CN111549163A - LAMP-based method for rapidly detecting prochloraz-resistant S312T genotype Fusarium celandi - Google Patents
LAMP-based method for rapidly detecting prochloraz-resistant S312T genotype Fusarium celandi Download PDFInfo
- Publication number
- CN111549163A CN111549163A CN202010356011.9A CN202010356011A CN111549163A CN 111549163 A CN111549163 A CN 111549163A CN 202010356011 A CN202010356011 A CN 202010356011A CN 111549163 A CN111549163 A CN 111549163A
- Authority
- CN
- China
- Prior art keywords
- primer
- reaction
- lamp
- loop
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a loop-mediated isothermal amplification primer for detecting sterol synthesis inhibitor fungicide S312T genotype bakanae bacteria, wherein an LAMP primer composition consists of 4 primers F3, B3, FIP and BIP. According to the invention, LAMP primer mismatch design is carried out on a 200-300 bp sequence containing 312 site mutation in Fusarium botryis Cyp51b gene, a primer which is strong in specificity, high in sensitivity and suitable for LAMP rapid molecular detection is screened out, and a technology for rapid molecular detection of the Fusarium botryis established. The method provided by the invention is used for LAMP detection of S312T mutant bacteria, the reaction process is simple (constant temperature of 64 ℃), the detection period is short (only 60min), the specificity is strong, the sensitivity is high, and the detection result can be observed by naked eyes.
Description
Technical Field
The invention belongs to the technical field of plant fungus molecular biology detection, relates to a primer group of S312T genotype Fusarium granatum for detecting sterol demethylation inhibitor-resistant bactericide prochloraz by using a loop-mediated isothermal amplification (LAMP) technology and a using method thereof, and belongs to the technical field of plant disease detection, identification, prevention and treatment and early warning of drug-resistant pathogenic bacteria.
Background
Fusarium fujikuroi (Fusarium fujikuroi) can cause rice bakanae disease and can also infect other plants such as corn. Wherein the bakanae disease is a hereditary fungal disease, which occurs in each main production area of rice, can occur from the seedling stage to the heading stage, and the yield of the field with light morbidity is reduced by 5-50%. The disease is mainly caused by infection, and seeds carrying pathogenic bacteria are the main infection source of the bakanae disease of rice, and if seeds with bacteria and healthy seeds are soaked together, disease-free seeds can be polluted. When the seeds grow new buds, germs can invade the seedlings through the buds , hyphae gradually spread to the whole plant along with the growth of the seedlings with germs, and a series of symptoms occur, such as internode elongation, exposure of the node and the outside of a leaf sheath, reduction of tillering capability, yellowing of the leaf color and abnormal development of a root system. The plants with light incidence degree are heading in advance, and the panicle shape is small but not solid. In the heading stage, diseases can also occur, and in severe cases, the ears become brown and cannot be fructified, so that the yield of rice is reduced.
Prochloraz belongs to sterol demethylation inhibitors (DMIs) and has obvious control effect on diseases of various crops caused by ascomycetes and adelomycetes. The pesticide is introduced into China at the end of the 20 th century, and mainly comprises two preparations of 25% of Schobenberg emulsifiable concentrate and 45% of Schobenberg water emulsion, and is applied to the prevention and treatment of rice bakanae disease by replacing carbendazim with serious resistance. By 10 months in 2019, the online data of Chinese pesticide information shows that 85 effective ingredients of 152 registered bactericides for preventing and treating the rice bakanae disease contain prochloraz (http:// www.icama.org.cn/hysj/index. To date, prochloraz is still the main agent for preventing and treating rice bakanae disease. Ergosterol is an important component of fungal cell membranes, and inhibition of its synthesis causes structural and functional disruption of the cell membrane, ultimately leading to cell death. Meanwhile, sterol plays an important role in the reproduction process of fungi as a precursor of some steroid hormones, and the reproduction of the fungi is influenced by the change of the content and the composition of the sterol. Sterol Biosynthesis Inhibitors (SBIs) can inhibit the biosynthesis of fungal ergosterol, and sterol 14 alpha-demethylation enzyme inhibitors (DMIs) in the SBIs are the most widely used bactericides in the SBIs at present. In 1970, DMI compounds are beginning to be applied to agricultural disease control, and the drug resistance of field DMIs bactericides is continuously reported. The drug resistance mechanism of Fusarium and other pathogenic bacteria to sterol demethylation inhibitor bactericides is reported to be a plurality of different forms such as point mutation of Cyp51 gene, overexpression of Cyp51 gene, effect of transport protein in drug resistance and the like. The detection of the drug resistance of the plant pathogenic bacteria can provide an important reference basis for epidemic early warning and drug resistance treatment of plant diseases. The traditional method for detecting or monitoring the resistance of the bactericide is mainly to culture pathogenic bacteria in a separation way, then culture the pathogenic bacteria on a medicine-containing culture medium and identify whether the bacterial strains are drug-resistant strains or not according to the inhibition effect of the medicament on the growth of hyphae, the detection period of the method is longer, the period from the separation to the identification is up to 1 week or even several weeks, and the bacterial contamination is always existed in the culture process of the pathogenic bacteria, so that errors are brought to the test results; meanwhile, a large amount of human resources are required to be input, and the detection cost is increased. Polymerase Chain Reaction (PCR) is also the most common method for detecting drug-resistant mutants by rapidly amplifying specific genes or DNA sequences in vitro, has high sensitivity and strong specificity, but requires expensive laboratory instruments and complicated experimental processes for detection, has long detection time and high detection cost, and cannot meet the requirements of economic, efficient and rapid detection.
