JP2010094070A - Method for discriminating blueberry cultivar - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a means for quickly and simply discriminating various blueberry cultivars by an SSR marker having high discrimination ability with excellent precision. <P>SOLUTION: The method for discriminating a blueberry cultivar in a sample to be tested includes using a DNA extracted from a sample to be tested as a template, amplifying one kind or a plurality of kinds of specific SSR markers present on a blueberry chromosome by PCR and analyzing an amplified fragment length. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to a method for identifying blueberry varieties. More particularly, the present invention relates to a method for identifying blueberry varieties using simple sequence repeats (hereinafter referred to as “SSR”) markers.

  One method for identifying plant varieties at the DNA level is to use SSR markers. SSRs are simple sequence repeats of several bases found in untranslated regions that do not encode proteins in genomic DNA, and the number of repeats is frequently seen among closely related varieties. Therefore, it is suitable as a DNA marker for variety identification. Therefore, the technology for identifying plant varieties using the SSR marker is used in crops such as rice, rush, peanut, and pear.

  There are also some reports regarding SSR markers for blueberries (Non-Patent Documents 1 to 4). Non-Patent Document 1 finds SSR markers from 30 microsatellite loci isolated from gene sequences of expressed sequence tag (EST) and high bush blueberry (Vaccinium corymbosum L), and polymorphisms of these SSR markers Evaluated with 11 tetraploid blueberry varieties. Non-Patent Document 2 specifies the genotypes of 69 strains of wild and cultivated highbush blueberries using 28 SSR markers. Non-Patent Document 3 reports that, as a result of analyzing SSR loci using 22 varieties of Highbush Blueberries, a number of alleles were observed for tetraploid Highbush Blueberries in four SSR markers. Yes. However, the SSR markers used in them can only elucidate and evaluate the systematic relationship in tetraploid highbush blueberry blue. Furthermore, as in Non-Patent Document 2, Non-Patent Document 4 has succeeded in the phylogenetic analysis of blueberries using the SSR marker, but the SSR marker actually used shows polymorphism but has too many alleles. It was suggested that it was difficult to distinguish between varieties.

  As described above, although there are examples of attempts to identify blueberry varieties using SSR markers, it is not possible to individually identify multiple varieties of blueberries, and it cannot be said to be a practical level. In general, cultivar blueberries as opposed to wild-type blueberries are more difficult to discern because reduced genetic differences are observed. In addition, blueberries have a high polyploidy of 2-6 diploids, and a large number of peak values appear depending on the number of bases of the SSR marker amplified by the primer, so that polymorphism analysis of fragments by electrophoresis is complicated. It is expected to be. Therefore, at present, the establishment of high-precision and practical blueberry variety identification technology using SSR markers has not been established.

P.S.Boches et al., Microsatellite markers for Vaccinium from EST and genomic libraries, Molecular Ecology Notes, 5: 657-660 (2005) P.S.Boches et al., Genetic Diversity in the Highbush Blueberry Evaluated with Microsatellite Markers, J. Amer. Soc. Hort. Sci., 131 (5): 674-686 (2006) Satoshi Kushikawa et al., Development of SSR marker in blueberry (Vaccinium spp.), Horticultural Journal, 75 (Attachment 2), p. 172 (2006) Isao Akagi et al. Phylogenetic classification of blueberries using known genetic information, Horticultural Journal, 75 (2), p. 174 (2006)

  It is an object of the present invention to provide means for accurately and quickly identifying various blueberry varieties with a highly discriminating SSR marker.

  As a result of intensive studies to solve the above problems, the present inventors selected SSRs effective for blueberry variety identification from SSRs on the blueberry genome registered in the existing database and newly discovered SSRs. The inventors succeeded in designing a primer for amplifying the SSR. Furthermore, by creating a database that correlates blueberry varieties with the amplified fragment length polymorphism of the obtained SSR marker, and efficiently combining one or more types of markers, a large number of major varieties of blueberries can be accurately identified. And it succeeded in identifying quickly and easily, and came to complete this invention.

That is, the present invention includes the following inventions.
[1] The SSR marker is amplified by PCR using DNA extracted from a test sample as a template using one or more primer pairs (A) to (K) below, and the length of the amplified fragment is analyzed. A method for identifying a blueberry variety, comprising identifying a blueberry variety in a test sample.
(A) SSR marker Vacc.01 amplification primer pair comprising an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 1 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 2
5'-gacatgtcttcagagttctcctc-3 '(SEQ ID NO: 1)
5'-gcgtgagggcacaaagctct-3 '(SEQ ID NO: 2)

(B) SSR marker Vacc.03 amplification primer pair comprising an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 3 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 4
5'-gagaagtagagtttagaagctctagaattca-3 '(SEQ ID NO: 3)
5'-tctccaaccccagtaattaagccca-3 '(SEQ ID NO: 4)

(C) SSR marker Vacc. 04 primer pair consisting of an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 5 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 6
5'-tttcattactgctatcgccactcct-3 '(SEQ ID NO: 5)
5'-gtctgggataaatacaaacccagttaga-3 '(SEQ ID NO: 6)

(D) An SSR marker Vacc.05 amplification primer pair comprising an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 7 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 8
5'-gtcatgaccagtaatcaaaccgcgt-3 '(SEQ ID NO: 7)
5'-aactagctagtggaaacaaccgggtt-3 '(SEQ ID NO: 8)

(E) An SSR marker Vacc.06 amplification primer pair comprising an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 9 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 10
5'-gtgtcagagggcacattcatg-3 '(SEQ ID NO: 9)
5'-cggctcgtttgcagcctagt-3 '(SEQ ID NO: 10)

(F) SSR marker Vacc.09 amplification primer pair comprising an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 11 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 12
5'-ccttcctgcntgaagagaaaaattgca-3 '(SEQ ID NO: 11)
5'-tgaaacccctgaaatcgtactctct-3 '(SEQ ID NO: 12)

(G) SSR marker Vacc.17 primer pair for amplification comprising an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 13 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 14
5'-gttgaaaagttcgttttggtccctcct-3 '(SEQ ID NO: 13)
5'-ctccgctgtgttgcttttggattttaga-3 '(SEQ ID NO: 14)

(H) A primer pair for amplification of SSR marker Vacc.19, comprising an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 15 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 16
5'-ggtacaaaaccctcgaacagaatctca-3 '(SEQ ID NO: 15)
5'-gtgtataacagaagactgctttgctgga-3 '(SEQ ID NO: 16)

(I) A primer pair for amplification of SSR marker Vacc.22 comprising an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 17 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 18
5'-cacattcactcaccatgttgcaacg-3 '(SEQ ID NO: 17)
5'-gtttgagatttgaccatgccttctgatgt-3 '(SEQ ID NO: 18)

(J) SSR marker Vacc.23 amplification primer pair comprising an oligonucleotide primer comprising the nucleotide sequence shown in SEQ ID NO: 19 and an oligonucleotide primer containing the nucleotide sequence shown in SEQ ID NO: 20
5'-caacgcatttacaccatccggtaaga-3 '(SEQ ID NO: 19)
5'-gttcaagtcaacacagaccccattct-3 '(SEQ ID NO: 20)

(K) SSR marker Vacc.24 primer pair for amplification comprising an oligonucleotide primer comprising the nucleotide sequence shown in SEQ ID NO: 21 and an oligonucleotide primer containing the nucleotide sequence shown in SEQ ID NO: 22
5'-caaagggatagctcaaagggtcttttca-3 '(SEQ ID NO: 21)
5'-gaattttgcgttcgtccgcagatatga-3 '(SEQ ID NO: 22)

[2] The method for identifying a blueberry variety according to [1], comprising the following steps.
(1) Amplifying each SSR marker by PCR using DNA extracted from a standard blueberry variety as a template and using each of the primer pairs (A) to (K) according to claim 1
(2) A step of analyzing the amplified fragment length of each SSR marker amplified in step (1) by electrophoresis, and determining an amplified fragment length serving as an identification index for each SSR marker for each variety
(3) A step of constructing a database consisting of a data set in which a standard sample blueberry variety and an amplified fragment length as an identification index in each SSR marker determined in step (2) are associated.
(4) Amplifying the corresponding SSR marker by PCR using DNA extracted from the test sample as a template and using one or more of the primer pairs (A) to (K) according to claim 1 Identifying the blueberry varieties contained in the test sample by comparing the amplified fragment length with the database constructed in step (3)

[3] The method for identifying a blueberry variety according to [2], wherein the blueberry variety of the standard sample is as follows.
"Woodard", "Essel", "Ozark Blue", "Austin", "Garden Blue", "Gulf Coast", "Cooper", "Gloria", "Cape Fur", "Cobill", "South Moon", " Sapphire, Summit, Sharp Blue, George Agem, Spartan, Suwanee, Darrow, Tiff Blue, Dixie, Duke, Delight, Trow, “Pearl River”, “Powder Blue”, “Patriot”, “Baldwin”, “Biloxi”, “Bright Blue”, “Blue Crop”, “Blue Pearl”, “Blue Bell”, “Blue Ridge”, “Floda” Blue, Florida Star, Bonita Blue, Homebell, Myers, Magnoia, Ribale "Red Pearl", "No.19", "No.35"

[4] The method for identifying a blueberry variety according to [2], wherein the amplified fragment length serving as an identification index in each SSR marker is an amplified fragment length showing the strongest signal (maximum amplified fragment length).
[5] Using the DNA extracted from the test sample as a template, the SSR marker Vacc.01 and the SSR marker Vacc.03 are amplified, the maximum amplified fragment length of the SSR marker is 127 to 128 bp, and the SSR marker Vacc.03 The blueberry variety identification method according to [4], wherein the blueberry variety in the test sample is determined to be “No. 35” using as an indicator that the maximum amplified fragment length is 134 bp or 137 bp.

