CN111549163B - LAMP-based method for rapidly detecting prochloraz-resistant S312T genotype fusarium graminearum - Google Patents
LAMP-based method for rapidly detecting prochloraz-resistant S312T genotype fusarium graminearum Download PDFInfo
- Publication number
- CN111549163B CN111549163B CN202010356011.9A CN202010356011A CN111549163B CN 111549163 B CN111549163 B CN 111549163B CN 202010356011 A CN202010356011 A CN 202010356011A CN 111549163 B CN111549163 B CN 111549163B
- Authority
- CN
- China
- Prior art keywords
- primer
- reaction
- loop
- isothermal amplification
- mediated isothermal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a loop-mediated isothermal amplification primer for detecting a sterol synthesis inhibitor fungicide S312T genotype bakanae germ, wherein an LAMP primer composition consists of 4 primers of F3, B3, FIP and BIP. The invention screens out primers which have strong specificity and high sensitivity and are suitable for LAMP rapid molecular detection by carrying out LAMP primer mismatch design on 200-300 bp sequences containing 312 site mutation in Fusarium caner Cyp51b genes, thereby establishing a technology for rapid molecular detection of the fusarium caner. The LAMP detection is carried out on the S312T mutant bacteria by adopting the method, the reaction process is simple and convenient (the constant temperature is 64 ℃), the detection period is short (only 60 minutes is needed), the specificity is strong, the sensitivity is high, and the detection result can be observed by naked eyes.
Description
Technical Field
The invention belongs to the technical field of molecular biology detection of plant fungi, relates to a primer group for detecting S312T genotype fusarium graminearum of a sterol demethylating inhibitor fungicide prochloraz by using a loop-mediated isothermal amplification (LAMP) technology and a use method thereof, and belongs to the technical field of plant disease detection, identification, prevention and control and early warning of drug-resistant pathogenic bacteria.
Background
Fusarium vine (Fusraium fujikuroi) can cause bakanae disease in rice and can also infect other plants such as corn. Wherein bakanae disease is a kind of infectious fungus disease, which occurs in all main areas of rice, and can occur from seedling stage to heading stage, and the yield of the field with light disease is reduced by 5-50%. The disease is mainly caused by infection, the seeds carrying pathogenic bacteria are the main infection source of bakanae disease of rice, if the seeds with bacteria are soaked together with healthy seeds, the disease-free seeds can be polluted. When the seeds grow new buds, germs can invade the seedlings through the buds , hyphae gradually spread to the whole plants along with the growth of the seedlings with the germs, and a series of symptoms such as internode elongation, node exposure and leaf sheath exterior, tillering capacity weakening, leaf color yellowing and root system dysplasia appear. Plants with light disease degree can heading earlier, and the spike shape is small but not practical. During the heading period, diseases can also occur, and when serious, the grain ears turn brown and cannot be set, so that the yield of rice is reduced.
Prochloraz belongs to sterol demethylating inhibitors (DMIs), and has obvious prevention effect on diseases of various crops caused by ascomycetes and deuteromycetes. At the end of the 20 th century, two preparations, namely 25% of Baozhen emulsifiable concentrate and 45% of Baozhen aqueous emulsion, are introduced into China, and the carbendazim with serious resistance is used for preventing and treating bakanae disease of rice. By 10 months in 2019, the Chinese pesticide information network data show that 85 active ingredients in the registered 152 bactericides for controlling the bakanae disease of the rice contain prochloraz (http:// www.icama.org.cn/hysj/index. Jhtml). Prochloraz is still the main medicament for preventing and treating bakanae disease of rice so far. Ergosterol is an important component of fungal cell membranes, and inhibition of its synthesis will cause disruption of cell membrane structure and function, ultimately leading to cell death. At the same time, sterols act as precursors of some steroid hormones, playing an important role in the reproduction of fungi, and changes in their content and composition will affect the reproduction of fungi. Sterol biosynthesis inhibitors (sterol biosynthesis inhibitors, SBIs) are capable of inhibiting the biosynthesis of fungal ergosterols, and the class of sterol 14α -demethylase inhibitors (14α -dememylation inhibitors, DMIs) in SBIs are currently the most widely used class of bactericides in SBIs. In 1970, DMI compounds began to be applied to agricultural disease control, and the drug resistance of field DMIs bactericides was continuously reported. The mechanism of resistance of Fusarium and other pathogens to sterilants, such as point mutation of the Cyp51 gene, over-expression of the Cyp51 gene, and the role of transport proteins in drug resistance, are reported in succession. The detection of the drug resistance of plant pathogenic bacteria can provide an important reference basis for the epidemic early warning of the drug resistance of plant diseases and the treatment of the drug resistance. The traditional method for detecting or monitoring the resistance of the bactericide mainly comprises the steps of separating and culturing pathogenic bacteria, then culturing the pathogenic bacteria on a drug-containing culture medium, and identifying whether the pathogenic bacteria are drug-resistant strains according to the inhibition effect of the medicament on the growth of hyphae, wherein the method has a longer detection period from separation to identification for up to 1 week or even several weeks, and the pathogenic bacteria are polluted by mixed bacteria in the culturing process of the pathogenic bacteria, so that errors are caused to test results; meanwhile, a large amount of human resources are needed to be input, and the detection cost is increased. The polymerase chain reaction (Polymerase Chain Reaction, PCR) is also the most common method for detecting drug-resistant mutants by in vitro rapid amplification of specific genes or DNA sequences, and has high sensitivity and strong specificity, but the detection requires expensive experimental instruments and complicated experimental procedures, and has long detection time and high detection cost, and cannot meet the requirements of economy, high efficiency and rapid detection.