Loop-mediated isothermal amplification (LAMP) is a novel nucleic acid amplification technology invented by Nippon grongy corporation, and is a novel nucleic acid amplification technology that can replace PCR because of the advantages of simple and rapid amplification operation, high specificity, low cost, and the like. It designs 4 pairs of specific primers aiming at 6 regions of a target gene, causes self-circulation strand displacement reaction under the action of Bst large-fragment polymerase, and can synthesize a large amount of target DNA within 60min to 65 ℃. The detection of the amplified product is generally performed by visual observation with a fluorescent dye, agarose gel electrophoresis, turbidity observation, and the like. The LAMP amplification process depends on 6 independent areas for identifying the target sequence, so the reaction specificity is very strong, the nucleic acid amplification process is carried out under the constant temperature condition, a common water bath pot or an isothermal thermos bottle can meet the reaction requirement, the detection cost is reduced, and the required time is short. The method has the characteristics of simple reaction, rapidness, high efficiency, economy and the like, so the method has extremely wide application prospect.
The existing detection method for prochloraz-resistant S312T genotype Fusarium granatum at present comprises the following steps: the strain is separated from the body of a diseased plant and cultured, and genomic DNA is extracted for sequencing to identify whether the strain is the S312T genotype of the anti-prochloraz. The method requires a specific instrument such as a PCR instrument and a gene sequencer.
Disclosure of Invention
The invention aims to provide a loop-mediated isothermal amplification method of S312T genotype Fusarium celiosum for detecting sterol demethylation inhibitor-like bactericide prochloraz, and primers and a kit used in the method.
In order to solve the technical problems, the invention provides an LAMP primer composition for detecting Fusarium celastrum of S312T genotype of anti-sterol demethylation inhibitor bactericide prochloraz, which consists of four primers of an upstream outer primer and a downstream inner primer, wherein the sequences of the primers are as follows:
upstream outer primer (F3): 5 '-TGATCATGAGGTCGCCCATA-3';
downstream outer primer (B3): 5 '-TTGGCAAGGTCGTCGTAAG-3';
inner upstream primer (FIP): 5 '-GACGGAGCATGATCCAAGAGCTTCATGGCTGGCCAGCACG-3';
downstream inner primer (FIP): 5 '-ACCCTCACATCATGGAGGAGCTTCAAGGGAGGCAAATCAGC-3'.
The improvement of the loop-mediated isothermal amplification primer for detecting the sterol synthesis inhibitor fungicide S312T genotype bakanae bacteria is as follows: the kit consists of a 312 site mutation region containing the Cyp51B gene of the bakanae disease and a primer group designed by mismatched bases, and the loop-mediated isothermal amplification reaction is used for detecting the bakanae disease of the sterol synthesis inhibitor fungicide S312T genotype.
The invention also provides application of the LAMP primer composition in detection of Fusarium celosicum of S312T genotype of anti-sterol demethylation inhibitor bactericide prochloraz.
The invention also provides application of the LAMP primer composition in a Fusarium granatum LAMP kit for detecting the S312T genotype of the sterol demethylation inhibitor-resistant prochloraz. Namely, the invention also provides an LAMP kit for detecting the Fusarium granatum of S312T genotype of the anti-sterol demethylation inhibitor bactericide prochloraz, which comprises the LAMP primer composition.
In the LAMP kit of the present invention, the final concentrations of the primer combinations are: 0.8 μ M of the forward inner primer FIP, 0.8 μ M of the reverse inner primer BIP, 0.3 μ M of the forward outer primer F3, 0.3 μ M of the reverse outer primer B3. The kit also comprises a premixed solution for loop-mediated isothermal amplification reaction: 10 XThermoPol Reaction Buffer, 1mM dNTPs, 4mM MgCl20.6M betaine, 150. mu.M hydroxynaphthol blue (HNB), 8U/. mu.L Bst DNA polymerase, ddH2O。
The invention also provides a loop-mediated isothermal amplification method for detecting the bakanae disease of the genotype of the sterol synthesis inhibitor fungicide S312T, wherein the total amount of the detection solution is 24 mu L, 1 mu L of DNA template to be detected is added to form a 25 mu L detection reaction system, and the 25 mu L reaction system contains 0.5 mu L (4U) of 8U/mu L Bst DNA polymerase, 10 × ThermoPolbuffer2.5 mu L, 10 mu M FIP 2.0 mu L, 10 mu M BIP 2.0 mu L, 10 mu M F30.75.75 mu L, 10 mu M B30.75.75 mu L and 25mMMgCl24.0 μ L, 2.5 μ L of 10mM dNTPs, 3.0 μ L of 5M betaine, 1 μ L of 3.75mM hydroxynaphthol blue (HNB) template, 1 μ L of L, DNA, and making up to 25 μ L with double distilled water.
The invention also provides a loop-mediated isothermal amplification method for detecting the Fusarium celastrum of S312T genotype of the anti-sterol demethylation inhibitor bactericide prochloraz, and the 25 mu L detection reaction system is used for carrying out LAMP amplification reaction. The LAMP amplification reaction program is as follows: at 64 ℃ for 60 min. Extinguishing fire at 80 deg.C for 10 min.
The method for analyzing and judging the amplification result comprises the following steps:
1) adding dye Hydroxy Naphthol Blue (HNB) as a reaction indicator before amplification, taking the color change of the Hydroxy Naphthol Blue (HNB) as a result judgment standard, and after the reaction is finished, observing the color development result, judging that sky blue is positive, namely, the Fusarium granatum of S312T genotype of the prochloraz of the anti-sterol demethylation inhibitor bactericide is detected, and judging that blue-violet is negative, namely, the detected strain is sensitive or the contained pathogenic bacteria do not reach the detection limit.