[6] The method for identifying a blueberry variety according to any one of [2] to [5], wherein the electrophoresis method is a capillary electrophoresis method.
[7] The method for identifying a blueberry variety according to [6], wherein a fluorescent label for analyzing the length of an amplified fragment by capillary electrophoresis is attached to the 5 ′ end of any one of the primer pairs.

[8] A primer set for identifying blueberry varieties comprising the following primer pairs (A) to (K):
(A) SSR marker Vacc.01 amplification primer pair comprising an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 1 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 2
5'-gacatgtcttcagagttctcctc-3 '(SEQ ID NO: 1)
5'-gcgtgagggcacaaagctct-3 '(SEQ ID NO: 2)

(B) SSR marker Vacc.03 amplification primer pair comprising an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 3 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 4
5'-gagaagtagagtttagaagctctagaattca-3 '(SEQ ID NO: 3)
5'-tctccaaccccagtaattaagccca-3 '(SEQ ID NO: 4)

(C) SSR marker Vacc. 04 primer pair consisting of an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 5 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 6
5'-tttcattactgctatcgccactcct-3 '(SEQ ID NO: 5)
5'-gtctgggataaatacaaacccagttaga-3 '(SEQ ID NO: 6)

(D) An SSR marker Vacc.05 amplification primer pair comprising an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 7 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 8
5'-gtcatgaccagtaatcaaaccgcgt-3 '(SEQ ID NO: 7)
5'-aactagctagtggaaacaaccgggtt-3 '(SEQ ID NO: 8)

(E) An SSR marker Vacc.06 amplification primer pair comprising an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 9 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 10
5'-gtgtcagagggcacattcatg-3 '(SEQ ID NO: 9)
5'-cggctcgtttgcagcctagt-3 '(SEQ ID NO: 10)

(F) SSR marker Vacc.09 amplification primer pair comprising an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 11 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 12
5'-ccttcctgcntgaagagaaaaattgca-3 '(SEQ ID NO: 11)
5'-tgaaacccctgaaatcgtactctct-3 '(SEQ ID NO: 12)

(G) SSR marker Vacc.17 primer pair for amplification comprising an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 13 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 14
5'-gttgaaaagttcgttttggtccctcct-3 '(SEQ ID NO: 13)
5'-ctccgctgtgttgcttttggattttaga-3 '(SEQ ID NO: 14)

(H) A primer pair for amplification of SSR marker Vacc.19, comprising an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 15 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 16
5'-ggtacaaaaccctcgaacagaatctca-3 '(SEQ ID NO: 15)
5'-gtgtataacagaagactgctttgctgga-3 '(SEQ ID NO: 16)

(I) A primer pair for amplification of SSR marker Vacc.22 comprising an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 17 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 18
5'-cacattcactcaccatgttgcaacg-3 '(SEQ ID NO: 17)
5'-gtttgagatttgaccatgccttctgatgt-3 '(SEQ ID NO: 18)

(J) SSR marker Vacc.23 amplification primer pair comprising an oligonucleotide primer comprising the nucleotide sequence shown in SEQ ID NO: 19 and an oligonucleotide primer containing the nucleotide sequence shown in SEQ ID NO: 20
5'-caacgcatttacaccatccggtaaga-3 '(SEQ ID NO: 19)
5'-gttcaagtcaacacagaccccattct-3 '(SEQ ID NO: 20)

(K) SSR marker Vacc.24 primer pair for amplification comprising an oligonucleotide primer comprising the nucleotide sequence shown in SEQ ID NO: 21 and an oligonucleotide primer containing the nucleotide sequence shown in SEQ ID NO: 22
5'-caaagggatagctcaaagggtcttttca-3 '(SEQ ID NO: 21)
5'-gaattttgcgttcgtccgcagatatga-3 '(SEQ ID NO: 22)

[9] A primer set for identifying blueberry varieties comprising a primer pair that amplifies the SSR of any of the following (P1) to (P5).
(P1) SSR consisting of ct repeats present at positions 100 to 117 of the base sequence of SSR marker Vacc.17 shown in SEQ ID NO: 23
(P2) SSR consisting of ctt repeats present at positions 71 to 88 of the base sequence of SSR marker Vacc.19 shown in SEQ ID NO: 24
(P3) SSR consisting of ct repeats present at positions 179 to 206 of the base sequence of SSR marker Vacc.22 shown in SEQ ID NO: 25
(P4) SSR consisting of ga repeats present at positions 575 to 582 of the base sequence of the SSR marker Vacc.23 shown in SEQ ID NO: 26, SSR consisting of ga repeats existing at positions 586 to 593 of the base sequence, SSR consisting of ga repeats at positions 627 to 646 of the base sequence
(P5) SSR consisting of ct repeats present at positions 718 to 725 of the base sequence of the SSR marker Vacc.24 shown in SEQ ID NO: 27, and SSR consisting of ct repeats present at positions 745 to 760 of the base sequence
[10] A kit comprising the primer set for identifying a blueberry variety according to [8] or [9].

  According to the present invention, a method for identifying a blueberry variety using an SSR marker and a primer set used therefor are provided. According to the method for identifying blueberry varieties of the present invention, blueberry varieties can be identified with high accuracy even among closely related varieties. Further, even when a processed blueberry product is used as a sample, the same level of identification accuracy as that obtained when a blueberry tissue is used is obtained, and it is also effective for identifying blueberry varieties in the distribution stage. Furthermore, by constructing a database that correlates standard blueberry varieties and SSR marker amplified fragment length polymorphism types, multiple varieties of test samples can be comprehensively and quickly identified. Therefore, the blueberry variety identification means of the present invention is useful as a tool for protecting excellent new varieties, forgery detection, and branding.

  The present invention uses DNA extracted from a test sample as a template, amplifies one or more specific SSR markers present on the blueberry chromosome by PCR, analyzes the amplified fragment length, The present invention relates to a method for identifying a blueberry variety, characterized by identifying a blueberry variety.

Examples of the specific SSR marker used in the method of the present invention include the following.
(1) Vacc.01 (NCBI: AY762683 ; Boches, PS, Bassil, NV and Rowland, LJ, Mol. Ecol. Notes 5 (3), 657-660 (2005))
Repeat motif: (GT) ₈ + (GA) ₂₃

(2) Vacc. 03 (NCBI: AY762682 ; Boches, PS, Bassil, NV and Rowland, LJ, Mol. Ecol. Notes 5 (3), 657-660 (2005))
Repeat motif: (CT) ₁₇

(3) Vacc. 04 (NCBI: AY762684 ; Boches, PS, Bassil, NV and Rowland, LJ, Mol. Ecol. Notes 5 (3), 657-660 (2005))
Repeat motif: (CT) ₁₆ + (CT) ₁₂

(4) Vacc. 05 (NCBI: AY762681 ; Boches, PS, Bassil, NV and Rowland, LJ, Mol. Ecol. Notes 5 (3), 657-660 (2005))
Repeat motif: (GAA) ₁₅

(5) Vacc.06 (NCBI: AY762678 ; Boches, PS, Bassil, NV and Rowland, LJ, Mol. Ecol. Notes 5 (3), 657-660 (2005))
Repeat motif: (CT) ₁₄

(6) Vacc. 09 (NCBI: AY762685 ; Boches, PS, Bassil, NV and Rowland, LJ, Mol. Ecol. Notes 5 (3), 657-660 (2005))
Repeat motif: (CT) ₂₂ + (CA) ₁₁

(7) Vacc.17
Repeat motif: (CT) ₉
(8) Vacc.19
Repeat motif: (CTT) ₆
(9) Vacc.22
Repeat motif: (CT) ₁₄

(10) Vacc.23
Repeat motif: (GA) ₄ + (GA) ₄ + (GA) ₁₀
(11) Vacc.24
Repeat motif: (CT) ₄ + (CT) ₈

  Among the above SSR markers, Vacc.01, Vacc.03, Vacc.04, Vacc.05, Vacc.06, and Vacc.09 were obtained using Vaccinium corymbosum as a material, PS Boches et al. Has already been reported. The sequence information can be obtained from the registration number of the database shown above. Also, Vacc. 17 (SEQ ID NO: 23, FIG. 1), Vacc. 19 (SEQ ID NO: 24, FIG. 2), Vacc. 22 (SEQ ID NO: 25, FIG. 3), Vacc. 23 (SEQ ID NO: 26, FIG. 4), Five types of Vacc.24 (SEQ ID NO: 27, FIG. 5) were newly obtained by the present inventors using Vaccinium spp. As a material by the RAPD (Random Amplified Polymorphic DNA) method.