Loop-mediated isothermal amplification (LAMP) is a novel nucleic acid amplification technology invented by Japanese Rong Yan, inc. because of the advantages of simple and rapid amplification operation, high specificity, low cost, etc., it becomes a novel nucleic acid amplification technology capable of replacing PCR. The method designs 4 pairs of specific primers aiming at 6 regions of a target gene, and causes self-circulation strand displacement reaction under the action of Bst large-fragment polymerase, so that target DNA can be synthesized in a large quantity within 60min at 60-65 ℃. The detection of amplified products is generally carried out by visual observation with fluorescent dyes, agarose gel electrophoresis, turbidity observation and the like. Because the LAMP amplification process depends on identifying 6 independent areas of a target sequence, the reaction specificity is strong, the nucleic acid amplification process is carried out under the constant temperature condition, the common water bath or an isothermal thermos can meet the reaction requirement, the detection cost is reduced, and the required time is short. The method has the characteristics of simple, quick, efficient, economical and the like, so that the method has extremely wide application prospect.
The current detection method of the prochloraz-resistant S312T genotype fusarium graminearum comprises the following steps: the strain is isolated from the diseased plant body, cultured, extracted and subjected to genome DNA sequencing to identify whether the strain is the prochloraz-resistant S312T genotype. The method can be carried out by specific instruments such as a PCR instrument and a gene sequencer.
Disclosure of Invention
The invention aims to solve the technical problem of providing a loop-mediated isothermal amplification method for detecting S312T genotype fusarium graminearum serving as an anti-sterol demethylating inhibitor fungicide prochloraz, and a primer and a kit used by the same.
In order to solve the technical problems, the invention provides an LAMP primer composition for detecting S312T genotype of a sterol-demethylating inhibitor fungicide prochloraz of fusarium graminearum, which consists of four primers, namely an upstream outer primer, a downstream outer primer and an upstream inner primer, wherein the sequences of the primers are as follows:
upstream outer primer (F3): 5 '-TGATCATGAGGTCGCCCATA-3';
downstream outer primer (B3): 5 '-TTGGCAAGGTCGTCGTAAG-3';
upstream inner primer (FIP): 5 '-GACGGAGCATGATCCAAGAGCTTCATGGCTGGCCAGCACG-3';
downstream inner primer (FIP): 5 '-ACCCTCACATCATGGAGGAGCTTCAAGGGAGGCAAATCAGC-3'.
As the improvement of the loop-mediated isothermal amplification primer for detecting the sterides synthesis inhibitor type bactericide S312T genotype bakanae germ: the primer group is composed of a primer group containing a mutant region of a site 312 of a bakanae germ Cyp51B gene and a mismatched base design, and the loop-mediated isothermal amplification reaction is used for detecting bakanae germ of an anti-sterol synthesis inhibitor type bactericide S312T genotype.
The invention also provides application of the LAMP primer composition in detecting S312T genotype fusarium graminearum of the sterol demethylating inhibitor fungicide prochloraz.
The invention also provides application of the LAMP primer composition in a fusarium graminearum LAMP kit for detecting the S312T genotype of the sterol demethylating inhibitor fungicide prochloraz. The invention also provides a LAMP kit for detecting S312T genotype of the sterol demethylating inhibitor fungicide prochloraz, which comprises the LAMP primer composition.
In the LAMP kit of the invention, the final concentration of the primer combination is as follows: 0.8. Mu.M of forward primer FIP, 0.8. Mu.M of reverse primer BIP, 0.3. Mu.M of forward primer F3, 0.3. Mu.M of reverse primer B3. The kit further comprises a premix of the loop-mediated isothermal amplification reaction: 10X ThermoPol Reaction Buffer, 1mM dNTPs, 4mM MgCl 2 0.6M betaine, 150. Mu.M hydroxynaphthol blue (HNB), 8U/. Mu.L Bst DNA polymerase, ddH 2 O。
The invention also provides a method for detecting the synthesis inhibition of the sterolA loop-mediated isothermal amplification method of bakanae germ of S312T genotype of a disinfectant is characterized in that 24 mu L of detection solution is added with 1 mu L of DNA template to be detected to form a 25 mu L detection reaction system. The 25. Mu.L reaction system contains 8U/. Mu.L Bst DNA polymerase 0.5. Mu.L (4U), 10X ThermoPol Buffer 2.5. Mu.L, 10. Mu.M FIP 2.0. Mu.L, 10. Mu.M BIP 2.0. Mu.L, 10. Mu. M F3 3.0.75. Mu.L, 10. Mu. M B3.3.75. Mu.L, 25mM MgCl 2 4.0. Mu.L, 10mM dNTPs 2.5. Mu.L, 5M betaine 3.0. Mu.L, 3.75mM hydroxynaphthol blue (HNB) 1. Mu. L, DNA template 1. Mu.L, double distilled water make up to 25. Mu.L.
The invention also provides a loop-mediated isothermal amplification method for detecting S312T genotype of the sterol demethylating inhibitor fungicide prochloraz, which is used for carrying out LAMP amplification reaction by using the 25 mu L detection reaction system. The LAMP amplification reaction procedure was: 64 ℃ for 60min. Extinguishing fire at 80deg.C for 10min.
The analysis and judgment method of the amplification result comprises the following steps:
1) Adding dye hydroxynaphthol blue (HNB) as a reaction indicator before amplification, taking color change of the hydroxynaphthol blue (HNB) as a result judgment standard, and after the reaction is finished, observing that the color result is positive by sky blue judgment, namely, displaying that S312T genotype fusarium graminearum of prochloraz serving as an anti-sterol demethylating inhibitor type bactericide is detected, and displaying that the blue purple judgment is negative, namely, displaying that a detection strain is sensitive or the detection limit of contained bacteria is not reached.