2) And (3) taking 5 mu L of amplification product, detecting by using 2% agarose gel electrophoresis, if a trapezoidal band appears, judging as positive, namely, the fusarium granatum of S312T genotype of the prochloraz of the sterol demethylation inhibitor-resisting bactericide is detected, and if no amplification band exists, judging as negative, namely, the detection strain is sensitive or the contained germs do not reach the detection limit.
The concentration corresponding to the detection limit was 0.01 ng/. mu.L.
The technical scheme of the invention is as follows:
1. elucidation of the mechanism of drug resistance
Sequencing of Cyp51 genes with different resistance levels to bakanae disease of Zhejiang province in a laboratory of the inventor discovers that S312T point mutation of Cyp51b occurs to the prochloraz-resistant bacteria, and no mutation is found in Cyp51 a. In 2018, the research on the site-directed mutation of the 312 th codon of the Cyp51 gene of resistant and sensitive bacteria of prochloraz is carried out respectively, and the S312T point mutation of the Cyp51b gene is proved to be the reason for the resistance of fusarium granatum to the prochloraz, namely, the molecular mechanism of the resistance of the fusarium granatum to the prochloraz is that the 312 th codon of the Cyp51b gene is mutated from TCT to ACT (S312T point mutation).
2. Design of primers
Screening of primers is a key factor of LAMP detection, Cyp51b genome sequence is downloaded from a Fusarium granatum database for comparison and analysis, a mutant LAMP primer is designed by using online software PrimeExplore V5(http:// Primexplor. jp/e/V5) in a 200-300 bp sequence containing a mutation site, and the 3' end base of the forward primer FIP is mismatched according to the mutation site. Finally, 2 outer primers (F3 and B3) and 2 inner primers (FIP and BIP) were obtained. The primer information is shown in Table 1.
Table 1, primer sequence information:
| primer name | Sequence 5'-3' |
| Fj-F3 | TGATCATGAGGTCGCCCATA |
| Fj-B3 | TTGGCAAGGTCGTCGTAAG |
| Fj-FIP | GACGGAGCATGATCCAAGAGCTTCATGGCTGGCCAGCACG |
| Fj-BIP | ACCCTCACATCATGGAGGAGCTTCAAGGGAGGCAAATCAGC |
3. Specific detection of primers
To detect the specificity of the primer, the DNA of S312T mutant pathogen was used as a positive control, the DNA of non-mutated susceptible pathogen (F. fujikurio), Ustilaginoidea virens (Ustilaginoidea virens) and the like were used as negative controls, and double distilled water was used as a blank control to test, and the primer was found to have specificity to S312T mutant Fusarium canescens (FIG. 1).
4. The LAMP reaction system is 25 μ L system containing 8U/. mu.L Bst DNA polymerase 0.5 μ L (4U), 10 × ThermoPol Buffer2.5 μ L, 10.0 μ M FIP primer 2.0 μ L, 10.0 μ M BIP primer 2.0 μ L, 10 μ M F3 primer 0.75 μ L, 10 μ M B3 primer 0.75 μ L, 25.0mM MgCl24.0. mu.L, 2.5. mu.L of 10.0mM dNTP, 3.0. mu.L of 5.0M betaine, 1. mu.L of 3.75mM hydroxynaphthol blue (HNB) template, and making up to 25. mu.L with double distilled water; the amplification conditions were 64 ℃ incubation for 60min, 80 ℃ inactivation for 10 min.
After the reaction, the specificity of the primers was determined by agarose gel electrophoresis and HNB dye color development, respectively. Agarose gel electrophoresis: taking 5 mu L of LAMP amplification product, detecting by 2% agarose gel electrophoresis, EB dyeing, observing in a gel imaging system, wherein the characteristic ladder-shaped strip is positive, and the strip which does not appear is negative; HNB dye color development method: and (3) observing the color change of the LAMP reaction mixed solution by naked eyes, wherein sky blue is a positive reaction, and blue purple is a negative reaction.
5. Determination of detection Limit of DNA concentration
The extracted S312T mutant type bakanae disease genome DNA is diluted to 7 concentrations (100 ng/muL-0.0001 ng/muL) according to a 10-fold gradient after the concentration is measured by using NanoDrop 1000, and the concentration is used for detecting LAMP amplification sensitivity. The LAMP reaction system and amplification conditions were as above.
After amplification is finished, 5 mu L of LAMP amplification concentration gradient product is taken to be subjected to electrophoresis analysis on 2% agarose gel, and the result is observed by using a gel imaging system after ethidium bromide staining.
6. Optimization of reaction programs
The purpose is to establish the LAMP optimal reaction temperature capable of detecting S312T mutant Fusarium celastrum. The above primer combination is used to form a detection solution with the reaction premix, 1 μ L of pathogen DNA template is added, the reaction temperature is set to 59 ℃, 60 ℃, 61 ℃, 62 ℃, 63 ℃, 64 ℃, 65 ℃ and 66 ℃, and after the amplification reaction is finished, the color change of the reaction tube is observed, and the detection is performed by 2% agarose gel electrophoresis as the verification step.
The reaction result shows (figure 2), the color change of the reaction tube is most obvious and the electrophoresis LAMP band is most clear when the reaction temperature is 64 ℃.
The purpose is to establish an optimum LAMP reaction time for detecting the S312T mutant pathogenic bacteria. The primer combination is utilized to form a detection solution together with the reaction premixed solution, 1 mu L of the DNA template of the rice bakanae disease is added, the reaction time is set to be 10min, 20min, 30min, 40min, 50min, 60min, 70min and 80min, the color change of the reaction tube is observed after the amplification reaction is finished, and the detection is carried out by 2% agarose gel electrophoresis as the verification in the next step.
The reaction results show (fig. 3), when the reaction time reaches 60min or longer, the color change of the reaction tube is obvious, the electrophoresis LAMP band is clear, and the detection time is saved, namely 60min is the amplification time.