  In the present invention, “SSR” refers to a simple repetitive sequence of a specific 2 to 10 bases, preferably 2 to 4 bases. An SSR whose number of repeats varies depending on the variety or strain can serve as a DNA marker for identifying the variety. The “SSR-specific sequence” refers to a sequence that is adjacent to both ends of the SSR and includes a primer and is specific to the SSR. In addition, “SSR marker” refers to a site comprising “SSR” and “SSR-specific sequence” and comprising a sequence that can be used as a DNA marker for variety identification. In gene databases such as GenBank, SSR sequences are registered as SSR markers together with SSR-specific sequences.

  As a primer for amplifying the above SSR marker, a 10 to 40 bp, preferably 20 to 30 bp continuous oligo complementary to the base sequence located on both sides (forward, reverse) across the repetitive sequence portion of SSR Nucleotides can be used. The primer is preferably set based on an SSR-specific sequence, but a part of the primer may contain an SSR repetitive sequence. That is, in the present invention, “amplifying DNA” means that amplification is performed using a primer set based on an SSR-specific sequence as described above. Including the sequence of

Primer design can be performed using commercially available software (for example, GENETYX; Software Development Co., Ltd.). Examples of primers that are newly designed by the present inventors and that can be preferably used for amplification of the specific SSR marker are as follows.
(Primer pair for Vacc.01 marker amplification)
Vacc.01-F: GACATGTCTTCAGAGTTCTCCTC (SEQ ID NO: 1)
Vacc.01-R: GCGTGAGGGCACAAAGCTCT (SEQ ID NO: 2)
(Primer pair for Vacc.03 marker amplification)
Vacc.03-F: GAGAAGTAGAGTTTAGAAGCTCTAGAATTCA (SEQ ID NO: 3)
Vacc.03-R: TCTCCAACCCCAGTAATTAAGCCCA (SEQ ID NO: 4)
(Vacc.04 marker amplification primer pair)
Vacc.04-F: TTTCATTACTGCTATCGCCACTCCT (SEQ ID NO: 5)
Vacc.04-R: GTCTGGGATAAATACAAACCCAGTTAGA (SEQ ID NO: 6)
(Vacc.05 marker amplification primer pair)
Vacc.05-F: GTCATGACCAGTAATCAAACCGCGT (SEQ ID NO: 7)
Vacc.05-R: AACTAGCTAGTGGAAACAACCGGGT (SEQ ID NO: 8)
(Primer pair for Vacc.06 marker amplification)
Vacc.06-F: GTGTCAGAGGGCACATTCATG (SEQ ID NO: 9)
Vacc.06-R: CGGCTCGTTTGCAGCCTA (SEQ ID NO: 10)
(Primer pair for Vacc.09 marker amplification)
Vacc.09-F: CCTTCCTGCNTGAAGAGAAAAATTGCA (SEQ ID NO: 11)
Vacc.09-R: TGAAACCCCTGAAATCGTACTCTCT (SEQ ID NO: 12)
(Primer pair for Vacc.17 marker amplification)
Vacc.17-F: GTTGAAAAGTTCGTTTTGGTCCCTCCT (SEQ ID NO: 13)
Vacc.17-R: CTCCGCTGTGTTGCTTTTGGATTTTAGA (SEQ ID NO: 14)
(Primer pair for Vacc.19 marker amplification)
Vacc.19-F: GGTACAAAACCCTCGAACAGAATCTCA (SEQ ID NO: 15)
Vacc.19-R: GTGTATAACAGAAGACTGCTTTGCTGGA (SEQ ID NO: 16)
(Vacc.22 marker amplification primer pair)
Vacc.22-F: CACATTCACTCACCATGTTGCAACGT (SEQ ID NO: 17)
Vacc.22-R: GTTTGAGATTTGACCATGCCTTCTGATGT (SEQ ID NO: 18)
(Vacc.23 marker amplification primer pair)
Vacc.23-F: CAACGCATTTACACCATCCGGTAAGA (SEQ ID NO: 19)
Vacc.23-R: GTTCAAGTCAACACAGACCCCATTCT (SEQ ID NO: 20)
(Primer pair for Vacc.24 marker amplification)
Vacc.24-F: CAAAGGGATAGCTCAAAGGGTCTTTTCA (SEQ ID NO: 21)
Vacc.24-R: GAATTTTGCGTTCGTCCGCAGATATGA (SEQ ID NO: 22)

The Vacc.17, Vacc.19, Vacc.22, Vacc.23, and Vacc.24 marker amplification primer pairs are not limited to the above primer pairs, and any of the following (P1) to (P5) It may be a primer pair that amplifies SSR.
(P1) SSR consisting of ct repeat (ctctctctctctctctctct: SEQ ID NO: 28) present at positions 100 to 117 of the base sequence of SSR marker Vacc.17 shown in SEQ ID NO: 23
(P2) SSR consisting of ctt repeat (cttcttcttcttcttctt: SEQ ID NO: 29) present at positions 71 to 88 of the base sequence of SSR marker Vacc.19 shown in SEQ ID NO: 24
(P3) SSR consisting of ct repeats (ctctctctctctctctctctctctctctct: SEQ ID NO: 30) present at positions 179 to 206 of the base sequence of SSR marker Vacc.22 shown in SEQ ID NO: 25
(P4) SSR consisting of ga repeat (gagagaga: SEQ ID NO: 31) present at positions 575 to 582 of the base sequence of SSR marker Vacc.23 shown in SEQ ID NO: 26, present at positions 586 to 593 of the base sequence SSR consisting of ga repeat (gagagaga: SEQ ID NO: 32), SSR consisting of ga repeat (gagagagagagagagagaga: base sequence 33) existing at positions 627 to 646 of the base sequence
(P5) SSR consisting of ct repeat (ctctctct: SEQ ID NO: 34) present at positions 718 to 725 of the base sequence of SSR marker Vacc.24 shown in SEQ ID NO: 27, present at positions 745 to 760 of the base sequence SSR consisting of ct repeats (ctctctctctctctct: SEQ ID NO: 35)

  Oligonucleotides that serve as primers can be synthesized using methods commonly known in the art as methods for synthesizing oligonucleotides, such as the phosphotriethyl method, phosphodiester method, etc., using a commonly used automatic DNA synthesizer. is there. The oligonucleotide may have a labeling substance at the 5 'end or 3' end for easy detection. The labeling substance may be any of a fluorescent dye, a radioisotope, an organic compound such as digoxigenin and biotin, but a fluorescent dye is preferred from the viewpoint of sensitivity.

In the present invention, the term “blueberry” refers to a deciduous or evergreen shrub or half-high tree fruit tree native to the United States that belongs to the family Aceraceae ( Ericaceae ), the genus Vaccinium , and the cyanococus section (or blueberry section; Cyanococcus ). There are approximately 6 types of blueberries, but the most important in fruit gardening are Rabbiteye blueberry ( V. ashei Reade , V. virgatum Aiton ), Northern high bush blueberry ( Vaccinium corymbosum ), Southern high bush blueberry ( Vaccinium darrowii ) There are three types. Therefore, the blueberry varieties that can be identified using the method of the present invention are mainly classified into rabbit eye blueberries, northern high bush blueberries, southern high bush blueberries, but are classified as low bush blueberries ( Vaccinium angustifolium ). Are also included. Specific examples include the following blueberry varieties, but are not limited thereto.

  Examples of rabbit eye blueberries include Woodard, Essel, Austin, Gloria, Delight, Powder Blue, Baldwin, Bright Blue, Pearl Blue, Blue Bell, Bonita Blue, Home Bell, and Red Pearl.