2) Taking 5 mu L of amplified product, detecting by using 2% agarose gel electrophoresis, judging positive if trapezoidal bands appear, namely, detecting S312T genotype fusarium graminearum of prochloraz serving as an anti-sterol demethylating inhibitor, and judging negative if no amplified bands exist, namely, judging that the detected strain is sensitive or the detection limit of contained bacteria is not reached.
The detection limit corresponds to a concentration of 0.01 ng/. Mu.L.
The technical scheme of the invention is as follows:
1. elucidation of the mechanism of drug resistance
The inventor is located in a laboratory and found out that the S312T point mutation of the Cyp51b appears in the bacteria resistant to prochloraz by sequencing the Cyp51 genes with different resistance levels of bakanae disease germ in Zhejiang province, and the Cyp51a does not find mutation. Site-directed mutagenesis studies on the 312 th codon of the Cyp51 gene of prochloraz-resistant and sensitive bacteria were performed in 2018, respectively, and it is proved that the S312T point mutation of the Cyp51b gene is the cause of prochloraz resistance of fusarium graminearum, namely, the molecular mechanism of prochloraz resistance of fusarium graminearum is that the 312 th codon of the Cyp51b gene is mutated from TCT to ACT (S312T point mutation).
2. Primer design
The Primer screening is a key factor of LAMP detection, cyp51b genome sequence is firstly downloaded from Fusarium vine caner database for comparison and analysis, and in a 200-300 bp sequence containing mutation sites, a mutant LAMP Primer is designed by utilizing online software Primer Explore V5 (http:// Primer Explorer. Jp/e/V5), and then the 3' -end base of a forward Primer FIP is mismatched according to the mutation sites. Finally, 2 outer primers (F3 and B3) and 2 inner primers (FIP and BIP) were obtained. The primer information is shown in Table 1.
Table 1, primer sequence information:
| primer name | Sequence 5'-3' |
| Fj-F3 | TGATCATGAGGTCGCCCATA |
| Fj-B3 | TTGGCAAGGTCGTCGTAAG |
| Fj-FIP | GACGGAGCATGATCCAAGAGCTTCATGGCTGGCCAGCACG |
| Fj-BIP | ACCCTCACATCATGGAGGAGCTTCAAGGGAGGCAAATCAGC |
3. Specific detection of primers
For detection of primer specificity, the primer was found to have specificity for S312T mutant Fusarium canescens by using S312T mutant pathogen DNA as positive control, DNA of unmutated sensitive pathogen (F.fujikurio), undaria pinnatifida (Ustilaginoidea virens) and the like as negative control, and double distilled water as blank control.
4. The LAMP reaction system is as follows: 25. Mu.L of Bst DNA polymerase 0.5. Mu.L (4U), 10 XThermopol Buffer 2.5. Mu.L, FIP primer 2.0. Mu.L, BIP primer 2.0. Mu.L, F3 primer 0.75. Mu.L, B3 primer 0.75. Mu.L, mgCl at 25.0mM at 8U/. Mu.L 2 4.0. Mu.L, 10.0mM dNTP 2.5. Mu.L, 5.0M betaine 3.0. Mu.L, 3.75mM hydroxynaphthol blue (HNB) 1. Mu. L, DNA template 1. Mu.L, double distilled water make up to 25. Mu.L; the amplification conditions were incubation at 64℃for 60min and inactivation at 80℃for 10min.
After the completion of the reaction, the specificity of the primers was determined by agarose gel electrophoresis and HNB dye-development, respectively. Agarose gel electrophoresis: taking 5 mu L of LAMP amplification products, detecting by using 2% agarose gel electrophoresis, staining by EB, observing in a gel imaging system, wherein the occurrence of characteristic ladder-shaped bands is positive, and the non-occurrence of the bands is negative; HNB dye color development method: the color of the LAMP reaction mixture was visually observed to give a sky blue positive reaction and a blue-violet negative reaction.
5. Determination of DNA concentration detection limits
The extracted S312T mutant bakanae germ genome DNA was diluted to 7 concentrations (100 ng/. Mu.L to 0.0001 ng/. Mu.L) by 10-fold gradient after concentration measurement with Nanodrop 1000, and used for detection of LAMP amplification sensitivity. The LAMP reaction system and the amplification conditions are the same as above.
After amplification, 5. Mu.L of LAMP amplification concentration gradient product was analyzed by electrophoresis on a 2% agarose gel, and after staining with ethidium bromide, the results were observed using a gel imaging system.
6. Optimization of the reaction procedure
The aim is to establish the LAMP optimal reaction temperature capable of detecting S312T mutant Fusarium caner. The primer combination is utilized to form detection solution with the reaction premix, 1 mu L of germ DNA template is added, the reaction temperature is respectively set to 59 ℃,60 ℃, 61 ℃, 62 ℃, 63 ℃, 64 ℃, 65 ℃ and 66 ℃, after the amplification reaction is finished, the color change of the reaction tube is observed, and further, 2% agarose gel electrophoresis detection is used as verification.
The reaction results showed (FIG. 2) that the color change of the reaction tube was most evident and the electrophoresis LAMP band was most clear at a reaction temperature of 64 ℃.
The purpose is to establish the LAMP optimal reaction time for detecting S312T mutant bacteria. The primer combination is utilized to form detection liquid with the reaction premix, 1 mu L of rice bakanae germ DNA template is added, the reaction time is set to 10min, 20min, 30min, 40min, 50min, 60min, 70min and 80min, after the amplification reaction is finished, the color change of the reaction tube is observed, and further, 2% agarose gel electrophoresis detection is used as verification.
The reaction results showed (FIG. 3) that the color change of the reaction tube was remarkable and the electrophoresis LAMP band was clear when the reaction time reached 60min and longer, in order to save the detection time, namely, 60min was the amplification time.