According to the optimization result of the reaction program, the reaction program is 64 ℃ and 60 min.
According to the invention, LAMP primer mismatch design is carried out on a 200-300 bp sequence containing 312 site mutation in Fusarium botryis Cyp51b gene, a primer which is strong in specificity, high in sensitivity and suitable for LAMP rapid molecular detection is screened out, and a technology for rapid molecular detection of the Fusarium botryis established. According to the invention, the Cyp51b gene mismatch is used for designing and screening the specific LAMP primer, the rapid molecular detection technical system and the reaction condition optimization are carried out, the LAMP detection is carried out on the S312T mutant pathogen, the reaction process is simple and convenient (the temperature is kept at 64 ℃), the detection period is short (only 60min is needed), the specificity is strong, the sensitivity is high, and the detection result can be observed by naked eyes.
The invention has the following technical advantages:
1) and the practicability is good. The traditional method for detecting the resistance of the bactericide is mainly to culture pathogenic bacteria in a separation way, then culture the pathogenic bacteria on a medicine-containing culture medium and identify whether the bacterial strains are drug-resistant strains or not according to the inhibition effect of the medicament on the growth of hyphae, and the method has a long detection period which is up to 1 week from the separation to the identification and consumes long time. The common PCR reaction is used for carrying out gel electrophoresis on the product, the result can be judged only by staining with Ethidium Bromide (EB) and observing under an ultraviolet lamp, the detection time is long, the detection cost is high, and the requirements of economical and efficient detection cannot be met. The LAMP reaction of the invention is only carried out at a constant temperature (64 ℃), and the result can be directly judged by naked eyes under normal light after the reaction is finished, so that the drug resistance of pathogenic bacteria can be rapidly detected, and the application value of the LAMP reaction in field detection is increased.
2) And carrying out constant temperature amplification. Unlike PCR method, which needs thermal cycling, the method gets rid of the dependence on a thermal cycler, can complete LAMP reaction only by using a stable heat source such as a constant temperature water bath, does not need expensive instruments and equipment, and is convenient for popularization and application in the grassroots agricultural production units. LAMP can be reacted under a constant heat source because betaine is added to the LAMP reaction solution to make double-stranded DNA in a dynamic equilibrium of melting, and amplification is achieved by Bst DNA polymerase.
The invention only needs one isothermal environment at 64 ℃.
3) And the accuracy is high. The traditional germ drug resistance detection technology is culture and identification on a drug-containing culture medium, and the identification method is long in time consumption and easy to be interfered by a plurality of factors such as human factors, environment factors and the like. The LAMP reaction specifically recognizes 6 independent regions on the target sequence through 4 primers, and the specificity and the sensitivity are remarkably improved compared with 2 independent regions of the target sequence recognized by common PCR primers.
The lowest detection concentration of the invention is 0.01 ng/. mu.L.
Drawings
The following describes embodiments of the present invention in further detail with reference to the accompanying drawings.
FIG. 1 is a comparison of primer specificity assays;
a: LAMP chromogenic change map; b: LAMP agarose gel electrophoresis picture; m represents DL2000 DNA Marker; 1. sterile water, 2. sensitive fusarium granatum, 3. sensitive fusarium granatum, 4. ustilaginoidea virens, 5.S312T mutant fusarium granatum, 6.S312T mutant fusarium granatum, 7.S312T mutant fusarium granatum, and 8.S312T mutant fusarium granatum.
In the color chart, 1-4 in FIG. 1a is bluish purple, and 5-8 days blue.
FIG. 2 is a diagram of reaction temperature optimization;
a: LAMP chromogenic change map; b: LAMP agarose gel electrophoresis picture; m represents DL2000 DNA Marker; 1: 59 ℃, 2: 60 ℃, 3: 61 ℃, 4: at 62 ℃ and 5: 63 ℃ and 6: 64 ℃, 7:65 ℃, 8: at 66 ℃.
In the color chart, 1-2 in FIG. 2a is bluish purple, 3-8 sky blue.
FIG. 3 is a graph of reaction time optimization;
a: LAMP chromogenic change map; b: agarose gel electrophoresis picture; m represents DL2000 DNA Marker; 1: 10min, 2: 20min, 3: 30min, 4: 40min, 5: 50min, 6: 60min, 7: 70min, 8: and 80 min.
In the color chart, 1-3 in FIG. 3a are bluish purple and 4-8 sky blue.
FIG. 4 is a graph showing the measurement of the limit of reaction;
a: LAMP chromogenic change map; b: LAMP agarose gel electrophoresis picture; m represents DL2000 DNA Marker; 1: ddH2O and 2-8 respectively represent the DNA concentration 2 of S312T Fusarium celastrum strain: 0.0001 ng/. mu.L, 3: 0.001 ng/. mu.L, 4: 0.01 ng/. mu.L, 5: 0.1 ng/. mu.L, 6: 1 ng/. mu.L, 7: 10 ng/. mu.L, 8: 100 ng/. mu.L.
In the color chart, 1-3 in FIG. 4a is bluish purple, 4-8 sky blue.
FIG. 5 is a graph showing detection of drug-resistant Fusarium granatum strains from rice seeds and seedlings
a: LAMP chromogenic change map; b: agarose gel electrophoresis picture;
m represents DL2000 DNA Marker; 1-2: rice seeds (inoculated by bakanae disease sensitive bacteria), 3-4: rice seeds (S312T mutant bakanae disease inoculation), 5-6: rice seedlings (inoculated with bakanae disease sensitive bacteria and 10 mug/mL prochloraz), 7-8: seedlings of rice (S312T mutant bakanae disease inoculation +10 mug/mL prochloraz);
in the color diagram, 1, 2, 5 and 6 in the figure 5a are blue-purple, and 3, 4, 7 and 8 are sky-blue;
c: a growth state diagram;
s: rice seedlings (inoculated with bakanae disease sensitive bacteria +10 mug/mL prochloraz); r: rice seedlings (S312T mutant bakanae disease inoculation + 10. mu.g/mL prochloraz).