  Northern Highbush Blueberries include Early Blue, Waymouth, Collins, Spartan (Spartan), Berkeley, Blue Jay, Blu-ray, Harvard, Late Blue, Blue Crop, Cobill, Darrow, Dewook (Duke), Crotone, Bruta, Patriot, Blue Haven, Blue Gold, Sunrise, Hayabaya-sato, Ogoshi, Blue Chip, Mieda, Echota, Toro (Trow), Carla's Choice, Blue Crop, Legacy, Shayera, Bonus, Vendor, Chandler, Nelson, Amakoshi, Jersey, Louvel, Elizabeth, Darones, Dixie, Late Blue, Elionette, Cape Fur and so on.

  Southern Highbush Blueberries include, for example, O'Neill, Florida Star, Florida Blue, Cape Fur, Florida Sapphire, Florida Blue, Cooper, Millenia, Emerald, Sharp Blue, Braden, Biloxi, Blue Ridge, South Moon, Misty, Georgia Gym, Daplin, Avon Blue, Magnoia, Sunshine Blue, Summit, Pearl River, Ozaku Blue, Gulf Coast, Florida Sapphire, Georgia Gym, Florida Star, Ribail (registered trademark) and the like.

  Lowbush blueberries include chigect, bronzewick, bromidon and the like.

  The variety identification in the present invention can be widely applied to blueberries, and it is also possible to identify rabbit eye blueberries that have been difficult with SSR markers. Among them, the new breeding lines “No. 19” and “No. 35” by the present inventors are excellent varieties having high antioxidant activity in leaves, and are useful from the viewpoint of variety protection. These two varieties contain more functional components in their leaves than home bells, and for example, they can be expected to suppress hepatitis C virus production (Japanese Patent Application Laid-Open No. 2007-119398).

A new breed of rabbit eye blueberry ( Vaccinium ashei ) "No.19" was developed by the National University Corporation Miyazaki University and has the following characteristics.
(i) A selected line grown for use as a processed food of leaves.
(ii) Medium vigor and low fruit and leaf productivity.
(iii) Flowering from late March to early April and matures from late July to early August. It is at the same time as Essel, the parent variety. The fruit is medium in size.
(iv) Can be easily propagated by cuttings.

Moreover, a new variety "No.35" of rabbit eye blueberry ( Vaccinium ashei ) is a variety developed by Miyazaki University, which has the following characteristics.
(i) A new variety grown for use as a processed food of leaves.
(ii) Strong tree vigor and high leaf productivity.
(iii) Flowering from late March to early April and matures from late July to early August. It is the same period as the home varieties home bell. The fruit is rather small and has little bloom.
(iv) Can be easily propagated by cuttings.

  “No. 19” is a new variety selected and nurtured from the late-pollinated generation of Essel, and “No. 35” is a new variety selected and cultivated from the late-pollinated generation of Homebell. “No.19” and “No.35” are confirmed and preserved by the National University Corporation Miyazaki University, Faculty of Agriculture, Field Science Education and Research Center (Kihana Field). (1-8 Gakuen Kanidai Nishi, Miyazaki City, Miyazaki Prefecture 889-2192)

  Further, in the present invention, “identification of blueberry varieties” not only specifies which varieties are blueberry varieties, but also includes determination of parental varieties in hybrid varieties, confirmation of hybrids, and determination of mutant individuals Demonstrate the concept. Note that the blueberry varieties in the present invention include not only the blueberry varieties for which varieties are registered or have been applied for, but also the blueberry varieties for which no varieties have been registered or have been applied for. In addition, a blueberry belonging to a certain blueberry variety includes a pure individual of the blueberry variety, but in addition to this, it is a new blueberry line created using the blueberry variety as an original variety and is shown between the original variety. Lines with little difference in characteristics (for example, offspring lines with the blueberry variety as a parent strain) are also included.

  Depending on the variety to be identified, the number of varieties to be identified, and the purpose of identification, the specific SSR marker may be a single type or a combination of multiple types without using all SSR markers. May be. It is preferable to distinguish between closely related varieties by combining a plurality of types of SSR markers so that the varieties can be more accurately identified. For example, two types of Vacc.01 and Vacc.17 may be used for the true / false determination of “No.19”, and Vacc.01 and Vacc.3, Two types such as Vacc.1 and Vacc.4 may be used. However, in the target area of the variety to be identified, depending on the type of the cultivated variety, it can be handled by using any one type of SSR marker. Further, when determining the type of the test object when the test target is unknown, four sets of Vacc.01, Vacc.03, Vacc.04, and Vacc.09 may be used as a set.

The SSR markers and their combinations used to identify the main varieties of blueberries are as follows.
Woodard: Vacc.04-Vacc.09, Vacc.03-Vacc.09
Essel: Vacc.03-Vacc.04, Vacc.03-Vacc.09
Aozaku Blue: Vacc.01-Vacc.04, Vacc.01-Vacc.09, Vacc.04-Vacc.09 and others Austin: Vacc.01
Garden Blue: Vacc.01
Gulf Coast: Vacc.17
Cooper: Vacc.03-Vacc.04
Gloria: Vacc.01-Vacc.04, Vacc.01-Vacc.09
Cape Fur: Vacc.01-Vacc.09, Vacc.04-Vacc.03, Vacc.04-Vacc.09, Vacc.03-Vacc.09
Cobill: Vacc.01-Vacc.04, Vacc.04-Vacc.09
South Moon: Vacc.09
Sapphire: Vacc.01-Vacc.04, Vacc.01-Vacc.03, Vacc.03-Vacc.04, Vacc.03-Vacc.09
Summit: Vacc.01-Vacc.09, Vacc.01-Vacc.03, Vacc.04-Vacc.09 and others Sharp blue: Vacc.01-Vacc.04, Vacc.01-Vacc.09, Vacc.01-Vacc .03 and others Georgia Age: Vacc.01-Vacc.09, Vacc.04-Vacc.09, Vacc.04-Vacc.03
Spartan: Vacc.01-Vacc.03, Vacc.01-Vacc.09
Suwanee: Vacc.01
Darrow: Vacc.01-Vacc.04, Vacc.01-Vacc.09, Vacc.04-Vacc.09, Vacc.03-Vacc.04
Tiff Blue: Vacc.01
Dexie: Vacc.01-Vacc.04, Vacc.01-Vacc.03, Vacc.03-Vacc.04, Vacc.03-Vacc.09
Duke: Vacc.01-Vacc.04, Vacc.01-Vacc.03, Vacc.01-Vacc.09 and others Delight: Vacc.01-Vacc.03, Vacc.04-Vacc.09, Vacc.03-Vacc. 09 Other troughs: Vacc.01-Vacc.04, Vacc.01-Vacc.03, Vacc.04-Vacc.09
Pearl River: Vacc.03-Vacc.09
Powder blue: Vacc.01-Vacc.04, Vacc.01-Vacc.09
Patriot: Vacc.01-Vacc.04, Vacc.01-Vacc.09, Vacc.04-Vacc.09, Vacc.03-Vacc.04
Baldwin: Vacc.01-Vacc.04, Vacc.01-Vacc.09
Biloxi: Vacc.04
Bright blue: Vacc.06-Vacc.09
Blue crop: Vacc.01-Vacc.04, Vacc.04-Vacc.09, Vacc.03-Vacc.04
Blue Pearl: Vacc.19
Bluebell: Vacc.01
Blue Ridge: Vacc.01-Vacc.04, Vacc.01-Vacc.09, Vacc.01-Vacc.03
Flowable: Vacc.01
Florida Star: Vacc.04-Vacc.22
Bonita Blue: Vacc.01-Vacc.04, Vacc.04-Vacc.09
Homebell: Vacc.01-Vacc.04
Myers: Vacc.04-Vacc.09
Magnoir: Vacc.01-Vacc.04
Reveil: Vacc.01-Vacc.03
Red Pearl: Vacc.01−Vacc.04, Vacc.01−Vacc.09, Vacc.01−Vacc.03 and others
No.19: Vacc.01−Vacc.17
No.35: Vacc.01-Vacc.3, Vacc.1-Vacc.4

  Moreover, the primer pair for amplifying the SSR marker can be provided as a primer set including all or plural types thereof. Furthermore, the primer set can be made into a kit. The kit of the present invention only needs to contain at least the above primer set, and if necessary, PCR extraction reagents (excluding primer sets) such as DNA extraction reagents, PCR buffers and DNA polymerases, and positive reactions. A DNA solution containing a PCR amplification region as a control, a detection reagent such as a staining agent or electrophoresis gel, and instructions may be included.

  Below, the specific procedure of the blueberry identification method of this invention is demonstrated. First, DNA is extracted from blueberries as test (or standard) samples. For DNA extraction, any part of the plant body such as leaves, fruits (fruit skin), seeds, roots, stems, seedlings, etc. may be used, but leaves are preferred. Further, since the analysis is possible as long as the extracted DNA is not severely damaged, the test sample can be a processed product of blueberry. Examples of processed products include beverages such as blueberry tea leaves, cooked products such as confectionery, yogurt and jam.