According to the optimized result of the reaction program, the reaction program in the invention is 64 ℃ for 60min.
The invention screens out primers which have strong specificity and high sensitivity and are suitable for LAMP rapid molecular detection by carrying out LAMP primer mismatch design on 200-300 bp sequences containing 312 site mutation in Fusarium caner Cyp51b genes, thereby establishing a technology for rapid molecular detection of the fusarium caner. According to the invention, the specific LAMP primer is designed and screened by the mismatch of the Cyp51b gene, and the LAMP detection is carried out on the S312T mutant bacteria by optimizing a rapid molecular detection technology system and reaction conditions, so that the detection process is simple (constant temperature of 64 ℃), the detection period is short (only 60 minutes is needed), the specificity is strong, and the sensitivity is high, and the detection result can be observed by naked eyes.
The invention has the following technical advantages:
1) The practicability is good. The traditional method for detecting the resistance of the bactericide mainly comprises the steps of separating and culturing pathogenic bacteria, then culturing the pathogenic bacteria on a medicament-containing culture medium, and identifying whether the pathogenic bacteria are drug-resistant strains according to the inhibiting effect of the medicament on the growth of hyphae. The gel electrophoresis is carried out on the product by the common PCR reaction, the result can be judged by Ethidium Bromide (EB) dyeing and observing under a purple light lamp, the detection time is long, the detection cost is high, and the requirements of economical and efficient detection cannot be met. The LAMP reaction is only carried out at a constant temperature (64 ℃), and the result can be directly judged by naked eyes under normal light after the reaction is finished, so that the drug resistance of pathogenic bacteria can be rapidly detected, and the application value of the LAMP reaction in field detection is increased.
2) And amplifying at constant temperature. Unlike PCR process, the heat circulation is not necessary, and thus the dependency on heat circulation instrument is eliminated, and the LAMP reaction can be completed only by stable heat source, such as constant temperature water bath, without expensive instrument and equipment, thus being convenient for popularization and application in basic agricultural production units. LAMP can react under a constant heat source because betaine is added into the LAMP reaction liquid, so that double-stranded DNA is in melting dynamic balance, and amplification is realized under the action of Bst DNA polymerase.
The invention only needs an isothermal environment at 64 ℃.
3) And the accuracy is high. The traditional germ drug resistance detection technology is to culture and identify on a drug-containing culture medium, and the identification method is long in time consumption and easy to be interfered by a plurality of factors such as human beings, environment and the like. The LAMP reaction specifically recognizes 6 independent areas on the target sequence through 4 primers, and compared with 2 independent areas of the target sequence recognized by common PCR primers, the specificity and the sensitivity are both obviously improved.
The minimum detection concentration of the invention is 0.01 ng/. Mu.L.
Drawings
The following describes the embodiments of the present invention in further detail with reference to the accompanying drawings.
FIG. 1 is a comparative diagram of primer specificity assays;
a: LAMP color development change plot; b: LAMP agarose gel electrophoresis; m represents DL2000 DNA Marker;1. sterile water, 2. Sensitive fusarium graminearum, 3. Sensitive fusarium graminearum, 4. Ustilaginoidea virens, 5.S312T mutant fusarium graminearum, 6.S312T mutant fusarium graminearum, 7.S312T mutant fusarium graminearum, 8.S312T mutant fusarium graminearum.
In the color chart, 1-4 in FIG. 1a are bluish violet, 5-8 sky blue.
FIG. 2 is a reaction temperature optimization diagram;
a: LAMP color development change plot; b: LAMP agarose gel electrophoresis; m represents DL2000 DNA Marker;1:59 ℃, 2:60 ℃, 3:61 ℃, 4:62 ℃, 5:63 ℃, 6:64 ℃, 7:65 ℃, 8:66 ℃.
In the color chart, 1-2 in FIG. 2a are bluish violet, 3-8 sky blue.
FIG. 3 is a reaction time optimization diagram;
a: LAMP color development change plot; b: agarose gel electrophoresis; m represents DL2000 DNA Marker;1:10min, 2:20min, 3:30min, 4:40min, 5:50min, 6:60min, 7:70min, 8:80min.
In the color chart, 1-3 in FIG. 3a are bluish violet, 4-8 sky blue.
FIG. 4 is a graph of a reaction detection limit;
a: LAMP color development change plot; b: LAMP agarose gel electrophoresis; m represents DL2000 DNA Marker;1: ddH2O and 2-8 respectively represent the DNA concentration 2 of S312T-type Fusarium caner strains: 0.0001 ng/. Mu.L, 3:0.001 ng/. Mu.L, 4:0.01 ng/. Mu.L, 5:0.1 ng/. Mu.L, 6:1 ng/. Mu.L, 7:10 ng/. Mu.L, 8:100 ng/. Mu.L.
In the color chart, 1-3 in FIG. 4a are bluish violet, 4-8 sky blue.
FIG. 5 is a graph showing detection of resistant Fusarium caner strains from rice seeds and seedlings
a: LAMP color development change plot; b: agarose gel electrophoresis;
m represents DL2000 DNA Marker;1-2: rice seeds (bakanae germ sensitive bacteria inoculation), 3-4: rice seeds (S312T mutant bakanae disease inoculation), 5-6: rice seedlings (bakanae germ sensitive bacteria inoculation +10 mug/mL prochloraz), 7-8: rice seedlings (S312T mutant bakanae disease inoculation +10. Mu.g/mL prochloraz);
in the color diagram, 1, 2, 5, 6 in fig. 5a are bluish violet, 3, 4, 7, 8 are sky blue;
c: a growth state diagram;
s: rice seedlings (bakanae germ sensitive bacteria inoculation +10 mug/mL prochloraz); r: rice seedlings (S312T mutant bakanae disease inoculation +10. Mu.g/mL prochloraz).