Detailed Description
The invention will be further described by way of example only with reference to the accompanying drawings, which do not in any way limit the scope of the invention, but are given by way of illustration only.
The main reagents and instruments used in the following examples Bst DNA polymerase, dNTP (Vazyme), betaine, DEPC water, molecular quality standard DNA Maker (TaKaRa bioengineering company genome), MgCl2The kit comprises a fungal genome DNA rapid extraction kit (bio-engineering Co., Ltd.), an eppendorf common PCR amplification instrument and a DK-8D type electric heating constant-temperature water bath of Shanghai sperm macroexperimental instrument factory.
Example 1: sensitive detection of primers
1. DNA of the mutant Fusarium canescens genome was extracted S312T and the concentration of the DNA solution was measured to be 200 ng/. mu.L. The DNA solution was diluted to have a gradient of 0.0001 ng/. mu.L, 0.001 ng/. mu.L, 0.01 ng/. mu.L, 0.1 ng/. mu.L, 1 ng/. mu.L, 10 ng/. mu.L, or 100 ng/. mu.L, and the following reaction systems were prepared as DNA templates, respectively:
25 μ L reaction system 8U/. mu.L Bst DNA polymerase 0.5 μ L (4U), 10 × ThermoPol Buffer2.5 μ L, 10 μ M FIP 2.0 μ L, 10 μ M BIP 2.0 μ L, 10 μ M F30.75.75 μ L, 10 μ M B30.75.75 μ L, 25mM MgCl24.0. mu.L, 2.5. mu.L of 10mM dNTPs, 3.0. mu.L of 5M betaine, 1. mu.L of 3.75mM hydroxynaphthol blue (HNB) template, and finally, each up to 25. mu.L with double distilled water.
The reaction system is prepared before LAMP amplification reaction. The reaction system is bluish purple.
Replacing 1. mu.L of DNA template in the 25. mu.L reaction system with 1. mu.L of double distilled water as a blank,
the following primer combinations were tested:
upstream outer primer (F3): 5 '-TGATCATGAGGTCGCCCATA-3';
downstream outer primer (B3): 5 '-TTGGCAAGGTCGTCGTAAG-3';
inner upstream primer (FIP): 5 '-GACGGAGCATGATCCAAGAGCTTCATGGCTGGCCAGCACG-3';
downstream inner primer (FIP): 5 '-ACCCTCACATCATGGAGGAGCTTCAAGGGAGGCAAATCAGC-3'.
The LAMP amplification reaction program used was: amplifying at 64 deg.C for 60min, and inactivating at 80 deg.C for 10 min; obtaining LAMP reaction mixed liquor (LAMP amplification product).
2. After the reaction, the specificity of the primers was determined by agarose gel electrophoresis and HNB dye color development, respectively.
Agarose gel electrophoresis: taking 5 microliter LAMP reaction mixed liquor (LAMP amplification product), detecting by 2 percent agarose gel electrophoresis, EB dyeing, observing in a gel imaging system, wherein the occurrence of characteristic ladder-shaped strips is positive, namely, the sterol synthesis inhibitor drug-resistant S312T mutant bakanae disease is detected, and the absence of strips is judged to be negative, namely, the detection strain is sensitive bakanae disease, or the content of the contained bakanae disease bacteria is not up to the lowest detection concentration of 0.01 ng/microliter detected.
HNB dye color development method: and (3) observing whether the color of the LAMP reaction mixed solution changes relative to the original reaction system by naked eyes, wherein the reaction is positive if the color changes into sky blue, and the reaction is negative if the color does not change into blue purple.
The results obtained are shown in FIG. 4, in particular as follows:
after the reaction, the reaction results were positive at DNA template concentrations of 0.01 ng/. mu.L, 0.1 ng/. mu.L, 1 ng/. mu.L, 10 ng/. mu.L, and 100 ng/. mu.L, the color of the reaction tube changed from bluish purple to sky blue before and after the reaction, and the reaction tube had a specific band as detected by 2% agarose gel electrophoresis. When the concentration is lower than 0.01 ng/. mu.L, the reaction tube becomes negative when no color change occurs, and no specific band appears by using 2% agarose gel electrophoresis.
The result showed that the lowest concentration of S312T mutant Fusarium canescens DNA detected was 0.01 ng/. mu.L.
Example 2: analysis of primer specificity
Sensitive fusarium granatum and ustilaginoidea virens genome DNA is extracted to be used as a negative control, S312T mutant fusarium granatum genome DNA is used as a positive control, and double distilled water is used as a blank control. The reaction system, the primer combination used, and the detection method were the same as in example 1.
That is, the sensitive Fusarium canescens DNA, Ustilaginoidea virens genomic DNA, and S312T mutant Fusarium canescens genomic DNA were used as templates (concentration: 0.01 ng/. mu.L), and the rest were the same as in example 1.
The test results are shown in figure 1: the templates except the S312T mutant fusarium granatum are negative, the color of the reaction solution in the reaction tube is not changed, and no specific band appears after 2% agarose gel electrophoresis detection. The primer combination constituted loop-mediated isothermal amplification system can detect S312T mutant Fusarium celastrum and has specificity.
Example 3: detection of drug resistant strains in seeds and seedlings
(1) Preparation of rice seed samples bacterial dishes with a diameter of 5mm were punched on the edges of colonies of 5d of sensitive Fusarium canopi and S312T of mutant Fusarium canopi cultured in the dark on a CM medium at 28 ℃, 3 bacterial dishes and 20 sterile rice seeds (seeds were sterilized in a water bath kettle at 60 ℃ for 15min) were put into PS (100mL) for shaking culture at 150rpm, 28 ℃, 12h light-dark cycle. After 3 d. Taking out the seeds, wrapping the seeds with sterilized paper, and naturally drying at 25 ℃ for later use. Two seeds are respectively taken to extract genome DNA for detecting resistant strains in the rice seeds.
(2) Each sample genome extracted was used as a template (concentration: 0.01 ng/. mu.L), and the rest was the same as in example 1.
The results obtained were:
the detection results of 2 rice seeds corresponding to sensitive Fusarium granatum are as follows: the result shows that the reaction solution in the reaction tube is negative, the color of the reaction solution is not changed, and no specific band appears after 2% agarose gel electrophoresis detection.
The detection results of 2 rice seeds corresponding to S312T mutant fusarium granatum were: the result shows positive, the color of the reaction solution in the reaction tube changes to sky blue, and specific bands appear after 2% agarose gel electrophoresis detection.
(3) Respectively taking one part of the seeds which are not dried after shaking culture, culturing in a rice nutrient solution, adding 10 mu g/mL prochloraz, shaking culture for 12h under the same condition, and shearing internodes after 15d to extract DNA. Selecting 15 sprouted grains with consistent growth vigor, sowing the sprouted grains on a plug in a culture solution, and illuminating for 12 hours at 28 ℃ and darkness for 12 hours at 28 ℃ with relative humidity of 70-80%. After the seedlings are cultured for about 15 days and the phenomena of spindling and inverted rooting appear, the internodes are cut to extract DNA for LAMP detection of resistant strains in the rice seedlings.
The results obtained were:
the DNA results for seedlings corresponding to sensitive Fusarium granatum are: the result shows that the reaction solution in the reaction tube is negative, the color of the reaction solution is not changed, and no specific band appears after 2% agarose gel electrophoresis detection.
DNA results for seedlings corresponding to S312T mutant fusarium granatum were: the result shows positive, the color of the reaction solution in the reaction tube changes to sky blue, and specific bands appear after 2% agarose gel electrophoresis detection.
Thus, the following conclusive conclusions can be drawn: the LAMP reaction did not detect seeds and seedlings with the sensitive strain, and seeds and seedlings with the S312T mutant type bakanae disease could be detected (FIG. 5).
Comparative examples 1-1,
The following primer combinations were used for the experiments:
upstream outer primer (F3): 5 '-TGATCATGAGGTCGCCCATA-3';
downstream outer primer (B3): 5 '-TTGGCAAGGTCGTCGTAAG-3';
inner upstream primer (FIP-1): 5 '-GACGGAGCATGATCCAAGAGCTTCATGGCTGGCCAGCACC-3';
downstream outer primer (BIP): 5 '-ACCCTCACATCATGGAGGAGCTTCAAGGGAGGCAAATCAGC-3'.
A25. mu.L reaction system was used, comprising 0.5. mu.L (4U) of Bst DNA polymerase 8U/. mu.L, 2.5. mu.L of 10 × ThermoPol Buffer, 12.0. mu.L of 10. mu.M FIP, 2.0. mu.L of 10. mu.M BIP, 10. mu. M F30.75.75. mu.L, 10. mu. M B30.75.75. mu.L, 25mM MgCl2mu.L of 4.0. mu.L, 2.5. mu.L of 10mM dNTPs, 3.0. mu.L of 5M betaine, 1. mu.L of 3.75mM hydroxynaphthol blue (HNB), 1. mu.L of DNA solutions (DNA of S312T mutant Fusarium canescens genome) at concentrations of 1 ng/. mu.L, 10 ng/. mu.L, and 100 ng/. mu.L, respectively, as a template, was added thereto, and the amount was made up to 25. mu.L with double distilled water.
The test results show that the test results are negative, the color of the reaction solution in the reaction tube is not changed, and no specific band appears after 2% agarose gel electrophoresis detection. It was shown that S312T mutant Fusarium celandi could not be efficiently detected by the loop-mediated isothermal amplification system comprising the primer set, and even if the concentration of the DNA template was increased to 100 ng/. mu.L, it could not be efficiently distinguished.
Comparative examples 1 to 2,
The following primer combinations were used for the experiments:
upstream outer primer (F3): 5 '-TGATCATGAGGTCGCCCATA-3';
downstream outer primer (B3): 5 '-TTGGCAAGGTCGTCGTAAG-3';
inner upstream primer (FIP-2): 5 '-GACGGAGCATGATCCAAGAGCTTCATGGCTGGCCAGCACA-3';
downstream outer primer (BIP): 5 '-ACCCTCACATCATGGAGGAGCTTCAAGGGAGGCAAATCAGC-3'.
The reaction system was referred to comparative example 1-1.
The test results show that the test results are negative, the color of the reaction solution in the reaction tube is not changed, and no specific band appears after 2% agarose gel electrophoresis detection. It was shown that S312T mutant Fusarium celandi could not be efficiently detected by the loop-mediated isothermal amplification system comprising the primer set, and even if the concentration of the DNA template was increased to 100 ng/. mu.L, it could not be efficiently distinguished.
Comparative examples 2,
The primer specificity analysis was performed as described in example 2 using the following primer combinations:
upstream outer primer (F3): 5 '-TGATCATGAGGTCGCCCATA-3';
downstream outer primer (B3): 5 '-TTGGCAAGGTCGTCGTAAG-3';
the upstream inner primer (FIP-3)5 '-GACGGAGCATGATCCAAGAGCTTCATGGCTGGCCAGCACT-3',
downstream outer primer (BIP): 5 '-ACCCTCACATCATGGAGGAGCTTCAAGGGAGGCAAATCAGC-3'.
As a result, it was found that: the results of the sensitive Fusarium granatum DNA, the Ustilaginoidea virens genome DNA and the S312T mutant Fusarium granatum genome DNA are consistent and are negative, the color of the reaction liquid in the reaction tube is not changed, and no specific band appears after 2% agarose gel electrophoresis detection. Even if the concentration of the DNA template was increased to 100 ng/. mu.L, it was still not effectively discriminated.
It should be noted that: the Primer is directly designed by using online software Primer Explorer 5(http:// Primer explorer. jp/e/v5), namely, the upstream inner Primer (FIP-3) is obtained, and the Primer cannot be specifically detected after the test, so that the 3' end base of the forward Primer FIP mismatched with the mutation site is introduced, namely, the tail end of the upstream inner Primer (FIP) is mismatched into ACC, ACA and ACG from ACT, and finally the test shows that the S312T mutant fusarium graminearum can be specifically detected only when the upstream inner Primer (FIP) is 5' -GACGGAGCATGATCCAAGAGCTTCATGGCTGGCCAGCACG-3 '.
Finally, it is also noted that the above-mentioned lists merely illustrate a few specific embodiments of the invention. It is obvious that the invention is not limited to the above embodiments, but that many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.
Claims (9)
1. The loop-mediated isothermal amplification primer for detecting the sterol synthesis inhibitor fungicide S312T genotype bakanae bacteria is characterized in that: the LAMP primer composition consists of the following 4 primers:
F3：5’-TGATCATGAGGTCGCCCATA-3’
B3：5’-TTGGCAAGGTCGTCGTAAG-3’
FIP：5’-GACGGAGCATGATCCAAGAGCTTCATGGCTGGCCAGCACG-3’
BIP：5’-ACCCTCACATCATGGAGGAGCTTCAAGGGAGGCAAATCAGC-3’。
2. the loop-mediated isothermal amplification primer for detecting the bakanae disease of the sterol synthesis inhibitor fungicide S312T genotype according to claim 1, which is characterized in that:
the kit consists of a 312 site mutation region containing the Cyp51B gene of the bakanae disease and a primer group designed by mismatched bases, and the loop-mediated isothermal amplification reaction is used for detecting the bakanae disease of the sterol synthesis inhibitor fungicide S312T genotype.
3. The loop-mediated isothermal amplification kit for detecting the genotype of the sterol synthesis inhibitor fungicide S312T is characterized by comprising the following components in parts by weight: comprising the LAMP primer composition of claim 1.
4. The kit of claim 3, wherein: the final concentrations of the primer combinations were: 0.8 μ M of the forward inner primer FIP, 0.8 μ M of the reverse inner primer BIP, 0.3 μ M of the forward outer primer F3, 0.3 μ M of the reverse outer primer B3.
5. The kit according to claim 3 or 4, characterized in that: the kit also comprises a premixed solution for loop-mediated isothermal amplification reaction: 10 XThermoPol Reaction Buffer, 1mM dNTPs, 4mM MgCl20.6M betaine, 150. mu.M hydroxynaphthol blue, 8U/. mu.L Bst DNA polymerase, ddH2O。
6. The loop-mediated isothermal amplification method for detecting the bakanae disease of the genotype of the sterol synthesis inhibitor fungicide S312T is characterized by comprising the following steps of:
a25. mu.L reaction system consisted of 0.5. mu.L of 8U/. mu.LBst DNA polymerase, 10 × ThermoPol buffer 2.5. mu.L, 10. mu.M FIP 2.0. mu.L, 10. mu.M BIP 2.0. mu.L, 10. mu. M F30.75.75. mu.L, 10. mu. M B30.75.75. mu.L, 25mM MgCl2mu.L of 4.0. mu.L, 2.5. mu.L of 10mM dNTPs, 3.0. mu.L of 5M betaine, 1. mu.L of 3.75mM hydroxynaphthol blue 1. mu. L, DNA template, and making up to 25. mu.L with double distilled water.
7. The loop-mediated isothermal amplification method according to claim 6, wherein:
performing LAMP reaction by using the reaction system, and selecting any one of the following methods:
adding a dye hydroxy naphthol blue as a reaction indicator before amplification, taking the color change of the hydroxy naphthol blue as a result judgment standard, and observing a bluish judgment as a positive result and a bluish-purple judgment as a negative result in a color development result after the reaction is finished;
and secondly, taking 5 mu L of amplification product, detecting by using 2% agarose gel electrophoresis, and judging as positive if a trapezoidal band appears, and judging as negative if no amplification band exists.
8. The loop-mediated isothermal amplification method according to claim 7, wherein:
positive, which indicates that the sterol synthesis inhibitor drug-resistant S312T mutant bakanae disease is detected;
negative indicates that the detection strain is sensitive bakanae disease bacteria or the content of the contained bakanae disease bacteria of the rice is not up to the lowest detection concentration of 0.01 ng/muL.
9. The loop-mediated isothermal amplification method according to claim 7 or 8, characterized in that the LAMP amplification reaction procedure is: amplifying at 64 deg.C for 60min, and extinguishing at 80 deg.C for 10 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010356011.9A CN111549163B (en) | 2020-04-29 | 2020-04-29 | LAMP-based method for rapidly detecting prochloraz-resistant S312T genotype fusarium graminearum |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010356011.9A CN111549163B (en) | 2020-04-29 | 2020-04-29 | LAMP-based method for rapidly detecting prochloraz-resistant S312T genotype fusarium graminearum |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111549163A true CN111549163A (en) | 2020-08-18 |
| CN111549163B CN111549163B (en) | 2023-05-05 |
Family
ID=71996431
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010356011.9A Active CN111549163B (en) | 2020-04-29 | 2020-04-29 | LAMP-based method for rapidly detecting prochloraz-resistant S312T genotype fusarium graminearum |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111549163B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116397047A (en) * | 2023-05-10 | 2023-07-07 | 三亚中国农业科学院国家南繁研究院 | Primer combination for detecting B-I280V mutation of corynespora polymorpha |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106350588A (en) * | 2016-08-30 | 2017-01-25 | 浙江农林大学 | Device for rapidly detecting benzimidazole fungicide-resistant botrytis cinerea Pers. based on LAMP |
| CN106893776A (en) * | 2017-02-20 | 2017-06-27 | 福建省农业科学院植物保护研究所 | A kind of method for detecting Ustilaginoidea virens cyp51 gene nucleotides mutational site |
| CN107022624A (en) * | 2017-05-08 | 2017-08-08 | 浙江农林大学 | The LAMP methods and kit of quick detection bakanae disease of rice germ from seed rice |
| CN110982922A (en) * | 2019-12-20 | 2020-04-10 | 浙江大学 | Primer composition and method for rapidly detecting rice bakanae disease pathogenic bacteria fusarium granatum based on LAMP |
-
2020
- 2020-04-29 CN CN202010356011.9A patent/CN111549163B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106350588A (en) * | 2016-08-30 | 2017-01-25 | 浙江农林大学 | Device for rapidly detecting benzimidazole fungicide-resistant botrytis cinerea Pers. based on LAMP |
| CN106893776A (en) * | 2017-02-20 | 2017-06-27 | 福建省农业科学院植物保护研究所 | A kind of method for detecting Ustilaginoidea virens cyp51 gene nucleotides mutational site |
| CN107022624A (en) * | 2017-05-08 | 2017-08-08 | 浙江农林大学 | The LAMP methods and kit of quick detection bakanae disease of rice germ from seed rice |
| CN110982922A (en) * | 2019-12-20 | 2020-04-10 | 浙江大学 | Primer composition and method for rapidly detecting rice bakanae disease pathogenic bacteria fusarium granatum based on LAMP |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116397047A (en) * | 2023-05-10 | 2023-07-07 | 三亚中国农业科学院国家南繁研究院 | Primer combination for detecting B-I280V mutation of corynespora polymorpha |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111549163B (en) | 2023-05-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107022624B (en) | LAMP method and kit for rapidly detecting bakanae disease bacteria of rice from rice seeds | |
| CN108085410B (en) | Seedling-stage strawberry anthracnose latent infection and rapid detection method for application of anthracnose latent infection | |
| Gayoso et al. | Assessment of real-time PCR as a method for determining the presence of Verticillium dahliae in different Solanaceae cultivars | |
| Silva et al. | Molecular, physiological and pathological characterization of Corynespora leaf spot fungi from rubber plantations in Sri Lanka | |
| KR101509076B1 (en) | Composition comprising DNA marker for selecting rice variety containing bakanae disease-resistant BK1 gene and method of selecting rice variety resistant to bakanae disease using the DNA marker | |
| CN106350588A (en) | Device for rapidly detecting benzimidazole fungicide-resistant botrytis cinerea Pers. based on LAMP | |
| Yan et al. | qPCR and loop mediated isothermal amplification for rapid detection of Ustilago tritici | |
| CN111549163B (en) | LAMP-based method for rapidly detecting prochloraz-resistant S312T genotype fusarium graminearum | |
| KR102234489B1 (en) | Composition for selecting variety resistant to rice bakanae disease containing qBK1 gene comprising DNA marker and method for selecting variety resistant to rice bakanae disease using DNA marker | |
| Block et al. | Development of a diagnostic assay for race differentiation of Podosphaera macularis | |
| Agisha et al. | Molecular discrimination of opposite mating type haploids of Sporisorium scitamineum and establishing their dimorphic transitions during interaction with sugarcane | |
| Rahman et al. | Simultaneous detection of Colletotrichum acutatum and C. gloeosporioides from quiescently infected strawberry foliage by real-time PCR based on high resolution melt curve analysis | |
| CN115976254A (en) | RPA-LFD primer and detection method for plant pathogenic fusarium oxysporum | |
| CN114032334A (en) | Primer group and kit for detecting quinoa phomopsis and detection method thereof | |
| CN112752843A (en) | Smut resistance-related marker of Saccharum plant and use thereof | |
| Chaudhary et al. | Morpho-genetic variability of Rhizoctonia solani population causing sheath blight disease in rice (Oryza sativa L.) | |
| CN114410828B (en) | Primer composition for identifying or assisting in identifying bacterial leaf blight resistance of rice and method thereof | |
| JP2016002005A (en) | Purity detection method of strawberry f1 seeds by using crude extraction liquid of dna of strawberry seeds | |
| Saberi-Riseh et al. | Association between agronomic traits and molecular markers with take-all disease severity in bread wheat Triticum aestivum | |
| Notsu et al. | Distribution of Botrytis isolates associated with onion gray-mold neck rot in Hokkaido, northern Japan | |
| JP7390736B2 (en) | Simultaneous detection method and primer kit for rot fungi | |
| CN114395617B (en) | LAMP (loop-mediated isothermal amplification) visual rapid detection method and application of powdery mildew of strawberry | |
| CN116377034A (en) | LAMP detection method for rapidly identifying two species of maize gray spot bacteria | |
| CN116103432B (en) | Clubroot disease resistance molecular marker, detection primer and application thereof | |
| Allawi | Isolation and Identification of Penicillium rubens from the Local Strain in Mosul, Iraq, and Investigation of Potassium Phosphate Effect on its Growth |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |