refers to cyp51 genes in Ustilaginoidea virens
Genome sequence the 543rd nucleotides from 5 ' ends is C.
3. application of the primer as claimed in claim 1 in the Ustilaginoidea virens resistance to the action of a drug is identified.
4. application according to claim 3, it is characterised in that：The described resistance to the action of a drug is anti-Tebuconazole.
5. application according to claim 3, it is characterised in that：There is the mutational site in Ustilaginoidea virens, with or
Candidate has the resistance to the action of a drug.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710090910.7A CN106893776A (en) | 2017-02-20 | 2017-02-20 | A kind of method for detecting Ustilaginoidea virens cyp51 gene nucleotides mutational site |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710090910.7A CN106893776A (en) | 2017-02-20 | 2017-02-20 | A kind of method for detecting Ustilaginoidea virens cyp51 gene nucleotides mutational site |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106893776A true CN106893776A (en) | 2017-06-27 |
Family
ID=59184894
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710090910.7A Pending CN106893776A (en) | 2017-02-20 | 2017-02-20 | A kind of method for detecting Ustilaginoidea virens cyp51 gene nucleotides mutational site |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106893776A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111549163A (en) * | 2020-04-29 | 2020-08-18 | 浙江农林大学 | LAMP-based method for rapidly detecting prochloraz-resistant S312T genotype Fusarium celandi |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102864220A (en) * | 2012-08-09 | 2013-01-09 | 中国农业大学 | Method for identifying nucleotide point mutation of rhizoctonia solani Sdh gene and drug resistance of rhizoctonia solani Sdh gene to thifluzamide |
| CN103627659A (en) * | 2013-11-27 | 2014-03-12 | 福建省农业科学院植物保护研究所 | Bacillus subtilis and application in prevention of rice ustilaginoidea virens |
-
2017
- 2017-02-20 CN CN201710090910.7A patent/CN106893776A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102864220A (en) * | 2012-08-09 | 2013-01-09 | 中国农业大学 | Method for identifying nucleotide point mutation of rhizoctonia solani Sdh gene and drug resistance of rhizoctonia solani Sdh gene to thifluzamide |
| CN103627659A (en) * | 2013-11-27 | 2014-03-12 | 福建省农业科学院植物保护研究所 | Bacillus subtilis and application in prevention of rice ustilaginoidea virens |
Non-Patent Citations (8)
| Title |
|---|
| DANILO AS PEREIRA等: "Mutations in the CYP51 gene reduce DMI sensitivity in Parastagonospora nodorum populations in Europe and Chi", 《PEST MANAG SCI》 * |
| RALLOS LE等: "Co-Occurrence of Two Allelic Variants of CYP51 in Erysiphe necator and Their Correlation with Over-Expression for DMI Resistance", 《PLOS ONE》 * |
| WANG F等: "The Y137H mutation of VvCYP51 gene confers the reduced sensitivity to tebuconazole in Villosiclava virens", 《SCI REP》 * |
| 安新焕等: "等位特异PCR方法检测IL-6基因启动子区-634C/G多态性", 《昆明医学院学报》 * |
| 徐克前: "《分子生物学检验技术实验指导（第2版）》", 31 July 2007 * |
| 李璞: "《医学遗传学》", 31 January 2004 * |
| 杨娇艳等: "甾醇14α-去甲基化酶(CYP51)的研究进展", 《生物工程学报》 * |
| 王菲: "水稻稻曲病菌遗传多样性及其抗DMI类杀菌剂分子机理的研究", 《中国博士学位论文全文数据库农业科技辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111549163A (en) * | 2020-04-29 | 2020-08-18 | 浙江农林大学 | LAMP-based method for rapidly detecting prochloraz-resistant S312T genotype Fusarium celandi |
| CN111549163B (en) * | 2020-04-29 | 2023-05-05 | 浙江农林大学 | LAMP-based method for rapidly detecting prochloraz-resistant S312T genotype fusarium graminearum |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Williams et al. | The application of species-specific assays based on the polymerase chain reaction to analyse Fusarium crown rot of durum wheat | |
| US7919243B2 (en) | Method for the detection of Fusarium graminearum | |
| Retief et al. | Potential inoculum sources of Phaeomoniella chlamydospora in South African grapevine nurseries | |
| CN105567682B (en) | Transgenic soybean event B4J8049 external source Insert Fragment flanking sequence and its application | |
| Williams et al. | Development and use of an assay based on the polymerase chain reaction that differentiates the pathogens causing spot form and net form of net blotch of barley | |
| Davierwala et al. | Marker assisted selection of bacterial blight resistance genes in rice | |
| CN106048010A (en) | RPA (recombinase polymerase amplification) technology based method for detecting phomopsis helianthi, RPA primers and kit | |
| Mazzaglia et al. | Development of a polymerase chain reaction (PCR) assay for the specific detection of Biscogniauxia mediterranea living as an endophyte in oak tissues | |
| US20050014144A1 (en) | Methods | |
| CN102864220B (en) | Method for identifying nucleotide point mutation of rhizoctonia solani Sdh gene and drug resistance of rhizoctonia solani Sdh gene to thifluzamide | |
| CN109735650B (en) | Four single nucleotide polymorphism-based molecular markers for resisting gummy stem blight of melon and application thereof | |
| CN109797238B (en) | Two molecular markers developed based on gummy stem blight resistance identification and application thereof | |
| CN111876514A (en) | Method for rapidly detecting gibberellin microspecies generated in rice bakanae disease | |
| Siva et al. | Genetic diversity study of important Indian rice genotypes using biochemical and molecular markers | |
| CN106893776A (en) | A kind of method for detecting Ustilaginoidea virens cyp51 gene nucleotides mutational site | |
| JP2002504347A (en) | Detection of fungal pathogens in wheat and barley using the polymerase chain reaction | |
| CN104328205A (en) | Establishment of rapid detection method for grain sclerospora graminicola by LAMP | |
| CN114032334A (en) | Primer group and kit for detecting quinoa phomopsis and detection method thereof | |
| CN102505016B (en) | Transmembrane protein gene triticum asetivum leucine rich repeat 3 (TaLRR3) with leucine rich repeat (LRR) structure domain as well as expression vector and application thereof | |
| CN106978505B (en) | Primer pair for detecting pedunculosis solani and application thereof | |
| CN106011301B (en) | A kind of primer, kit and its method of throughput assays wheat seed main effect dormant gene | |
| Mohamed et al. | Identification of different species of Rhodotorula using Internal Transcribed Spacers | |
| CN113666994B (en) | Ustilago oryzae effector protein and application thereof in disease resistance of rice | |
| CN109777883B (en) | Specific primer of codominant molecular marker of tomato yellow leaf curl virus Ty-2 resistance gene and application thereof | |
| SEUNG-HEE et al. | A genetic marker associated with the A1 mating type locus in Phytophthora infestans |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170627 |