Detailed Description
The invention is further described below by way of examples and with reference to the accompanying drawings, which do not constitute a limitation on the scope of the invention in any way, but are only illustrative.
The main reagents and instruments used in the following examples were Bst DNA polymerase, dNTP (Vazyme), betaine, DEPC water, molecular mass standard DNA marker (TaKaRa Bioengineering Co., ltd.), mgCl 2 And a fungus genome DNA rapid extraction kit (Biotechnology Co., ltd.), an eppendorf ordinary PCR amplification instrument and a DK-8D type electric heating constant temperature water bath kettle of Shanghai Jing Hongxiao laboratory instrument factory.
Example 1: sensitivity detection of primers
1. DNA of the S312T mutant Fusarium caner genome was extracted, and the concentration of the DNA solution was measured to be 200 ng/. Mu.L. The DNA solution was diluted to a gradient of 0.0001 ng/. Mu.L, 0.001 ng/. Mu.L, 0.01 ng/. Mu.L, 0.1 ng/. Mu.L, 1 ng/. Mu.L, 10 ng/. Mu.L, 100 ng/. Mu.L, and the following reaction systems were prepared as DNA templates:
25. Mu.L of reaction system: 8U/. Mu.L Bst DNA polymerase 0.5. Mu.L (4U), 10 XThermoPol Buffer 2.5. Mu.L, 10. Mu.M FIP 2.0. Mu.L, 10. Mu.M BIP 2.0. Mu.L, 10. Mu. M F3 3.75. Mu.L, 10. Mu. M B3 3.75. Mu.L, 25mM MgCl 2 4.0. Mu.L, 10mM dNTPs 2.5. Mu.L, 5M betaine 3.0. Mu.L, 3.75mM hydroxynaphthol blue (HNB) 1. Mu. L, DNA template 1. Mu.L, and finally two distilled water was used to make up to 25. Mu.L each.
The reaction system is prepared before LAMP amplification reaction. The reaction system was bluish violet.
1. Mu.L of double distilled water was used as a blank to replace 1. Mu.L of the DNA template in the 25. Mu.L reaction system,
the following primer combinations were used for the experiments:
upstream outer primer (F3): 5 '-TGATCATGAGGTCGCCCATA-3';
downstream outer primer (B3): 5 '-TTGGCAAGGTCGTCGTAAG-3';
upstream inner primer (FIP): 5 '-GACGGAGCATGATCCAAGAGCTTCATGGCTGGCCAGCACG-3';
downstream inner primer (FIP): 5 '-ACCCTCACATCATGGAGGAGCTTCAAGGGAGGCAAATCAGC-3'.
The LAMP amplification reaction procedure used was: amplifying at 64 ℃ for 60min, and inactivating at 80 ℃ for 10min; the LAMP reaction mixture (LAMP amplification product) was obtained.
2. After the completion of the reaction, the specificity of the primers was determined by agarose gel electrophoresis and HNB dye-development, respectively.
Agarose gel electrophoresis: taking 5 mu L of LAMP reaction mixed solution (LAMP amplification product), detecting by using 2% agarose gel electrophoresis, staining by using EB, observing in a gel imaging system, wherein a characteristic ladder-shaped strip appears as positive, namely, the detection of sterol synthesis inhibitor drug-resistant S312T mutant bakanae disease bacteria is shown, and judging as negative if the strip does not appear, namely, the detection strain is sensitive bakanae disease bacteria, or the content of the bakanae disease bacteria in the rice does not reach the lowest detection concentration of 0.01 ng/mu L.
HNB dye color development method: the color of the LAMP reaction mixture is observed visually whether to change relative to the original reaction system, if the LAMP reaction mixture becomes sky blue, the LAMP reaction mixture is positive, and if the LAMP reaction mixture is unchanged, the LAMP reaction mixture is blue-purple, and the LAMP reaction mixture is negative.
The results are shown in FIG. 4, and are specifically as follows:
after completion of the reaction, the reaction results were positive at the DNA template concentrations of 0.01 ng/. Mu.L, 0.1 ng/. Mu.L, 1 ng/. Mu.L, 10 ng/. Mu.L, 100 ng/. Mu.L, and the color of the reaction tube was changed from bluish purple to sky blue before and after the reaction, and the specific bands were detected by 2% agarose gel electrophoresis. At concentrations below 0.01 ng/. Mu.L, the reaction tube became negative with no change in color, and no specific bands were detected by 2% agarose gel electrophoresis.
The results showed that the lowest concentration detected for S312T mutant Fusarium caner DNA was 0.01 ng/. Mu.L.
Example 2: specificity analysis of primers
Extracting sensitive fusarium graminearum and ustilaginoidea virens genome DNA as negative control, S312T mutant fusarium graminearum genome DNA as positive control, and double distilled water as blank control. The reaction system, the primer combination used and the detection method are the same as in example 1.
That is, the remainder was identical to example 1, except that the sensitive Fusarium oxysporum DNA, the Ustilago virens genomic DNA, and the S312T mutant Fusarium oxysporum genomic DNA were used as templates (concentration: 0.01 ng/. Mu.L), respectively.
The test results are shown in FIG. 1: the templates except S312T mutant Fusarium caner showed negative, the color of the reaction solution in the reaction tube did not change, and no specific band appeared by 2% agarose gel electrophoresis detection. The loop-mediated isothermal amplification system formed by the primer combination can detect S312T mutant fusarium graminearum and has specificity.
Example 3: detection of drug resistant strains in seeds and seedlings
(1) Preparation of Rice seed samples sensitive Fusarium vine caner and S312T mutant Fusarium vine caner with diameter of 5mm were inoculated on the colony edge of CM medium and cultured in darkness for 5d at 28℃and 3 bacterial dishes and 20 sterile rice seeds (seeds were sterilized in a water bath at 60℃for 15 min) were placed in PS (100 mL) and shake cultured at 150rpm, 28℃for 12h of light-dark cycle, respectively. After 3 d. Taking out the seeds, wrapping with sterilized paper, and naturally drying at 25deg.C. Respectively taking two seeds to extract genome DNA for detecting resistant strains in rice seeds.
(2) Each of the sample genomes thus extracted was used as a template (concentration: 0.01 ng/. Mu.L), and the remainder was identical to example 1.
The results obtained were:
the detection results of 2 rice seeds corresponding to the sensitive fusarium graminearum are as follows: and the reaction tube is negative, the color of the reaction liquid in the reaction tube is not changed, and no specific band appears through 2% agarose gel electrophoresis detection.
The detection results of 2 rice seeds corresponding to S312T mutant Fusarium caner bacteria are as follows: the reaction tube shows positive, the color of the reaction liquid in the reaction tube changes to sky blue, and specific bands appear after detection by 2% agarose gel electrophoresis.
(3) One part of seed which is not dried after shaking culture is respectively taken and cultured in a rice nutrient solution, 10 mu g/mL prochloraz is added, and DNA is extracted by cutting internode after shaking culture for 12h and 15d under the same condition. 15 germinated millet with consistent growth vigor are selected and sowed on a plug in the culture solution, the culture solution is irradiated for 12 hours at 28 ℃, the culture solution is dark for 12 hours at 28 ℃, and the relative humidity is 70-80%. After seedling cultivation for about 15d and the phenomena of overgrowth and rooting, the internode extracted DNA is sheared for LAMP detection of the resistant strain in the rice seedling.
The results obtained were:
the DNA results of seedlings corresponding to sensitive fusarium graminearum were: and the reaction tube is negative, the color of the reaction liquid in the reaction tube is not changed, and no specific band appears through 2% agarose gel electrophoresis detection.
The DNA results corresponding to seedlings of S312T mutant fusarium graminearum were: the reaction tube shows positive, the color of the reaction liquid in the reaction tube changes to sky blue, and specific bands appear after detection by 2% agarose gel electrophoresis.
Thus, the following summary can be drawn: the LAMP reaction did not detect seeds and seedlings with the susceptible strain, and seeds and seedlings with S312T mutant bakanae disease were detected (FIG. 5).
Comparative examples 1 to 1,
The assays were performed using the following primer combinations:
upstream outer primer (F3): 5 '-TGATCATGAGGTCGCCCATA-3';
downstream outer primer (B3): 5 '-TTGGCAAGGTCGTCGTAAG-3';
upstream inner primer (FIP-1): 5 '-GACGGAGCATGATCCAAGAGCTTCATGGCTGGCCAGCACC-3';
downstream outer primer (BIP): 5 '-ACCCTCACATCATGGAGGAGCTTCAAGGGAGGCAAATCAGC-3'.
The reaction system was used in an amount of 25. Mu.L, which was prepared from the following componentsThe method comprises the following steps: 8U/. Mu.L Bst DNA polymerase 0.5. Mu.L (4U), 10 XThermoPol Buffer 2.5. Mu.L, 10. Mu.M FIP-1.0. Mu.L, 10. Mu.M BIP 2.0. Mu.L, 10. Mu. M F3 0.75. Mu.L, 10. Mu. M B3 0.75. Mu.L, 25mM MgCl 2 4.0. Mu.L, 10mM dNTPs 2.5. Mu.L, 5M betaine 3.0. Mu.L, 3.75mM hydroxynaphthol blue (HNB) 1. Mu.L, 1. Mu.L was added with 1. Mu.L of double distilled water to 25. Mu.L using DNA solutions (DNA of S312T mutant Fusarium caner genome) at concentrations of 1 ng/. Mu.L, 10 ng/. Mu.L, 100 ng/. Mu.L, respectively, as a template.
The test results are all negative, the color of the reaction liquid in the reaction tube is not changed, and no specific band appears through the detection of 2% agarose gel electrophoresis. The loop-mediated isothermal amplification system formed by the primer combination can not effectively detect S312T mutant fusarium graminearum, and even if the concentration of the DNA template is increased to 100 ng/. Mu.L, the S312T mutant fusarium graminearum can not be effectively distinguished.
Comparative examples 1 to 2,
The assays were performed using the following primer combinations:
upstream outer primer (F3): 5 '-TGATCATGAGGTCGCCCATA-3';
downstream outer primer (B3): 5 '-TTGGCAAGGTCGTCGTAAG-3';
upstream inner primer (FIP-2): 5 '-GACGGAGCATGATCCAAGAGCTTCATGGCTGGCCAGCACA-3';
downstream outer primer (BIP): 5 '-ACCCTCACATCATGGAGGAGCTTCAAGGGAGGCAAATCAGC-3'.
The reaction system was referred to comparative examples 1-1.
The test results are all negative, the color of the reaction liquid in the reaction tube is not changed, and no specific band appears through the detection of 2% agarose gel electrophoresis. The loop-mediated isothermal amplification system formed by the primer combination can not effectively detect S312T mutant fusarium graminearum, and even if the concentration of the DNA template is increased to 100 ng/. Mu.L, the S312T mutant fusarium graminearum can not be effectively distinguished.
Comparative example 2,
The following primer combinations were used to conduct primer specificity assays as described in example 2:
upstream outer primer (F3): 5 '-TGATCATGAGGTCGCCCATA-3';
downstream outer primer (B3): 5 '-TTGGCAAGGTCGTCGTAAG-3';
the upstream inner primer (FIP-3) 5 '-GACGGAGCATGATCCAAGAGCTTCATGGCTGGCCAGCACT-3',
downstream outer primer (BIP): 5 '-ACCCTCACATCATGGAGGAGCTTCAAGGGAGGCAAATCAGC-3'.
