JP2016002005A - Purity detection method of strawberry f1 seeds by using crude extraction liquid of dna of strawberry seeds - Google Patents

Abstract

PROBLEM TO BE SOLVED: To perform DNA extraction from strawberry seeds in F1 purity detection using seeds as simply and safely as possible, and subsequently to provide a purity detection method of strawberry F1 seeds, achieving F1 purity detection at low cost.SOLUTION: A purity detection method of strawberry F1 seeds comprises the steps of: (1) preparing crude extraction liquid of DNA from strawberry seeds by crushing the strawberry seeds in an extraction liquid not containing organic solvent; (2) amplifying DNA using primers for SSR markers for identifying the breed and line of the strawberry by PCR using the crude extraction liquid of DNA as template; (3) detecting whether there is any amplification of the markers by electrophoresis; and (4) determining that the SSR markers are derived either from father or mother by repetition frequencies of the detected SSR markers, and thereby identifying whether the strawberry seeds are self-propagating seeds or F1 seeds.

Description

The present invention relates to a purity test method for strawberry F1 seeds using a strawberry seed DNA crude extract.

So far, various techniques have been developed to test the purity of F1 varieties using DNA markers.

For example, Patent Document 1 describes an invention for identifying a watermelon F1 variety using a synthetic oligonucleotide. More specifically, F1 seeds are seeded depending on whether or not an amplified product of 850 bp band is obtained by PCR using a specific synthetic oligonucleotide for DNA extracted from roots obtained after sowing of watermelon seeds. This is a method to distinguish between parents.

Patent Document 2 describes a hybrid seed determination method and a purity test method. More specifically, the presence or absence of DNA present in the mitochondria of rice in the maintenance line and the fertile recovery line and deleted in the mitochondria of the cytoplasmic male sterile line is examined by PCR. This is a method for determining whether rice seeds or the rice seedlings are hybrid.

Similarly, Patent Document 3 describes a method for simply discriminating rice BT male sterile cytoplasm from normal cytoplasm. More specifically, the presence or absence of DNA present in the normal cytoplasm but not in the BT male sterile cytoplasm is examined by PCR to determine the male sterile line (BT male sterile cytoplasm) and This is a method for identifying a maintenance line (normal cytoplasm).

As a DNA marker, a simple sequence repeat (SSR or “microsatellite”) marker is generally known in which a sequence consisting of about 2 to 4 bases is repeated several times to about 100 times. . This SSR marker is stable in amplification by PCR, and two or more allelic loci can be detected with a single marker. As an example of F1 seed test using this SSR marker, 200 SSR marker sets for detecting polymorphism among melon varieties have been developed (Non-patent Document 1).

Furthermore, a method for extracting seedling DNA and detecting it with two RFLP markers has been developed (Non-patent Document 2).

Strawberries are cultivated nationwide, and the total production is fifth in the crop. Compared with the world production situation, the production volume is 7th by country and the unit price is 1st, and the production value is 2nd after the United States. Strawberries generally grow seedlings by vegetative breeding by runners. However, the breeding of runners has a low burden of raising seeds and seeds, which has been a heavy burden on farmers. In order to overcome this situation, attempts have been made to develop seed breeding type F1 varieties. Seed breeding varieties have extremely high seed and seedling propagation efficiency, and have an advantage that seedlings that are not infected with pests can be easily obtained by obtaining seedlings from seeds. Furthermore, since it is an F1 variety, illegal copying of the variety is unlikely to occur, and the rights of the breeder can be easily protected.

Strawberry is an allotrophic plant that mixes mother and father strains and crosses them with insect media such as bees to collect F1 varieties. However, if the father's pollen is not pollinated at an appropriate timing to the mother's stigma, the mother's own pollen may be pollinated and become self-propagated seeds. Self-breeding individuals develop different traits from F1 individuals, such as smaller plants and fruits. Therefore, mixing of self-propagating seeds will degrade the quality of the seeds, so it is necessary to distinguish self-propagating individuals from F1 individuals.

However, it is difficult to discriminate the difference between F1 individuals and self breeding individuals at the seedling stage. is necessary. However, if the genotype is discriminated from the DNA extracted from the seed using the DNA marker, the degree of contamination of the self-propagating seed can be discriminated immediately after sowing.

As described above, there have been reports of F1 purity tests using seeds only for crops with relatively large seed sizes. This requires a certain amount of cost to extract and test DNA for each individual seed or seedling, so if the crop is not a large seed with a relatively high unit price, the test cost should be included in the seed price. This is because there are circumstances that cannot be done.

That is, cucurbitaceous crops such as melon, watermelon and cucumber have a large seed weight of 30-50g per 1000 grains and are distributed in the market at a relatively high unit price. On the other hand, the seed weight of strawberry is 0.67 g per 1000 grains, and it is expected that the seed unit price will be lowered from the above-mentioned cucurbitaceae crops when distributed to the market. Therefore, it is necessary to further reduce the cost of the F1 purity test.

On the other hand, strawberry varieties have hardly been cultivated so far, and no examples of F1 purity tests using DNA markers have been reported.

From a biological point of view, strawberries have a complex genome structure of octaploids. This is because many organisms have 8 sets of genomes compared to 2 sets of genomes (one set containing all the genetic information required by organisms) in somatic cells. Having more genome sets complicates the inheritance pattern, making it difficult to identify varieties and strains compared to diploid species. However, the inventors have already developed 45 types of SSR markers for identifying 128 types of strawberry varieties / lines centering on varieties cultivated in Japan (Non-patent Document 3).

Although DNA extraction can be performed from most tissues of plants, in practice, leaves are generally used. This is because tissues other than leaves are difficult to grind samples, and since many substances such as sugars and polyphenols are contained, it often takes time to purify DNA.

The F1 purity test is roughly divided into three steps: DNA extraction, PCR reaction, and genotyping by electrophoresis of PCR reaction products. In the F1 purity test, it is considered simplest to extract DNA directly from seeds, but DNA extraction from seeds is generally more laborious and costly than leaves for the reasons described above. There are commercially available DNA extraction kits (GM quicker <Nippon Gene>, DNeasy Plant Mini kit <QIAGEN>, etc.) for DNA extraction from seeds. When these kits are used, for example, they are ground in a seed mill. After that, it takes time to prepare the sample. In addition, there is an example in which a crude DNA extract is used for PCR reaction, but it is common to use phenols harmful to the human body for the extraction buffer (Non-patent Document 4).

In addition, in order to save the labor of DNA extraction, a direct PCR method has been developed in which a part of plant tissue is directly put into a PCR reaction solution to perform PCR, and several types of commercially available kits are sold (MightyAmp Trademarks) DNA Polymerase <Takara Bio>, PhilePlant Direct PCR Kit <Thermo scientific>, etc.). Although it is possible to simplify the inspection procedure by using these kits, it is difficult to use in terms of cost since the kit is expensive.

Japanese Patent Laid-Open No. 6-189964 Japanese Patent Laid-Open No. 10-286093 JP 2004-24141 A

SSR Marker that can be used for Melon F1 Seed Purity Test and Variety Identification (2004) (National Institute of Agricultural Sciences) / Results Information http://www.naro.affrc.go.jp/project/results/laboratory/vegetea/2004/ vegetea04-15.html) Development of seed purity test for cucumber F1 varieties by RFLP analysis of nuclear DNA, Matsuura et al., Horticultural Journal, 63 (2): 370-383, 1994 Isobe et al. (2013) DNA Research, 20 (1): 79-92. Simple DNA extraction method from legume seeds, potatoes, etc., analysis with RAPD markers, Hokkaido report summary (1997)

Therefore, the problem to be solved by the present invention is to solve the above-mentioned problems seen in the conventional F1 purity test using seeds, and to perform DNA extraction from strawberry seeds as easily and safely as possible. As a result, F1 purity test It is to provide a purity test for strawberry F1 seed at low cost.

The present inventor solved the above problems by using 45 kinds of SSR markers for identifying 128 strawberry varieties / lines developed so far, and examining DNA extraction methods and PCR conditions from strawberry seeds. The present invention has been completed.

That is, this invention has the following aspects.
[Aspect 1]
A purity test method for strawberry F1 seeds,
(1) preparing a crude DNA extract from strawberry seeds by crushing strawberry seeds in an extract containing no organic solvent;
(2) In a PCR reaction using a crude DNA extract as a template, a step of amplifying DNA with a primer for an SSR marker for strawberry variety / line identification;
(3) detecting the presence or absence of amplification of the marker by electrophoresis, and
(4) The number of repetitions of the detected SSR marker is used to determine whether the SSR marker is derived from a father or mother, thereby identifying whether the strawberry seed is a self-fertilized seed or an F1 seed The process of
The purity test method comprising:
[Aspect 2]
The purity test method according to embodiment 1, wherein the extract is a simple extract (composition: 20 mM Tris-HCl, pH 8.0, 100 mM NaCl, 5 mM EDTA, 0.1% SDS, 0.2 mg / ml Proteinase K) .
[Aspect 3]
The purity test method according to the aspect 1 or 2, wherein one strawberry seed is put into each hole of a 96-well PCR plate, and the strawberry seed is crushed in the extract poured therein.
[Aspect 4]
4. The purity test method according to any one of aspects 1 to 3, wherein the strawberry seed is tumbled and mixed overnight in sterile distilled water, and then the strawberry seed is crushed in the extract.
[Aspect 5]
The purity test method according to any one of Embodiments 1 to 4, wherein the number of cycles in the PCR reaction is 30 to 35.
[Aspect 6]
6. The purity test method according to embodiment 5, wherein the number of cycles in the PCR reaction is 33.
[Aspect 7]
The following primer sets:
(SSR marker: for FVES1230)
Forward primer: GATGATGGGTCTTCTTGCGT (SEQ ID NO: 1) and
Reverse primer: AGAGTTTTGATCGCCTCGAA (SEQ ID NO: 2) and / or (SSR marker: for FAES0107)
Forward primer: ACCCTGGAGGATCTGCTCTT (SEQ ID NO: 3) and
Reverse primer: CAGAGGCTAAAACAAGAAGGGA (SEQ ID NO: 4),
The purity test method according to any one of embodiments 1 to 6, wherein the SSR marker for cultivar / line identification of each strawberry is amplified using a strawberry.

Compared with the prior art, the method of the present invention has the following excellent features.
(1) The extract (buffer) used for DNA extraction from strawberry seeds does not contain an organic solvent such as phenol / chloroform, and is one kind.
(2) A crude DNA extract obtained by destroying seed tissue in the extract can be used for PCR.
(3) Taq polymerase used for PCR can be an inexpensive commercial product, and the PCR reaction solution used for each sample (one strawberry seed) requires only a small amount of about 5 μl in total. Reduction of verification cost can be realized.
(4) The number of PCR cycles is devised so that false positives are not detected even when a small amount of contamination occurs in the PCR reaction container, and the assay can be performed with high accuracy.

It is a photograph which shows the DNA extraction method from one strawberry seed (number in a figure shows each step number in a sentence). The result of real-time PCR is shown. Results of fluorescent fragment analyzer analysis of FAES0107 and FVES1230 using mother and father DNA are shown. The vertical axis represents the fluorescence intensity, and x1 and x343 represent the dilution rate. The fluorescence fragment analyzer analysis result of FAES0107 and FVES1230 using father's DNA is shown. The vertical axis represents the fluorescence intensity, and x1 and x343 represent the dilution rate.

The purity test method for the strawberry F1 seed has the following steps.
(1) preparing a crude DNA extract from strawberry seeds by crushing strawberry seeds in an extract containing no organic solvent;
(2) In a PCR reaction using a crude DNA extract as a template, a step of amplifying DNA with a primer for an SSR marker for strawberry variety / line identification;
(3) detecting the presence or absence of amplification of the marker by electrophoresis, and
(4) The number of repetitions of the detected SSR marker is used to determine whether the SSR marker is derived from a father or mother, thereby identifying whether the strawberry seed is a self-fertilized seed or an F1 seed The process of
Including said method.

Here, the extract used for DNA extraction from strawberry seeds in step (1) is characterized by not containing an organic solvent such as phenol / chloroform. Although there is no restriction | limiting in particular in the composition, For example, like "simple extract" described in the Example, buffers, such as Tris-HCl (pH 7.5-8.0 grade), NaCl, EDTA, SDS, And an extract containing an appropriate amount of a proteolytic enzyme and the like is preferable.

Strawberry seeds can be crushed in the extract by an appropriate means / method. For example, one strawberry seed is put in each hole of a 96-well PCR plate, and the strawberry seed is crushed by using an appropriate means such as a toothpick head or a pipette in the extracted solution. Can be crushed.

Before crushing the strawberry seed in the extract, the seed surface is washed with water and washed with water using an appropriate means known to those skilled in the art, for example, by tumbling in sterile distilled water overnight. It is preferable to make it soft beforehand.

In the PCR reaction using the crude DNA extract prepared in step (1), DNA (the marker present in the crude DNA extract) was prepared by the SSR marker primer for strawberry variety / line identification developed by the inventors. Amplify. In addition, when using for PCR reaction, according to the kind etc. of a strawberry seed, you may dilute a DNA rough extract suitably about 10-20 times.

For the SSR marker for strawberry variety / line identification, first use the marker that the parents of F1 seeds to be tested do not have the same size allele so that self-breeding of both father and mother can be easily denied during F1 test There is a need. Furthermore, it is preferable to select markers from the viewpoints of reproducibility of repetitive results, ease of allyl determination, few extra bands, uniformity of peak height between F1 heteroaryls, and the like. In addition, the primer set for amplification of each SSR marker can be appropriately designed and prepared by a person skilled in the art based on the surrounding base sequence containing each SSR marker in the chromosome.

In order to increase the accuracy of the purity test, it is preferable to use a plurality of SSR markers. Typical examples of the base sequence of the SSR marker for strawberry variety / line identification and the primer set for amplification of the SSR marker that can be used in the present invention include those described in Non-Patent Document 3. . Furthermore, the details of the SSR marker and the specific base sequence of the detection primer for the marker are disclosed on the website of Kazusa DNA Research Institute, the applicant of the present application (http: // vim. kazusa.or.jp/Strawberry). Specifically, the 45 types of SSR markers described in Non-Patent Document 3 are as follows.

Incidentally, as described in the Examples, “Strain 23” (Kagawa Prefecture, Mie Prefecture, Chiba Prefecture, and the Kyushu Okinawa Agricultural Research Center, Kyushu Okinawa Agricultural Research Center, 2014 Application for variety registration on Jan. 10. Variety registration application No. 28844. Name for application for variety registration was “Yotsuboshi”) For F1 seed testing, F. ananassa Since EST-derived FAES0107 and F.vesca EST-derived FVES1230 were good as SSR markers, the following primers were used to test the purity of strawberry F1 seeds.

The following primer sets:
(SSR marker: for FVES1230)
Forward primer: GATGATGGGTCTTCTTGCGT (SEQ ID NO: 1) and
Reverse primer: AGAGTTTTGATCGCCTCGAA (SEQ ID NO: 2) and / or (SSR marker: for FAES0107)
Forward primer: ACCCTGGAGGATCTGCTCTT (SEQ ID NO: 3) and
Reverse primer: CAGAGGCTAAAACAAGAAGGGA (SEQ ID NO: 4)

The number of cycles of PCR in the PCR reaction using the crude DNA extract is preferably in the range of 30 to 35 times, more preferably about 33 times, as a result of examination by real-time PCR, so that a very small amount of PCR is contained in the PCR reaction vessel. Even when contamination occurred, false positives were not substantially detected, and it was confirmed that the test can be performed with high accuracy. Other techniques / conditions in the PCR reaction can be appropriately set by those skilled in the art depending on the type of strawberry F1 seed, the type of SSR marker, the PCR reaction apparatus, and the like.

The PCR product obtained in step (2) is subjected to electrophoresis under appropriate conditions known to those skilled in the art, and the presence or absence of amplification of the marker by appropriate means such as fluorescence by using a primer labeled with a fluorescent dye. Can be detected.

When the SSR marker is detected in step (3), it is determined whether the SSR marker is derived from a father or a mother based on the number of repetitions of the SSR marker obtained based on the position of electrophoresis. Thus, it is possible to identify whether the strawberry seed used as a sample is a self-propagating seed or an F1 seed.

The “purity” of the strawberry F1 seed means the ratio of the number of seeds having the F1 genotype, and the value is, for example, the number of seeds having the F1 genotype / the total number of seeds whose genotype was found by the test. It can be obtained as follows. In addition, the seed which does not have a father's genotype by self-propagation corresponds to the seed which does not have F1 genotype.

Hereinafter, the present invention will be described with reference to examples. It should be noted that the technical scope of the present invention is not limited to the description of these examples, and modifications and corrections appropriately made by those skilled in the art based on these descriptions are also included in the present invention.

The F1 seed purity was verified using line 23 F1 seeds seeded at the Mie Agricultural Research Institute at multiple times (24 different seeding dates). Two markers, FVES1230 and FAES0107, were used as SSR markers in PCR. DNA was extracted from 96 samples of each seeding date as one repeat, and the test was repeated 3 times in total. The total number of seeds tested was 6912 (24 seeding days x 96 grains x 3 repetitions). From the above results, it was found that the purity of F1 seed of line 23 was 99,94%.

(1) DNA extraction (FIG. 1).
DNA extraction was performed according to the following protocol.
1. Strawberry seeds were placed in sterilized distilled water and gently mixed by inversion overnight.
2. Add 50 μl of a simple extract (composition: 20 mM Tris-HCl, pH 8.0, 100 mM NaCl, 5 mM EDTA, 0.1% SDS, 0.2 mg / ml Proteinase K) to a 96-well PCR plate, add a seed, and add the head of the toothpick. (When crushed, white fibers came out of the seeds and the solution became a little cloudy).
3. It was placed in a PCR apparatus and incubated at a temperature of 60 ° C. for 10 min. → 98 ° C. for 2 min.
4). After light mixing, the mixture was centrifuged at 4,000 rpm for 10 min., And the supernatant was clarified.
5. The supernatant was carefully collected so as not to suck the seed residue and transferred to another PCR plate.
6). The supernatant was diluted 10-fold with sterile distilled water and used for PCR.

(2) PCR
PCR was performed according to the following protocol. The polymorphism was detected by fluorescent fragment analysis using a primer pre-labeled with a fluorescent dye.
The total volume of the PCR solution is 5 μl, and the composition is 1x Buffer P (16 mM (NH ₄ ) ₂ SO ₄ , 67 mM Tris-HCl (pH 8.8), 0.1% BSA, 0.5% Tween 20, 0.5% PVP 25), 200 μM dNTP, 3 mM MgCl 2 0.4 μM primer mix (2% forward primer labeled with R6G by Sigma), 0.016 U / μl BIOTAQ (trademark) (BIOLINE), 0.2 μl / μl 10-fold diluted DNA solution.

The PCR reaction program was performed at 94 ° C for 2 minutes, followed by 33 cycles of 94 ° C for 30 seconds, 60 ° C for 30 seconds, 72 ° C for 45 seconds at 72 ° C for 10 minutes at 4 ° C. Polymorphism is detected by adding 0.5 μl of PCR product to 5 μl of loading mix (GeneScan ™ 500LIZ ™ dye Size Standard diluted 156 times with HiDi Formamide) and using a fluorescent fragment analyzer (ABI3730). It was.

Of the 6912 seeds that were tested, 4 seeds were clearly determined to be self-propagating. In addition, 19 grains could not be determined.

The number of PCR cycles of 33 in the above example was set as follows.
The sensitivity of the fluorescent fragment analyzer (ABI3730) was high, and it was thought that a false positive band might be detected in samples with a small amount of DNA extraction when contamination of a small amount of sample occurred during sample preparation. Therefore, the template DNA used for the normal PCR reaction was diluted 343 or 2401 times using the FVES1230 marker, and the detection sensitivity of trace amounts of DNA was assayed by real-time PCR (FIG. 2). As a result, amplification similar to that of undiluted DNA was detected in part of the 343-fold dilution in 40 cycles, suggesting that a peak may be seen in part of the 2401-fold dilution. On the other hand, at the 33th cycle, the normal amount of template DNA would yield a sufficient amount of amplification product for detection, and a small amount of DNA would have yielded amplification products below the detection limit. The number of PCR cycles was 33.

In addition, when a small amount of paternal DNA was contaminated in the maternal homosample at this number of cycles, it was confirmed whether there was an effect on the determination. As a result, no paternal peak was observed in the FVES1230 and FAES0107 markers (FIG. 3). Subsequently, PCR and Fragment analyzes were performed using only diluted paternal DNA, assuming that trace contamination occurred when there was no allyl-containing DNA due to null allele or DNA extraction failure. In the diluted sample, the peak dropped to a height that was indistinguishable from noise, and no peak was detected (FIG. 4). From the above results, it was considered that false positives due to trace contamination were unlikely to affect the results in 33 cycles of PCR for both FAES0107 and FVES1230.

As already described, strawberry seed breeding varieties have superior features compared to conventional runner breeding. At present, breeding places of public institutions nationwide are collaborating to grow and cultivate seed breeding varieties, and seed breeding varieties are expected to become the standard for strawberry varieties instead of vegetative breeding varieties. Already in Chiba Prefecture, the seed breeding type F1 variety “Chiba F-1” was first grown in Japan in 2011. In addition, it is expected that private industry will enter and create new industries such as seed production and distribution.

Since the method of the present invention has the advantages as described in the “Effects of the Invention” column, the newly developed seed breeding type F1 varieties such as “Chiba F-1” Purity testing can be performed on a commercial basis, and can greatly contribute to the spread of strawberry F1 seeds.

Claims (7)

A purity test method for strawberry F1 seeds,
(1) preparing a crude DNA extract from strawberry seeds by crushing strawberry seeds in an extract containing no organic solvent;
(2) In a PCR reaction using a crude DNA extract as a template, a step of amplifying DNA with a primer for an SSR marker for strawberry variety / line identification;
(3) detecting the presence or absence of amplification of the marker by electrophoresis, and
(4) The number of repetitions of the detected SSR marker is used to determine whether the SSR marker is derived from a father or mother, thereby identifying whether the strawberry seed is a self-fertilized seed or an F1 seed The process of
The purity test method comprising: The purity test according to claim 1, wherein the extract is a simple extract (composition: 20 mM Tris-HCl, pH 8.0, 100 mM NaCl, 5 mM EDTA, 0.1% SDS, 0.2 mg / ml Proteinase K). Law. The purity test method according to claim 1 or 2, wherein one strawberry seed is put into each hole of a 96-well PCR plate, and the strawberry seed is crushed in the extract poured therein. The purity test method according to any one of claims 1 to 3, wherein the strawberry seeds are crushed and mixed overnight in sterile distilled water, and then the strawberry seeds are crushed in the extract. The purity test method according to any one of claims 1 to 4, wherein the number of cycles in the PCR reaction is 30 to 35 times. The purity test method according to claim 5, wherein the number of cycles in the PCR reaction is 33 times. The following primer sets:
(SSR marker: for FVES1230)
Forward primer: GATGATGGGTCTTCTTGCGT (SEQ ID NO: 1) and
Reverse primer: AGAGTTTTGATCGCCTCGAA (SEQ ID NO: 2) and / or (SSR marker: for FAES0107)
Forward primer: ACCCTGGAGGATCTGCTCTT (SEQ ID NO: 3) and
Reverse primerr: CAGAGGCTAAAACAAGAAGGGA (SEQ ID NO: 4),
The purity test method according to any one of Claims 1 to 6, wherein the SSR marker for cultivar / line identification of each strawberry is amplified using a strawberry.