  The blueberry contained in the test sample is not limited to one type of blueberry, and may be a mixture of two or more types of blueberries. However, in the identification of blueberry varieties with high polyploidy and multiple multiple alleles, it may be difficult to identify with a mixture of multiple varieties of DNA. Treatment with a mixture may not be suitable.

  DNA extraction can be performed by a method known to those skilled in the art, for example, a normal plant genomic DNA extraction method. Specifically, for example, the following procedure is performed. First, tissues such as blueberry leaves are ground in liquid nitrogen. After cetyltrimethylammonium bromide (CTAB) solution is added to the ground product and incubated, chloroform-isoamyl alcohol is added and mixed well. Isolate and collect the aqueous layer by centrifugation, add isopropyl alcohol and mix well. After collecting the precipitate by centrifugation, 70% ethanol is added for rinsing and centrifugation is performed again to obtain genomic DNA. The extraction can also be performed using a commercially available kit (for example, “DNeasy” manufactured by QIAGEN). As the amount of DNA extracted, it is sufficient that an amount capable of analyzing the next SSR marker is extracted. When subjected to PCR, for example, 10 ng or more per reaction.

  Moreover, since polysaccharides, polyphenols, and the like contained in the blueberry extract hinder subsequent PCR amplification, it is preferable to remove these PCR inhibitors as much as possible. In particular, when extracting from leaves, it is known that a large amount of polyphenol is contained. The polyphenol can be removed by a method known per se, for example, a method of adding PVPP (polyvinyl polypyrrolidone) and the like (Japanese Patent Laid-Open No. 2005-168308).

  Next, using the DNA obtained by the above operation as a template, one or more of the specific SSRs described above are amplified by PCR using corresponding primers. Here, PCR is a method for amplifying specific DNA using a reaction that is performed by repeating a DNA replication cycle comprising a denaturation step, a primer annealing step, and a DNA polymerase extension step, which is known to those skilled in the art. (For example, Saiki et al., Science, 230, 1350-1354, 1985; plant cell engineering separate volume "Plant PCR Experiment Protocol", supervised by Isao Shimamoto and Takuji Sasaki, 1995, Non-Patent Document 6 published by Shujunsha) be able to. For example, a thermostable DNA polymerase and the primer are added to a template DNA, and the three steps of denaturation at about 90 to 96 ° C., annealing at about 40 to 70 ° C., and extension at about 70 to 75 ° C. are repeated 20 to 60 cycles. .

  After PCR, the fragment length of the obtained amplification product is analyzed. Analysis of the amplified fragment length can be performed by electrophoresis such as capillary electrophoresis or gel plate electrophoresis, but the electrophoresis time is short, the separation performance is good, and multiple samples can be processed. The method is preferred.

  Capillary electrophoresis can be performed, for example, by using a combination of Applied Biosystems (ABI) capillary electrophoresis device “3730 DNA Analyzer” and analysis software “Gene Mapper” to analyze the length of the amplified fragment. And can be done. In this case, the PCR is performed using a fluorescently labeled primer in which either 5 ′ end of the primer pair is previously labeled with a fluorescent dye. By using a fluorescently labeled primer, a fluorescent dye is introduced into the obtained amplification product, and after electrophoresis, the length of the amplified fragment can be analyzed based on the fluorescence.

When identifying a blueberry variety in a test sample, a preferred embodiment of the method for identifying a blueberry variety of the present invention includes the following steps.
(1) Using the DNA extracted from the blueberry variety of the standard sample as a template, each of the VSR.01, 03, 04, 05, 06, 09, 17, 19, 22, 23, 24 primer pairs for amplifying each SSR marker Amplifying each SSR marker using PCR
(2) A step of analyzing the amplified fragment length of each SSR marker amplified in step (1) by electrophoresis, and determining an amplified fragment length serving as an identification index for each SSR marker for each variety
(3) A step of constructing a database consisting of a data set in which a standard sample blueberry variety and an amplified fragment length as an identification index in each SSR marker determined in step (2) are associated.
(4) Using DNA extracted from a test sample as a template, one type of primer pairs for amplification of each SSR marker of Vacc. 01, 03, 04, 05, 06, 09, 17, 19, 22, 23, 24 or A process of amplifying the corresponding SSR marker by PCR using multiple species, and identifying the blueberry varieties contained in the test sample by comparing the obtained amplified fragment length with the database constructed in step (3)

  First, DNA extraction, PCR amplification, and electrophoresis in steps (1) and (2) are performed as described above. Amplified fragment length serving as an identification index is preferably an amplified fragment length showing the strongest signal, for example, when PCR amplification is performed using a fluorescently labeled primer and a plurality of amplified fragment lengths are obtained by analysis by capillary electrophoresis. The amplification fragment length (hereinafter also referred to as the maximum amplification fragment length) exhibiting the highest peak value (maximum fluorescence intensity) among them is adopted.

  Next, in step (3), typical varieties of blueberries as standard samples, and each SSR of Vacc. 01, 03, 04, 05, 06, 09, 17, 19, 22, 23, 24 that the varieties have. A database in which the polymorphism type of the amplified fragment length of the marker is associated is created (see Table 1 below). The polymorphic type is an identification type classified according to the size of the amplified fragment length (see Table 2 below). For example, when there are four fragment lengths, A, B, C , D and symbolized in the database are preferable in that it is possible to identify the types quickly and easily.

Here, the following 43 types of blueberries can be listed as the blueberry varieties serving as standard samples, but are not limited thereto. As the database, the more blueberry varieties that serve as standard samples, the higher the identification accuracy of unknown test samples.
"Woodard", "Essel", "Ozark Blue", "Austin", "Garden Blue", "Gulf Coast", "Cooper", "Gloria", "Cape Fur", "Cobill", "South Moon", " Sapphire, Summit, Sharp Blue, George Agem, Spartan, Suwanee, Darrow, Tiff Blue, Dixie, Duke, Delight, Trow, “Pearl River”, “Powder Blue”, “Patriot”, “Baldwin”, “Biloxi”, “Bright Blue”, “Blue Crop”, “Blue Pearl”, “Blue Bell”, “Blue Ridge”, “Floda” Blue, Florida Star, Bonita Blue, Homebell, Myers, Magnoia, Ribale "Red Pearl", "No.19", "No.35"

  Table 1 shows correspondence between 43 types of standard samples and polymorphic types of amplified fragment lengths of each SSR marker (Vacc.01, 03, 04, 05, 06, 09, 17, 19, 22, 23, 24) A table is shown. Table 2 shows the classification of the polymorphic type of the amplified fragment length of each SSR marker.

  Next, in step (4), the DNA extracted from the test sample is amplified using one or more of the SSR marker amplification primers contained in the above database, and the length of the amplified fragment is analyzed to see Table 2. To determine the type of polymorphism. Finally, if the polymorphic type is compared with the correspondence table in Table 1, the blueberry variety in the test sample can be identified.

EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples, but these examples do not limit the present invention.
Example 1 Search for SSR Markers In order to search for SSR markers effective for blueberry variety identification, primers that amplify SSR present on the blueberry genome were designed.
(1) Primer design
More than 5 iterations from the base sequence information of blueberries obtained from the database (NCBI, The National Center for Biotechnolgy Information; http://www.ncbi.nlm.nih.gov/) and the genome analysis by the inventors We found SSRs with repetitive sequences and designed primers to amplify these SSRs. The primers were designed so that the number of bases was about 20 bp, the Tm value was about 60 ° C., and the length of the amplified fragment was about 120 to 150 bp. Fluorescent labels (FAM and HEX) were added to the 5 ′ end of the Reverse primer for analysis of the length of the amplified fragment by capillary electrophoresis. Primer synthesis was outsourced to Operon Biotechnology.

  The nucleotide sequence of SSR obtained from the above genomic analysis by the inventors was determined by gel extraction using a 2% agarose gel from an arbitrary DNA fragment of blueberry, for example, a DNA fragment obtained by PCR amplification using a random primer. Extracted, purified, and sequenced by analysis with a DNA sequencer (ABIPRISM 3100-Avant Genetic Analyzer, Applied Biosystems).

The conditions for PCR amplification with the above random primers were as follows. The composition of the reaction solution is 2 μL of DNA extract (20 ng / μL), 10 × buffer (100 mM Tris-HCl, 500 mM KCl, 15 mM MgCl ₂ , Takara Bio) 2 μL, 2.5 mM dNTPs 2 μL (Takara Bio), 10 μM Primer 1 μL (Operon Biotechnology), 5 uints / μL Taq polymerase (rTaq; Takara Bio) 0.4 μL, and distilled water 12.6 μL were prepared. The reaction conditions were as follows: first heat denaturation at 95 ° C for 1 minute, then 94 ° C for 1 minute (thermal denaturation), 35 ° C for 2 minutes (annealing), 72 ° C for 3 minutes (extension) for a total of 40 cycles. The reaction was cycled, and finally the extension reaction was performed at 72 ° C. for 5 minutes.

(2) Extraction of DNA from blueberry samples “Woodard”, “Essel”, “Ozark Blue”, “Austin”, “Garden Blue”, “Gulf Coast”, “Cooper”, “Gloria”, “Cape Fur”, “ “Cobil”, “South Moon”, “Sapphire”, “Summit”, “Sharp Blue”, “Georgia Gem”, “Spartan”, “Swanee”, “Darrow”, “Tiff Blue”, “Dixie”, “Duke” , "Delight", "Trow", "Pearl River", "Powder Blue", "Patriot", "Baldwin", "Biloxi", "Bright Blue", "Blue Crop", "Blue Pearl", "Blue Bell" , “Blue Ridge”, “Flodder”, “Florida Star”, “Bonita Blue”, “Home Bell”, “Myers” ”,“ Magnoia ”,“ Riveil ”,“ Red Pearl ”,“ No.19 ”,“ No.35 ”in total 43 types were used. The leaves of these varieties and lines were obtained from the National University Corporation Miyazaki University Faculty of Agriculture Field Center and used as samples. Samples were stored frozen at −80 ° C. until just before DNA extraction.

  For DNA extraction / purification, a commercially available DNA extraction / purification kit (DNeasy Plant mini Kit; manufactured by Qiagen) was used, and the specific procedure was in accordance with the protocol recommended by Qiagen. 10 μL of mercaptoethanol was added. First, grind about 1/2 frozen blueberry leaves (less than 0.1 g) in a mortar that has been chilled with liquid nitrogen until powdered, and add the buffer and RNase A to the ground sample according to the protocol. And incubated at 65 ° C. for 10 minutes. Next, a buffer solution was added, and the mixture was allowed to stand on ice for 5 minutes, and then centrifuged. The obtained supernatant was centrifuged using a QIAshredder spin column, and the eluted filtrate was mixed with the buffer solution. The mixture was added to DNeasy spin culumn and centrifuged, and the eluate was removed. Then, a buffer solution was added to the column and centrifuged. Further, the buffer solution was added once more, followed by centrifugation to completely remove ethanol from the DNA-adsorbed membrane. A buffer solution was added to the membrane, allowed to stand for 5 minutes or longer, and then centrifuged to extract DNA. This operation was repeated once more, and the obtained eluate was used as a DNA sample. The concentration of the obtained DNA extract was about 10 ng / μL.

(3) Amplification of SSR marker by PCR method PCR was carried out using the primers designed in (1) above using the DNA of each variety obtained in (2) above as a template to amplify the SSR marker.

The PCR reaction was performed using a DNA thermal cycler (GeneAmp PCR System 9700; Perkin-Elmer) in a reaction volume of 10 μL. The composition of the reaction solution is 1 μL of DNA extract (10 ng / μL), 10 × buffer (100 mM Tris-HCl, 500 mM KCl, 15 mM MgCl ₂ , Takara Bio) 1 μL, 2.5 mM dNTPs 1 μL (Takara Bio), 20 μM A primer, 5 uints / μL Taq polymerase (rTaq; Takara Bio Inc.) 0.1 μL, and distilled water 5.9 μL were prepared. First, heat denaturation was performed at 95 ° C for 1 minute, then at 94 ° C for 1 minute (thermal denaturation), at 60 ° C for 1 minute (annealing), and at 72 ° C for 2 minutes (extension) for a total of 10 reaction conditions. Cycle, 94 ° C for 1 minute (thermal denaturation), 58 ° C for 1 minute (annealing), 72 ° C for 2 minutes (extension) for a total of 25 cycles, and finally the extension reaction at 72 ° C for 7 minutes went. The amplification product obtained by the PCR reaction was diluted 10 to 100 times and subjected to the next fragment analysis.

(4) Analysis of amplified fragment length by capillary electrophoresis The amplified fragment length was analyzed using a DNA sequencer (ABI PRISM 3100-Avant Genetic Analyzer, Applied Biosystems). The sample used for analysis is 12.5 µL of formamide (Hi-Di Formamide, Applied Biosystems) containing a molecular weight marker (GeneScan 400HD ROX standard, Applied Biosystems) mixed with 1 µL of the SSR-PCR product obtained by the above method. Then, after using a DNA thermal cycler (GeneAmp PCR System 9700; Perkin-Elmer) or the like, the mixture was heat-denatured at 95 ° C. for 5 minutes and immediately cooled in ice for 10 minutes. The DNA sequencer is equipped with a 36 cm capillary (3100-Avant Capillary Array, Applied Biosystems), a DNA sequencer dedicated polymer (3100 POP-4 polymer, Applied Biosystems) and a dedicated buffer (Genetic Analyzer Buffer with EDTA, Applied Biosystems) System) and was operated according to the procedure described in the attached manual. Analysis of the length of the amplified fragment was performed using software (GeneMapper, Applied Biosystems) attached to the DNA sequencer.

  The amplified fragment length patterns obtained by the above method are illustrated in FIGS. The designed SSR marker uses a repeat sequence of 2 or 3 bases as a motif, so about 2 bp for markers with 2 base repeats and about 3 bp for markers with 3 base repeats A peak called stutter appeared. FIG. 6 shows the analysis result of “flow double” using Vacc.01 marker (amplified fragment by Vacc.01 primer). Stutters were observed every 2 bp, 103, 105, 107, 109. In this case, the length of the amplified fragment showing the highest peak among the series of peaks was adopted as an identification index characterizing the variety. FIG. 7 shows the analysis result of “blue crop” using the Vacc.01 marker (amplified fragment by the Vacc.01 primer). Two amplified fragment length data of 105 and 118 were obtained. Since blueberries have high-order ploidy, there were cases where multiple amplified fragment length data were obtained in this way, but in this case, the amplified fragment that showed the highest peak among the multiple amplified fragment length data The length (maximum amplified fragment length) was adopted as an identification index characterizing the variety. FIG. 8 shows the analysis result of “No. 35” using the Vacc.09 marker (amplified fragment using the Vacc.09 primer). A continuous amplified fragment length pattern of 110 and 111 every 1 bp was shown. In this way, when amplified fragment lengths showing peaks of almost the same height were obtained, both of them were adopted as identification indices.

  Eleven markers amplified using the primers designed in (1) above (Vacc.01, Vacc.03, Vacc.04, Vacc.05, Vacc.06, Vacc.09, Vacc.17, Vacc.19, The amplified fragment length data of Vacc.22, Vacc.23 and Vacc.24) are shown in FIGS. As for 11 types of markers, amplified fragment length data showing polymorphism between varieties were obtained, and it was revealed that they were effective as cultivar identification markers.

  As a result of analyzing the amplified fragment length pattern of each marker based on the above-mentioned criteria for adopting the identification index, 99 to 143 bp for the Vacc.01 marker, 120 to 158 bp for the Vacc.03 marker, 80 to 80 for the Vacc.04 marker 150 bp, 77 to 111 bp for the Vacc.05 marker, 83 to 117 bp for the Vacc.06 marker, 74 to 128 bp for the Vacc.09 marker, 120 to 130 bp for the Vacc.17 marker, 130 to 130 for the Vacc.19 marker Variety-specific amplified fragment length data was obtained between 136 bp, 113-120 bp for the Vacc.22 marker, 118-150 bp for the Vacc.23 marker, and 121-143 bp for the Vacc.24 marker. Table 3 below shows the correspondence between blueberry varieties and cultivar-specific amplified fragment lengths (identification indices) for each marker.

  As shown in Table 3, it was found that all 43 varieties tested (including 2 newly grown lines) could be identified by appropriately combining 11 types of SSR markers. Also, based on this correspondence table, Vacc.01, Vacc.03, Vacc.04 can be used to identify blueberries with unknown varieties corresponding to any of the 43 varieties under test (including 2 newly grown lines). It was suggested that four markers of Vacc.09 should be used.

(Example 2) Confirmation of effectiveness by blueberry variety identification method of the present invention In order to confirm the effectiveness of the blueberry variety identification method of the present invention, two varieties of blueberries (variety A) cultivated at the Miyazaki Prefectural Agricultural Experiment Station And cultivar B). These two varieties are presumed to be “Woodard” and “Home Bell”, respectively.

  Four markers of Vacc.01, Vacc.03, Vacc.04 and Vacc.09 were used as the variety identification markers. DNA was extracted from blueberry leaves in the same procedure as in Example 1 described above, SSR markers were amplified by PCR, and the amplified fragment length was analyzed by capillary electrophoresis.

  As a result of the analysis, Vacc.01, Vacc.03, Vacc.04 and Vacc.06 markers give the maximum amplified fragment lengths of 103, 140, 83 and 91 for variety A and 128, 140, 122 and 110 for variety B. (Table 4).

  Referring to the correspondence table (Table 3) of the identification marker and the amplified fragment length of each product type, the maximum amplified fragment length of product type A matches Woodard, and the maximum amplified fragment length of product type B matches Homebell. Variety B was determined to be a home bell. This was consistent with the previously estimated variety.

(Example 3) Variety identification by DNA extracted from blueberry peel and seeds As a general rule, the base sequence is universal regardless of the site of the plant as long as it is the same individual. It is considered that it can be applied to fruits as well. Therefore, the effectiveness of this identification method was confirmed for the fruits of blueberries “Uddard” and “Homebell” harvested at the field center of the University of Miyazaki, Faculty of Agriculture.

  Skins and seeds were collected from blueberry fruits using a knife and tweezers. Because the blueberry fruit was soft, it was frozen at -20 ° C just before it to make it easier to collect. Since the pulp is expected to contain contaminants that inhibit PCR amplification, including sugars, consideration was given to reducing these contaminations. The test amount was about 1/4 of the amount of peel obtained from one fruit of the fruit skin, and almost the whole amount of seed obtained from one fruit of the seed was used as one sample.

  The collected pericarp and seed coat are soaked in a 70% ethanol aqueous solution for about 30 minutes to 1 hour, and then pulverized until they become powdery on a mortar that has been cooled with liquid nitrogen. DNA was extracted. Four markers of Vacc.01, Vacc.03, Vacc.04 and Vacc.09 were used as the variety identification markers. Amplification of SSR marker by PCR and analysis of amplified fragment length by capillary electrophoresis were performed in the same procedure as in Example 1.

  As a result of the analysis, according to the markers Vacc.01, Vacc.03, Vacc.04 and Vacc.09, the skin of “Woodard” is 103, 140, 84 and 92, the seed is 103, 140, 84 and 92, “Homebell” The maximum amplified fragment lengths of 128, 140, 122 and 111 were obtained for the pericarp and 128, 140, 122 and 111 for the seed (Table 5).

  The maximum amplified fragment lengths obtained from these blueberry peels and seeds were almost the same as the maximum amplified fragment lengths obtained from blueberry leaves. This indicates that this identification method can be applied to DNA extracted not only from blueberry leaves but also from parts such as fruits.

(Example 4) Variety identification by DNA extracted from blueberry tea leaves The blueberry variety identification method of the present invention enables high-precision identification at the DNA level, and can therefore be used effectively for variety identification of blueberry processed products. Conceivable. Therefore, the effectiveness of this identification method was confirmed for processed products of blueberry leaves (blueberry tea leaves) processed as blueberry tea.

  We obtained blueberry tea leaves made from “Homebell” leaf, which was prototyped in the Miyazaki Prefecture Regional Convergence Joint Research Project, and used it as a test material. About 5 mg of blueberry tea leaf was pulverized until it became powdery on a mortar that had been cooled with liquid nitrogen, and DNA was extracted in the same manner as in Example 1 below. Using four markers Vacc.01, Vacc.03, Vacc.04, and Vacc.09 as cultivar identification markers, amplification of SSR marker by PCR method and amplified fragment by capillary electrophoresis in the same procedure as Example 1. A length analysis was performed.

  As a result of analysis, the maximum amplified fragment length obtained from the blueberry tea leaf obtained by processing the “home bell” leaf almost coincides with the maximum amplified fragment length obtained from the “home bell” leaf shown in Example 1. (Table 6).

  From this, it was shown that the blueberry variety used as the raw material of the processed product can be identified from the DNA extracted from the processed product of blueberries such as blueberry tea.

  The present invention is useful as a blueberry variety identification method in the field of food and agriculture.

The sequence of the SSR marker Vacc.17 is shown (underlined is a primer, bold is a repetitive sequence). The sequence of the SSR marker Vacc.19 is shown (underlined is a primer, bold is a repetitive sequence). The sequence of the SSR marker Vacc.22 is shown (underlined is a primer, bold is a repetitive sequence). The sequence of the SSR marker Vacc.23 is shown (underlined is primer, bold is repetitive sequence). The sequence of the SSR marker Vacc.24 is shown (underlined is a primer, bold is a repetitive sequence). The analysis result of "flow double" by Vacc.01 marker (amplified fragment by Vacc.01 primer) is shown. “109” indicating the highest peak (maximum amplified fragment length) was adopted as an identification index of “flow double”. The analysis result of "blue crop" by Vacc.01 marker (amplified fragment by Vacc.01 primer) is shown. Of the obtained two amplified fragment length data of 105 and 118, “105” indicating the higher peak (maximum amplified fragment length) was adopted as an identification index for “blue crop”. The analysis result of "No. 35" by the Vacc.09 marker (amplified fragment by Vacc.09 primer) is shown. 110 and 111 consecutive amplified fragment length patterns every other bp are shown. In this case, two amplified fragment lengths of “110” and “111” were adopted as the identification index of “No. 35”. An example of the analysis result of the amplified fragment length using the Vacc.01 primer is shown (A: Homebell, B: Sharp Blue, C: Bluebell, D: Woodard). An example of the analysis result of the amplified fragment using the Vacc.03 primer is shown (A: Sapphire, B: Homebell, C: Gulf Coast, D: Delight). An example of the analysis result of the amplified fragment length by the Vacc.04 primer is shown (A: Florida Star, B: Essel, C: Dexie, D: Flowable). An example of the analysis result of the amplified fragment length by the Vacc.05 primer is shown (A: Blue crop, B: Essel, C: Flowable, D: No. 19). An example of the analysis result of the amplified fragment length using the Vacc.06 primer is shown (A: Myers, B: No. 35, C: Flowable, D: Powder Blue). An example of the analysis result of the amplified fragment length using the Vacc.09 primer is shown (A: Flowable, B: Florida Star, C: Delight, D: Blue Ridge). An example of the analysis result of the amplified fragment length using the Vacc.17 primer is shown (A: Blue crop, B: Sharp blue, C: Red pearl, D: Woodard). An example of the analysis result of the amplified fragment length by the Vacc.19 primer is shown (A: No. 35, B: Dexie, C: Blue Pearl). An example of the analysis result of the amplified fragment length using the Vacc.22 primer is shown (A: Trow, B: O'Neal, C: Baldwin). An example of the analysis result of the amplified fragment length using the Vacc.23 primer is shown (A: Blue Ridge, B: No. 35, C: Cape Fur, D: Baldwin). An example of the analysis result of the amplified fragment length using the Vacc.24 primer is shown (A: Bonita Blue, B: Spartan, C: Blue Ridge, D: Essel).

Claims (10)

Using the DNA extracted from the test sample as a template using one or more of the following primer pairs (A) to (K), the SSR marker is amplified by PCR, the amplified fragment length is analyzed, and the test sample A method for identifying a blueberry variety, comprising identifying a blueberry variety therein.
(A) SSR marker Vacc.01 amplification primer pair comprising an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 1 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 2
5'-gacatgtcttcagagttctcctc-3 '(SEQ ID NO: 1)
5'-gcgtgagggcacaaagctct-3 '(SEQ ID NO: 2)
(B) SSR marker Vacc.03 amplification primer pair comprising an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 3 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 4
5'-gagaagtagagtttagaagctctagaattca-3 '(SEQ ID NO: 3)
5'-tctccaaccccagtaattaagccca-3 '(SEQ ID NO: 4)
(C) SSR marker Vacc. 04 primer pair consisting of an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 5 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 6
5'-tttcattactgctatcgccactcct-3 '(SEQ ID NO: 5)
5'-gtctgggataaatacaaacccagttaga-3 '(SEQ ID NO: 6)
(D) An SSR marker Vacc.05 amplification primer pair comprising an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 7 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 8
5'-gtcatgaccagtaatcaaaccgcgt-3 '(SEQ ID NO: 7)
5'-aactagctagtggaaacaaccgggtt-3 '(SEQ ID NO: 8)
(E) An SSR marker Vacc.06 amplification primer pair comprising an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 9 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 10
5'-gtgtcagagggcacattcatg-3 '(SEQ ID NO: 9)
5'-cggctcgtttgcagcctagt-3 '(SEQ ID NO: 10)
(F) SSR marker Vacc.09 amplification primer pair comprising an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 11 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 12
5'-ccttcctgcntgaagagaaaaattgca-3 '(SEQ ID NO: 11)
5'-tgaaacccctgaaatcgtactctct-3 '(SEQ ID NO: 12)
(G) SSR marker Vacc.17 primer pair for amplification comprising an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 13 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 14
5'-gttgaaaagttcgttttggtccctcct-3 '(SEQ ID NO: 13)
5'-ctccgctgtgttgcttttggattttaga-3 '(SEQ ID NO: 14)
(H) A primer pair for amplification of SSR marker Vacc.19, comprising an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 15 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 16
5'-ggtacaaaaccctcgaacagaatctca-3 '(SEQ ID NO: 15)
5'-gtgtataacagaagactgctttgctgga-3 '(SEQ ID NO: 16)
(I) A primer pair for amplification of SSR marker Vacc.22 comprising an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 17 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 18
5'-cacattcactcaccatgttgcaacg-3 '(SEQ ID NO: 17)
5'-gtttgagatttgaccatgccttctgatgt-3 '(SEQ ID NO: 18)
(J) SSR marker Vacc.23 amplification primer pair comprising an oligonucleotide primer comprising the nucleotide sequence shown in SEQ ID NO: 19 and an oligonucleotide primer containing the nucleotide sequence shown in SEQ ID NO: 20
5'-caacgcatttacaccatccggtaaga-3 '(SEQ ID NO: 19)
5'-gttcaagtcaacacagaccccattct-3 '(SEQ ID NO: 20)
(K) SSR marker Vacc.24 primer pair for amplification comprising an oligonucleotide primer comprising the nucleotide sequence shown in SEQ ID NO: 21 and an oligonucleotide primer containing the nucleotide sequence shown in SEQ ID NO: 22
5'-caaagggatagctcaaagggtcttttca-3 '(SEQ ID NO: 21)
5'-gaattttgcgttcgtccgcagatatga-3 '(SEQ ID NO: 22) The method for identifying a blueberry variety according to claim 1, comprising the following steps.
(1) Amplifying each SSR marker by PCR using DNA extracted from a standard blueberry variety as a template and using each of the primer pairs (A) to (K) according to claim 1
(2) A step of analyzing the amplified fragment length of each SSR marker amplified in step (1) by electrophoresis, and determining an amplified fragment length serving as an identification index for each SSR marker for each variety
(3) A step of constructing a database consisting of a data set in which a standard sample blueberry variety and an amplified fragment length as an identification index in each SSR marker determined in step (2) are associated.
(4) Amplifying the corresponding SSR marker by PCR using DNA extracted from the test sample as a template and using one or more of the primer pairs (A) to (K) according to claim 1 Identifying the blueberry varieties contained in the test sample by comparing the amplified fragment length with the database constructed in step (3) The method for identifying a blueberry variety according to claim 2, wherein the blueberry variety of the standard sample is as follows.
"Woodard", "Essel", "Ozark Blue", "Austin", "Garden Blue", "Gulf Coast", "Cooper", "Gloria", "Cape Fur", "Cobill", "South Moon", " Sapphire, Summit, Sharp Blue, George Agem, Spartan, Suwanee, Darrow, Tiff Blue, Dixie, Duke, Delight, Trow, “Pearl River”, “Powder Blue”, “Patriot”, “Baldwin”, “Biloxi”, “Bright Blue”, “Blue Crop”, “Blue Pearl”, “Blue Bell”, “Blue Ridge”, “Floda” Blue, Florida Star, Bonita Blue, Homebell, Myers, Magnoia, Ribale "Red Pearl", "No.19", "No.35"   The method for identifying a blueberry variety according to claim 2, wherein the amplified fragment length serving as an identification index in each SSR marker is an amplified fragment length showing the strongest signal (maximum amplified fragment length).   Using DNA extracted from the test sample as a template, SSR marker Vacc.01 and SSR marker Vacc.03 are amplified, the maximum amplified fragment length of SSR marker Vacc.01 is 127 to 128 bp, and SSR marker Vacc.03 The blueberry variety identification method according to claim 4, wherein the blueberry variety in the test sample is determined to be “No. 35” using as an index the maximum amplified fragment length of 134 bp or 137 bp.   The method for identifying a blueberry variety according to any one of claims 2 to 5, wherein the electrophoresis method is a capillary electrophoresis method.   The method for identifying a blueberry variety according to claim 6, wherein a fluorescent label for analyzing the length of the amplified fragment by capillary electrophoresis is attached to the 5 'end of any one of the primer pairs. A primer set for identifying blueberry varieties comprising the following primer pairs (A) to (K).
(A) SSR marker Vacc.01 amplification primer pair comprising an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 1 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 2
5'-gacatgtcttcagagttctcctc-3 '(SEQ ID NO: 1)
5'-gcgtgagggcacaaagctct-3 '(SEQ ID NO: 2)
(B) SSR marker Vacc.03 amplification primer pair comprising an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 3 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 4
5'-gagaagtagagtttagaagctctagaattca-3 '(SEQ ID NO: 3)
5'-tctccaaccccagtaattaagccca-3 '(SEQ ID NO: 4)
(C) SSR marker Vacc. 04 primer pair consisting of an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 5 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 6
5'-tttcattactgctatcgccactcct-3 '(SEQ ID NO: 5)
5'-gtctgggataaatacaaacccagttaga-3 '(SEQ ID NO: 6)
(D) An SSR marker Vacc.05 amplification primer pair comprising an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 7 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 8
5'-gtcatgaccagtaatcaaaccgcgt-3 '(SEQ ID NO: 7)
5'-aactagctagtggaaacaaccgggtt-3 '(SEQ ID NO: 8)
(E) An SSR marker Vacc.06 amplification primer pair comprising an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 9 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 10
5'-gtgtcagagggcacattcatg-3 '(SEQ ID NO: 9)
5'-cggctcgtttgcagcctagt-3 '(SEQ ID NO: 10)
(F) SSR marker Vacc.09 amplification primer pair comprising an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 11 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 12
5'-ccttcctgcntgaagagaaaaattgca-3 '(SEQ ID NO: 11)
5'-tgaaacccctgaaatcgtactctct-3 '(SEQ ID NO: 12)
(G) SSR marker Vacc.17 primer pair for amplification comprising an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 13 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 14
5'-gttgaaaagttcgttttggtccctcct-3 '(SEQ ID NO: 13)
5'-ctccgctgtgttgcttttggattttaga-3 '(SEQ ID NO: 14)
(H) A primer pair for amplification of SSR marker Vacc.19, comprising an oligonucleotide primer comprising the base sequence shown in SEQ ID NO: 15 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 16
5'-ggtacaaaaccctcgaacagaatctca-3 '(SEQ ID NO: 15)
5'-gtgtataacagaagactgctttgctgga-3 '(SEQ ID NO: 16)
(I) A primer pair for amplification of SSR marker Vacc.22 comprising an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 17 and an oligonucleotide primer containing the base sequence shown in SEQ ID NO: 18
5'-cacattcactcaccatgttgcaacg-3 '(SEQ ID NO: 17)
5'-gtttgagatttgaccatgccttctgatgt-3 '(SEQ ID NO: 18)
(J) SSR marker Vacc.23 amplification primer pair comprising an oligonucleotide primer comprising the nucleotide sequence shown in SEQ ID NO: 19 and an oligonucleotide primer containing the nucleotide sequence shown in SEQ ID NO: 20
5'-caacgcatttacaccatccggtaaga-3 '(SEQ ID NO: 19)
5'-gttcaagtcaacacagaccccattct-3 '(SEQ ID NO: 20)
(K) SSR marker Vacc.24 primer pair for amplification comprising an oligonucleotide primer comprising the nucleotide sequence shown in SEQ ID NO: 21 and an oligonucleotide primer containing the nucleotide sequence shown in SEQ ID NO: 22
5'-caaagggatagctcaaagggtcttttca-3 '(SEQ ID NO: 21)
5'-gaattttgcgttcgtccgcagatatga-3 '(SEQ ID NO: 22) A primer set for identifying blueberry varieties comprising a primer pair that amplifies the SSR of any of the following (P1) to (P5).
(P1) SSR consisting of ct repeats present at positions 100 to 117 of the base sequence of SSR marker Vacc.17 shown in SEQ ID NO: 23
(P2) SSR consisting of ctt repeats present at positions 71 to 88 of the base sequence of SSR marker Vacc.19 shown in SEQ ID NO: 24
(P3) SSR consisting of ct repeats present at positions 179 to 206 of the base sequence of SSR marker Vacc.22 shown in SEQ ID NO: 25
(P4) SSR consisting of ga repeats present at positions 575 to 582 of the base sequence of the SSR marker Vacc.23 shown in SEQ ID NO: 26, SSR consisting of ga repeats existing at positions 586 to 593 of the base sequence, SSR consisting of ga repeats at positions 627 to 646 of the base sequence
(P5) SSR consisting of ct repeats present at positions 718 to 725 of the base sequence of the SSR marker Vacc.24 shown in SEQ ID NO: 27, and SSR consisting of ct repeats present at positions 745 to 760 of the base sequence   A kit comprising the primer set for identifying a blueberry variety according to claim 8 or 9.

Images