The result shows that: the sensitive fusarium graminearum DNA, the ustilaginoidea virens genome DNA and the S312T mutant fusarium graminearum genome DNA have the same result, are negative, have no change in the color of the reaction liquid in the reaction tube, and have no specific band after detection by 2% agarose gel electrophoresis. Even if the concentration of the DNA template is increased to 100 ng/. Mu.L, it is still not effectively discriminated.
It should be noted that: the upstream inner Primer (FIP-3) is directly designed by utilizing online software Primer Explore V5 (http:// Primer Explorer. Jp/e/V5), and can not be specifically detected after the test, so that the invention introduces the 3' -end base of the mutation site mismatched forward outer Primer FIP, namely, the upstream inner Primer (FIP) is mismatched from ACT to ACC, ACA and ACG, and finally the test finds that only the upstream inner Primer (FIP) of the invention is 5' -GACGGAGCATGATCCAAGAGCTTCATGGCTGGCCAGCACG-3 ', and S312T mutant fusarium bingo can be specifically detected.
Finally, it should also be noted that the above list is merely a few specific embodiments of the present invention. Obviously, the invention is not limited to the above embodiments, but many variations are possible. All modifications directly derived or suggested to one skilled in the art from the present disclosure should be considered as being within the scope of the present invention.
Claims (9)
1. The loop-mediated isothermal amplification primer for detecting the sterides synthesis inhibitor type bactericide S312T genotype bakanae germ is characterized in that: the loop-mediated isothermal amplification primer composition consists of the following 4 primers:
F3：5’ - TGATCATGAGGTCGCCCATA -3’
B3：5’ - TTGGCAAGGTCGTCGTAAG -3’
FIP：5’ - GACGGAGCATGATCCAAGAGCTTCATGGCTGGCCAGCACG -3’
BIP：5’ - ACCCTCACATCATGGAGGAGCTTCAAGGGAGGCAAATCAGC -3’。
2. the loop-mediated isothermal amplification primer for detecting the anti-sterol synthesis inhibitor type bactericide S312T genotype bakanae bacteria according to claim 1, wherein the primer is characterized in that:
from the bacteria containing bakanae diseaseCyp51BThe primer group designed by mismatched bases consists of a gene 312 locus mutation region, and the loop-mediated isothermal amplification reaction is used for detecting bakanae disease germ of the sterides synthesis inhibitor type bactericide S312T genotype.
3. The utility model provides a bakanae germ loop-mediated isothermal amplification kit for detecting steriod synthesis inhibitor class germicide S312T genotype which characterized in that: a loop-mediated isothermal amplification primer composition comprising the composition of claim 1.
4. A kit according to claim 3, wherein: the final concentration of primer combination is: 0.8 mu.M of forward primer FIP, 0.8. Mu.M of reverse primer BIP, 0.3. Mu.M of forward primer F3, 0.3. Mu.M of reverse primer B3.
5. The kit of claim 3 or 4, wherein: the kit further comprises a premix of the loop-mediated isothermal amplification reaction: 10X ThermoPol Reaction Buffer, 1mM dNTPs, 4mM MgCl 2 0.6M betaine, 150. Mu.M hydroxynaphthol blue, 8U/. Mu.LBst DNA polymerase, ddH 2 O。
6. The reaction system of the loop-mediated isothermal amplification method for detecting the bakanae germ of the S312T genotype of the sterides synthesis inhibitor is characterized in that: use of the primers F3, B3, FIP and BIP according to claim 1;
25. the μl reaction system consisted of the following components: 8U/. Mu.LBst DNA polymerase 0.5. Mu.L, 10 XThermoPol Buffer 2.5. Mu.L, 10. Mu.M FIP 2.0μL、10 μM BIP 2.0 μL、10 μM F3 0.75 μL、10 μM B3 0.75 μL、25 mM MgCl 2 4.0. Mu.L, 10mM dNTPs 2.5. Mu.L, 5M betaine 3.0. Mu.L, 3.75mM hydroxynaphthol blue 1. Mu. L, DNA template 1. Mu.L, double distilled water make up to 25. Mu.L.
7. A loop-mediated isothermal amplification method according to claim 6, wherein:
carrying out loop-mediated isothermal amplification reaction by using the reaction system, and selecting any one of the following methods:
adding dye hydroxynaphthol blue as a reaction indicator before amplification, taking color change of the hydroxynaphthol blue as a result judgment standard, and after the reaction is finished, judging that the sky blue is positive and the blue-violet is negative;
and secondly, taking 5 mu L of amplified products, detecting by using 2% agarose gel electrophoresis, and judging positive if trapezoidal bands appear and judging negative if no amplified bands appear.
8. The loop-mediated isothermal amplification method according to claim 7, wherein:
positive, namely detecting sterol synthesis inhibitor drug-resistant S312T mutant bakanae disease bacteria;
negative, the detected strain is sensitive bakanae disease germ, or the content of the bakanae disease germ in the rice does not reach the lowest detection concentration of 0.01 ng/mu L.
9. The loop-mediated isothermal amplification method according to claim 7 or 8, wherein the loop-mediated isothermal amplification reaction procedure is as follows: amplifying at 64 ℃ for 60min, and extinguishing at 80 ℃ for 10min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010356011.9A CN111549163B (en) | 2020-04-29 | 2020-04-29 | LAMP-based method for rapidly detecting prochloraz-resistant S312T genotype fusarium graminearum |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010356011.9A CN111549163B (en) | 2020-04-29 | 2020-04-29 | LAMP-based method for rapidly detecting prochloraz-resistant S312T genotype fusarium graminearum |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111549163A CN111549163A (en) | 2020-08-18 |
| CN111549163B true CN111549163B (en) | 2023-05-05 |
Family
ID=71996431
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010356011.9A Active CN111549163B (en) | 2020-04-29 | 2020-04-29 | LAMP-based method for rapidly detecting prochloraz-resistant S312T genotype fusarium graminearum |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111549163B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116397047A (en) * | 2023-05-10 | 2023-07-07 | 三亚中国农业科学院国家南繁研究院 | Primer combination for detecting B-I280V mutation of corynespora polymorpha |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106350588A (en) * | 2016-08-30 | 2017-01-25 | 浙江农林大学 | Device for rapidly detecting benzimidazole fungicide-resistant botrytis cinerea Pers. based on LAMP |
| CN106893776A (en) * | 2017-02-20 | 2017-06-27 | 福建省农业科学院植物保护研究所 | A kind of method for detecting Ustilaginoidea virens cyp51 gene nucleotides mutational site |
| CN107022624A (en) * | 2017-05-08 | 2017-08-08 | 浙江农林大学 | The LAMP methods and kit of quick detection bakanae disease of rice germ from seed rice |
| CN110982922A (en) * | 2019-12-20 | 2020-04-10 | 浙江大学 | Primer composition and method for rapidly detecting rice bakanae disease pathogenic bacteria fusarium granatum based on LAMP |
-
2020
- 2020-04-29 CN CN202010356011.9A patent/CN111549163B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106350588A (en) * | 2016-08-30 | 2017-01-25 | 浙江农林大学 | Device for rapidly detecting benzimidazole fungicide-resistant botrytis cinerea Pers. based on LAMP |
| CN106893776A (en) * | 2017-02-20 | 2017-06-27 | 福建省农业科学院植物保护研究所 | A kind of method for detecting Ustilaginoidea virens cyp51 gene nucleotides mutational site |
| CN107022624A (en) * | 2017-05-08 | 2017-08-08 | 浙江农林大学 | The LAMP methods and kit of quick detection bakanae disease of rice germ from seed rice |
| CN110982922A (en) * | 2019-12-20 | 2020-04-10 | 浙江大学 | Primer composition and method for rapidly detecting rice bakanae disease pathogenic bacteria fusarium granatum based on LAMP |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111549163A (en) | 2020-08-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Clark et al. | Dikaryons of the basidiomycete fungus Schizophyllum commune: evolution in long-term culture | |
| CN107022624B (en) | LAMP method and kit for rapidly detecting bakanae disease bacteria of rice from rice seeds | |
| CN108085410B (en) | Seedling-stage strawberry anthracnose latent infection and rapid detection method for application of anthracnose latent infection | |
| Gayoso et al. | Assessment of real-time PCR as a method for determining the presence of Verticillium dahliae in different Solanaceae cultivars | |
| Silva et al. | Molecular, physiological and pathological characterization of Corynespora leaf spot fungi from rubber plantations in Sri Lanka | |
| KR101509076B1 (en) | Composition comprising DNA marker for selecting rice variety containing bakanae disease-resistant BK1 gene and method of selecting rice variety resistant to bakanae disease using the DNA marker | |
| Ravnskov et al. | Mycorrhiza induced tolerance in Cucumis sativus against root rot caused by Pythium ultimum depends on fungal species in the arbuscular mycorrhizal symbiosis | |
| Udayashankar et al. | Specific PCR-based detection of Alternaria helianthi: the cause of blight and leaf spot in sunflower | |
| Forcelini et al. | Development of high-throughput SNP genotyping assays for rapid detection of strawberry Colletotrichum species and the G143A mutation | |
| CN111549163B (en) | LAMP-based method for rapidly detecting prochloraz-resistant S312T genotype fusarium graminearum | |
| Rong et al. | Rapid diagnosis of rice bakanae caused by Fusarium fujikuroi and F. proliferatum using loop‐mediated isothermal amplification assays | |
| Hejazi et al. | Susceptibility assessment and genetic population structure associated with Rhizoctonia solani AG3-PT-Potato stem canker disease | |
| CN111876514B (en) | Rapid detection method for gibberellin miniascape generated in bakanae disease germ of rice | |
| KR102234489B1 (en) | Composition for selecting variety resistant to rice bakanae disease containing qBK1 gene comprising DNA marker and method for selecting variety resistant to rice bakanae disease using DNA marker | |
| Wang et al. | Development of a real-time TaqMan PCR method for absolute quantification of the biocontrol agent Esteya vermicola | |
| Rodríguez-García et al. | Expression of MfAvr4 in banana leaf sections with black leaf streak disease caused by Mycosphaerella fijiensis: A technical validation | |
| Park et al. | Genetic stability of Magnaporthe oryzae during successive passages through rice plants and on artificial medium | |
| Pothiraj et al. | Physiological race characterisation of Fusarium oxysporum strains infecting tomato employing candidate pathogenicity genes and host resistance | |
| KR20080043164A (en) | Identification of clubroot resistance gene using rapd marker in chines cabbage | |
| CN113789405A (en) | Method for detecting content of gibberella zeae in soil based on real-time fluorescent quantitative PCR | |
| Proctor et al. | Targeting Fumonisin biosynthetic genes | |
| CN112752843A (en) | Smut resistance-related marker of Saccharum plant and use thereof | |
| CN114410828B (en) | Primer composition for identifying or assisting in identifying bacterial leaf blight resistance of rice and method thereof | |
| JP2016002005A (en) | Purity detection method of strawberry f1 seeds by using crude extraction liquid of dna of strawberry seeds | |
| Bouchon | Vascular wilt disease of Theobroma cacao in Uganda and DR Congo caused by Verticillium dahliae: studies on management using a genetic approach |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |