CN114032331B - A specific detection target FPRO_09882 of Fusarium stratum, and its application - Google Patents

Abstract

The invention discloses a novel detection target FPRO-09882 of a layered Fusarium (Fusarium proliferatum), and a detection primer, a detection kit and a detection method thereof, wherein the protein sequence of the detection target FPRO-09882 is shown as SEQ ID NO: 1, and the DNA sequence for coding the protein is shown as SEQ ID NO: 2, respectively. Meanwhile, the invention also discloses a specific primer and probe combination of the RPA detection technology for specifically detecting the target FPRO-09882, wherein the forward primer sequence is shown as SEQ ID NO: 3, the reverse primer sequence is shown as SEQ ID NO. 4, and the probe sequence is shown as SEQ ID NO: 5, respectively. The invention discovers a new detection target of the Fusarium laminarization, provides a new detection way for detecting the Fusarium laminarization, and simultaneously, the RPA-LFD detection primer and the probe developed based on the target can realize the specific detection of the Fusarium laminarization and has high sensitivity.

Description

FPRO_09882, a specific detection target of Fusarium stratum, and its application

technical field

The invention belongs to the technical field of gene detection, in particular to a specific detection target FPRO_09882 of Fusarium proliferatum and its application.

Background technique

F. proliferatum can infect rice, wheat, corn, asparagus, garlic, onion and other crops and woody plants such as azalea, camellia, camellia, cedar, etc., causing root rot. Fusarium lamellae can grow on PDA plates, and its morphological characteristics are similar to that of F. verticillioides. After culturing at 25℃ for 5 days, the colonies are round, often aggregated into bundles, and the central hyphae are The body grows vigorously, the peripheral mycelium grows relatively sparsely, the mycelium develops from white to light yellow, and the central mycelium shows a lavender shape in the later stage. The large conidia are fusarium-shaped or spindle-shaped, colorless and transparent, slightly curved, and gradually tapered to both ends, with 2 to 5 septa, the size is (24.2 to 46.7 μm)*(1.5 to 3.7 μm), its Small conidia are observed under microscope as long oval or ellipse, colorless and transparent, size (4.4～8.4μm)*(1.2～3.1μm), without septum or with one septum, bunched or pseudocephalic, spores Chains are short in "V" shape, with more false heads, single or double phlebos, and more phlegm. No chlamydospores are produced. Under artificial culture conditions, the optimum temperature for the growth of the bacteria is 25°C, the optimum pH value for growth is 5-7, the conidia can germinate well when the relative humidity is 100%, and the lethal temperature for the growth of the bacteria is 60℃, 10min. The better carbon source for the growth of bacteria is soluble starch, and the nitrogen source is ammonium chloride. The optimum growth temperature of Fusarium lamelliae was 25℃, and the growth of mycelium at high temperature above 35℃ was inhibited. The disease has a wide distribution, serious damage, and the symptoms of the disease history are difficult to distinguish and difficult to control. It is one of the most serious diseases in plant production. When environmental conditions are favorable for root rot to occur, it can lead to substantial reductions in plant yields or failures. Root rot caused by Fusarium spp. is a type of soil-borne disease that occurs both at home and abroad.

In recent years, several molecular detection methods for Fusarium sp. have been developed. In 2010, G Mulèe et al. used partial calmodulin gene sequences to design specific primers for F. proliferatum isolated from asparagus, and used ordinary PCR for detection. Hao Fang et al. isolated F. proliferatum from Camellia oleifera root rot in 2009, and designed specific primers based on ITS, with a sensitivity of 1 pg, and 100 ag after amplification by nested PCR. In 2016, Riikka Peltomaa et al. used Fusarium sensors to detect Fusarium spp. in food. These sensors are based on species-specific capture and detection probes that bind to the IGS region. Oligonucleotide-functionalized magnetic microbeads were used to capture target DNA, which was then detected using a biotinylated detection probe and a streptavidin-conjugated tag, which was effective against F. proliferatum. The detection sensitivity can reach 2.0pg. In 2012, Jonathan et al. used Cal gene to design a probe for real-time fluorescence quantitative PCR, with a sensitivity of 11pg. In 2020, Yan Wang et al. used the TEF-1α region as the target of LAMP detection, through SYBR Green I visual assessment and agarose gel electrophoresis detection, and the minimum detection concentration of the target gene was 10pg. Maria et al. designed a real-time fluorescent quantitative PCR probe based on the TEF gene, which can be used for Fusarium stratum stratum that infects rice seeds at an early stage. The primers designed in these methods are mainly from conserved genes such as transcribed spacer (ITS) or TEF gene. These regions or genes are in high copies in the genome, so they can be easily detected. However, more and more studies have found that the ITS sequences of some Phytophthora species differ very little, and primers designed for this purpose are difficult to distinguish between different species. There is a certain gap in the specificity and sensitivity of the detection of different target sequences, and the results will be very different due to different target sequences selected and different fragment sizes. Therefore, the discovery of specific target genes is the core of the current detection technology of Fusarium sp.

SUMMARY OF THE INVENTION

In view of the problems in the prior art that the biological detection method of F. proliferatum requires a long period of time, the detection method has poor specificity, low sensitivity and fewer specific detection targets, the present invention provides a novel F. proliferatum biological detection method. The detection target FPRO_09882 of F. proliferatum and its RPA-LFD detection primer composition based on the new detection target. Another object of the present invention is to provide the above-mentioned RPA-LFD detection kit for F. proliferatum.

In the first aspect, the present invention provides a specific detection target FPRO_09882 of Fusarium exoplaneta, and the protein sequence of the detection target is shown in SEQ ID NO: 1:

MRRVLGPIAHDKWKNKSTMIGWCLYRAEAGEFTHLLRHWNATEVETAGRLIAWGVPNFVLPALLGLPLAEARTGDDETIYRWVKDEERILEHQYDPFQEGRFNDGGSSADNGYGRSENPYRGRENISGPLGVTHVSARRGNSGSLQQDNRLQEERPGRAGNSTETSHETEAHTLGEIDGLGGFDNFGYREPSNRTRGEGPRSVGNGTKNPYKSNRDGLDR(SEQ ID NO.1).

On the other hand, the present invention provides a specific detection target FPRO_09882 of Fusarium stratum, the nucleotide sequence of the detection target is shown in SEQ ID NO: 2:

ATGCGACGCGTCCTCGGCCCCATCGCTCACGACAAATGGAAAAACAAGTCGACAATGATAGGCTGGTGTTTATATCGGGCTGAGGCCGGCGAATTTACTCACTTACTAAGGCATTGGAATGCTACAGAGGTGGAAACGGCTGGGAGGTTAATAGCATGGGGAGTACCAAATTTTGTCCTTCCAGCTCTGCTGGGTCTACCGTTGGCAGAGGCTCGAACCGGGGATGATGAGACGATTTACCGATGGGTGAAGGATGAAGAGAGGATACTGGAGCATCAATATGATCCGTTCCAAGAGGGGCGATTCAACGATGGTGGAAGCAGTGCCGACAATGGGTATGGGAGAAGTGAGAATCCGTATAGGGGACGGGAGAACATATCGGGGCCTTTGGGGGTGACTCACGTATCAGCAAGACGTGGGAACTCCGGGAGTTTGCAGCAAGACAATCGTCTTCAGGAGGAGAGACCCGGGAGGGCTGGTAACAGTACCGAGACGTCACATGAGACGGAAGCGCATACCTTGGGGGAGATAGACGGGCTAGGAGGTTTCGACAACTTTGGGTATAGGGAGCCAAGCAATCGTACCCGAGGAGAGGGACCCAGGAGTGTTGGTAACGGTACCAAGAACCCGTACAAGTCGAACCGGGATGGTTTAGACCGTTAA(SEQ ID NO.2)。

On the other hand, the present invention also provides a primer and probe combination for detecting Fusarium sp., the sequence of the forward primer FPRO_09882F1 is shown in SEQ ID NO: 3, and the sequence of the reverse primer FPRO_09882R1 is shown in SEQ ID NO: 4, the probe sequence FPRO_09882P sequence is shown in SEQ ID NO:5.

Fpro_09882F1: AACGGCTGGGAGGTTAATAGCATGGGGAGTACCA (SEQ ID NO: 3);

Fpro_09882R1: ATACGGATTCTCACTTCTCCCATACCCATTGTCG (SEQ ID NO: 4);

Fpro_09882P: 5'-GCTCGAACCGGGGATGATGAGACGATTTACGATGGGT GAAGGATG-3' (SEQ ID NO: 5), the 5' end was labeled with FAM, the 3' end was modified with C3Spacer, and THF modification was performed at 30 bp from the 5' end in the sequence of the probe.

In another aspect, the present invention also provides a kit for detecting Fusarium sp., comprising at least one dose of the detection solution containing the above-mentioned combination of primers and probes.

Further, the kit also includes: a TwistAmp reaction unit tube containing lyophilized enzyme powder, a buffer solution Buffer, MgAc, deionized water, HybriDetect assaybuffer, and lateral flow chromatography test strips.

In another aspect, the present invention also provides the specific detection target FPRO_09882, the primer and probe combination, and the application of the kit in detecting Fusarium sp.

On the other hand, the present invention also provides a method for detecting Fusarium stratum, characterized in that,

1) Extract the DNA of the sample to be tested;

2) using DNA as a template, using the combination of primers (SEQ ID NO.3, SEQ ID NO.4) and probes (SEQ ID NO.5) of the present invention or the kit of the present invention to carry out RPA amplification;

3) wherein, the RPA amplification: add 29.5 μL of buffer buffer to the 0.2 mL TwistAmp reaction unit tube (TwistAmpnfo kits, Twist) containing lyophilized enzyme powder, and 2.1 μL of 10 μM upstream primer (SEQ ID NO.3) , 10 μM downstream primer (SEQ ID NO.4) 2.1 μL, probe (SEQ ID NO.5) 0.6 μL, DNA 2.0 μL, MgAc 2.5 μL inside the PCR tube lid, deionized water to make up to 50 μL; RPA The amplification system was thoroughly mixed, centrifuged at 5,000 × g for 10 s, placed on a metal bath at 39°C for 30 minutes, and incubated for 4 minutes. The reaction tube was mixed again, centrifuged for 3-5 seconds, and placed in a water bath at 39°C for 30 minutes.

4) Use lateral flow chromatography test strips to detect RPA amplification products;

10 μL of RPA reaction product was added to 190 μL of HybriDetect assay buffer (Milenia Biotec, Giessen, Germany) for dilution, and 10 μL of HybriDetect 1strip was dropped on the test strip after dilution. The other end of the test strip was inserted vertically into 100 μL of HybriDetect assay buffer, and left at room temperature for 5 minutes.

When two brown bands appear on the test strip, one in the quality control area and the other in the detection area, the result is positive, indicating that the sample contains F. proliferatum; when the test strip has only the quality control If a brown band appears in the test area, and there is no band in the detection area, the result is negative, indicating that the sample does not contain F. proliferatum.

Compared with conventional PCR, the method of the present invention has faster detection speed and does not need to go through three steps of denaturation, annealing and extension. The optimal temperature of RPA reaction is between 25°C and 40°C, no denaturation is required, and it can be performed at room temperature for about 20 minutes. complete the reaction. In this way, constant temperature amplification is realized. Unlike PCR method, which requires thermal cycling, it gets rid of the dependence on thermal cycling instruments. As long as there is a stable heat source, RPA reaction can occur, which greatly expands the scope of RPA use. Truly realize portable on-site rapid nucleic acid detection. The PCR reaction time takes one and a half hours, while the RPA reaction only takes 15 minutes, which greatly shortens the detection time.

Compared with the prior art, the beneficial effects of the present invention are:

1) The present invention provides a new and high-reliability specific FPRO_09882 molecular detection target for Fusarium stratum, which provides a new detection approach for the detection of Fusarium stratum.

2) Based on the new target, a sensitive, accurate and high-throughput RPA-LFD detection technology system is established, which overcomes the long cycle, time-consuming, laborious, cumbersome and poor specificity of the biological detection method of Fusarium stratum in the prior art. The problem and PCR detection technology requires thermal cyclers, and cannot quickly detect the problem of Fusarium spp. under isothermal conditions, the detection method of the present invention can detect Fusarium spp. rapidly, conveniently, efficiently, with high specificity and high sensitivity. , does not require complex instruments, can better meet the on-site detection of Fusarium stratiformis, and plays an important role in improving the rapid molecular detection research of Fusarium stratiformis and the early diagnosis of the disease caused by the detection.

3) The detection method provided by the present invention has high accuracy: the present invention detects the sequence of the new target FPRO_09882 according to Fusarium stratum, design specific detection primers and probe combinations, LFD lateral flow chromatography test strip detection results The target band was cleared, and the RPA detection concentration was 1 pg·μL ^-1 . The sensitivity of the RPA lateral flow chromatography test strip detection method was 100 times higher than that of the PCR method.

Description of drawings

In order to illustrate the specific embodiments of the present invention or the technical solutions in the prior art more clearly, the following briefly introduces the accompanying drawings required for the description of the specific embodiments.

Fig. 1 is a graph showing the results of cross-species specificity detection of the RPA-LFD lateral flow chromatography test strip based on the FPRO_14873 primer of the detection target FPRO_14873;

Figure 2 is a graph showing the results of interspecies-specific detection of the RPA-LFD lateral flow chromatographic test strip based on the newly discovered detection target FPRO_09882 of F. proliferatum;

Figure 3 is a graph showing the specificity detection results between genera of the lateral flow chromatography test strip of the RPA-LFD of the newly discovered detection target FPRO_09882 based on F. proliferatum;

4 is a graph showing the sensitivity detection results of lateral flow chromatography test strips based on the design of the specific primer RPA-LFD based on the new discovery and detection of the new target FPRO_09882 by Fusarium stratumbae;

Fig. 5 is the electrophoresis image of the general PCR sensitivity verification of specific primers designed by the newly discovered and detected new target FPRO_09882 of Fusarium sp.;

Fig. 6 is a graph showing the detection results of the RPA-LFD lateral flow chromatography test strip of Fusarium stratum in living tissue.

Detailed ways

Embodiments of the technical solutions of the present invention will be described in detail below with reference to the accompanying drawings. The following examples are only used to illustrate the technical solutions of the present invention more clearly, and are therefore only used as examples, and cannot be used to limit the protection scope of the present invention. It should be noted that, unless otherwise specified, the technical or scientific terms used in this application should have the usual meanings understood by those skilled in the art to which the present invention belongs.

Example 1

This study is based on the genome sequences of some Fusarium genus (F.proliferatum, Fusariumcircinatum, F.oxysporum, F.graminearum, F.solani, F.fujikuroi, F.odoratissimum, F.verticillioides, F.odoratissimum, F.vanettenii, F. Whole genome sequence analysis of 17 species of Fusarium such as .virguliforme, F.clavum, F.mangiferae, F.cerealis, F.redolens, F.sacchari, F.flagelliforme, F.sporotrichioides, etc. Extract, compare and analyze, and mine large-scale genome databases to discover the detection targets of Phytophthora. Through the whole genome comparison, more than 1000 specific detection targets of F. proliferatum were obtained in total; more than 1000 specific detection targets of F. proliferatum were randomly selected from Some genes were selected as candidate genes, and specific primers were designed and screened. Table 1 lists 6 target genes (Table 1).

Table 1 Sequence list of six specific genes of F. proliferatum pathogenic bacteria

Select different species from Fusarium proliferatum (Fusarium proliferatum, F. verticillioides, F. circinatum, F. fujikuroi ), F. solani, F. asiaticum, and F. oxysporum, and RPA-LFD detection was performed with each designed target primer.

Sample detection: Add 29.5 μL of Buffer, 2.1 μL of 10 μM upstream primer, 2.1 μL of 10 μM downstream primer, and 0.6 μL of probe to a 0.2 mL TwistAmp reaction unit tube (TwistAmp Basickits, Twist) containing lyophilized enzyme powder , DNA 2.0 μL, MgAc 2.5 μL was added to the inside of the PCR tube lid, deionized water was added to 50 μL; the RPA amplification system was fully mixed, centrifuged at 5,000 × g for 10 s, placed on a metal bath at 39 °C for 30 min of reaction, and incubated for 4 minutes, the reaction tube was mixed again, centrifuged for 3-5s, and placed in a water bath at 39°C to continue the reaction for 30min.

Negative control: The operation steps are the same as sample detection, and 2.0 μL of template DNA is changed to add 2.0 μL of sterilized ddH ₂ O. After the RPA reaction was completed, the amplification products were detected using lateral flow chromatography test strips. When two brown strips appear on the test strip, one in the control line and the other in the test line, the result is positive, indicating that the sample contains Fusarium spp.; when the test strip Only a brown band appears in the quality control area, and there is no band in the test area (Test line), the result is negative, indicating that the sample does not contain Fusarium stratum.

The primers and probes designed by the other five detection targets are used, taking the target FPRO_14873 as an example, the primer sequences are: Fpro_14873F: AAACAGAGCGAACAAGTAAGACTAGGGTCGACGA (SEQ ID NO: 6); Fpro_14873R: GTGGCACATTTTGCAACTCCCTAAGCGTGTCTTT (SEQ ID NO: 7), select and layer out Different species of Fusarium (Fusarium proliferatum, F. verticillioides, F. circinatum, F. fujikuroi, eggplant rot F. solani, F. asiaticum, and F. oxysporum, the RPA-LFD detection results show that the primers designed based on the FPRO_14873 target have poor specificity, and the results are shown in Figure 1 .

Considering the detection specificity and sensitivity of molecular targets, the molecular detection target FPRO_09882 was obtained by screening as a new target for the final detection of Fusarium spp., as well as a combination of specific primers and probes. The forward primer sequence is shown in SEQ ID NO: 3 , the reverse primer sequence is shown in SEQ ID NO:4, and the probe sequence is shown in SEQ ID NO:5.

Example 2

In order to verify the specific primer sequences of F. proliferatum, in this example, F. proliferatum strains and pathogenic fungi and other oomycetes were used as test materials (Table 2). The DNA of F. proliferatum was extracted from the diseased tissue by CTAB method. The specific method is as follows: take a small amount of mycelial powder, add 900 μL of 2% CTAB extract and 90 μL of 10% SDS, vortex and mix, and place in a water bath at 60° C. for 1 h, inverting several times every 10 min in between. Centrifuge at 12000rpm for 10min, take the supernatant and add an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1), invert and mix, and centrifuge at 12000rpm for 10min; transfer the supernatant to a new tube, add an equal volume of chloroform, and gently mix by inversion Homogenize and centrifuge at 12,000 rpm for 5 min. The supernatant was transferred to a new tube, 2 volumes of absolute ethanol and 1/10 volume of 3M NaAc (pH 5.2) were added, and precipitated at -20°C (>1h). Centrifuge at 12,000 rpm for 10 min, pour off the supernatant, wash the precipitate twice with 70% ethanol, and dry at room temperature. Add an appropriate amount of sterile ultrapure water or TE (pH8.0) to dissolve the precipitate (containing 20 μg/mL RNase), treat at 37°C for 1 h, and store at -20°C for later use.

Table 2 Fungal and oomycete strains for F. proliferatum RPA-LFD detection

The detection is carried out according to the method of Example 1, and the detection results are shown in Figures 2-3.

Figure 2 shows the specific detection results of the RPA-LFD lateral flow chromatography test strip based on the new discovery of F. proliferatum to detect the new target FPRO_09882; 1, 2, Fusarium proliferatum 3, Pine resin canker pathogen (F.circinatum); 4, Fusarium fujikura (F.fujikuroi); 5, Fusarium solani (F.solani); 6, Fusarium verticillium (F.verticill) ioides); 7, F. asiaticum; 8, N negative control. Figure 2 shows that No. 1 has 2 bands, one of which is the Control Line and the other is the Test Line, so it is positive, and the rest have only one Control Line. Negative, indicating that the sample contains F. proliferatum; indicating that the newly discovered detection target FPR O_09882 has interspecies specificity.

Figure 3 is the specificity detection result of the RPA-LFD lateral flow chromatography test strip based on the high-reliability specific molecular detection of the new target FPRO_09882 between genera; 1: F. proliferatum ; 2: Pythium ultimum; 3: Phytop hthora syringae; 4: Colletotrichum truncatum; 5: Verticilium dahliae; 6: Rhizoctonia solani Rhizoctonia solani; 7: Magnaporthe grisea; 8: Negative control; Figure 3 shows that the first line has 2 bands, one of which is the control line and the other is the detection line , so it was positive, indicating that the sample contained Fusarium stratum stratum; the remaining only one control line was negative. This indicated that the newly discovered detection target FPRO_09882 had intergeneric specificity. It can be seen that after the RPA amplification reaction is carried out with the primers designed in Example 1, the detection result of the LFD lateral flow chromatography test strip shows 2 brown bands, and the target band is clear, which can effectively detect Fusarium stratum. While other fungi and oomycetes only had a brown band in the quality control area, and the negative control only had a brown band in the quality control area.

Example 3

Using the genomic DNA of the standard strain of Fusarium layered at the same concentration as the amplification template, after using the RPA amplification reaction of the present invention, the LFD lateral flow chromatography test strip detection results are shown in Figure 4. The target band is clear. analysis. It can be seen that, based on the newly discovered target FPRO_09882, the detection results of the RPA lateral flow chromatography test strip detection method are shown in Figure 4, and the sensitivity is 1pg·μL ^-1 , while the PCR detection results are shown in Figure 5, the detection concentration When it is 100pg·μL ^-1 , the target band can be seen, indicating that the sensitivity of RPA detection is higher than that of PCR. The RPA detection time only takes 30 minutes, and does not require expensive equipment such as PCR machines. The operation procedure is simple, and it is more conducive to popularization and application in production.

Example 4

The DNA of the diseased pine needles of Fusarium sp. from the inoculation layer was extracted by NaOH alkaline lysis method and used as a template for PCR amplification. Take 1 uL of DNA solution and carry out RPA-LFD detection according to the method of Example 3. The results are shown in Figure 6. The test results are 1 from the left to the right, and the DNA extracted from F. proliferatum is used as a positive control; 2-4 are artificial inoculation layers. F. proliferatum ) DNA extracted from pine needles (Cedrus dedara); 5-7 DNA extracted from pine needles (Cedrus deodara) artificially inoculated agar blocks; 8 DNA extracted from pine needles (Cedrus deodara); 9 sterile water (negative control).

After the RPA amplification reaction, the LFD lateral flow chromatography test strip detection results showed that the diseased pine needles (2, 3, 4) with Fusarium sp. Fusarium sp. stratum was detected. While other fungi and oomycetes only had a brown band in the quality control area, and the negative control only had a brown band in the quality control area.

Unless specifically stated otherwise, the numerical values set forth in these examples do not limit the scope of the invention. In all examples shown and described herein, unless stated otherwise, any specific value should be construed as merely exemplary and not as limiting, as other examples of exemplary embodiments may have different values.

sequence listing

<110> Nanjing Forestry University

<120> A specific detection target FPRO_09882 of Fusarium stratum and its application

<130> 2021

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 220

<212> PRT

<213> Fusarium proliferatum

<400> 1

Met Arg Arg Val Leu Gly Pro Ile Ala His Asp Lys Trp Lys Asn Lys

1 5 10 15

Ser Thr Met Ile Gly Trp Cys Leu Tyr Arg Ala Glu Ala Gly Glu Phe

20 25 30

Thr His Leu Leu Arg His Trp Asn Ala Thr Glu Val Glu Thr Ala Gly

35 40 45

Arg Leu Ile Ala Trp Gly Val Pro Asn Phe Val Leu Pro Ala Leu Leu

50 55 60

Gly Leu Pro Leu Ala Glu Ala Arg Thr Gly Asp Asp Glu Thr Ile Tyr

65 70 75 80

Arg Trp Val Lys Asp Glu Glu Arg Ile Leu Glu His Gln Tyr Asp Pro

85 90 95

Phe Gln Glu Gly Arg Phe Asn Asp Gly Gly Ser Ser Ala Asp Asn Gly

100 105 110

Tyr Gly Arg Ser Glu Asn Pro Tyr Arg Gly Arg Glu Asn Ile Ser Gly

115 120 125

Pro Leu Gly Val Thr His Val Ser Ala Arg Arg Gly Asn Ser Gly Ser

130 135 140

Leu Gln Gln Asp Asn Arg Leu Gln Glu Glu Arg Pro Gly Arg Ala Gly

145 150 155 160

Asn Ser Thr Glu Thr Ser His Glu Thr Glu Ala His Thr Leu Gly Glu

165 170 175

Ile Asp Gly Leu Gly Gly Phe Asp Asn Phe Gly Tyr Arg Glu Pro Ser

180 185 190

Asn Arg Thr Arg Gly Glu Gly Pro Arg Ser Val Gly Asn Gly Thr Lys

195 200 205

Asn Pro Tyr Lys Ser Asn Arg Asp Gly Leu Asp Arg

210 215 220

<210> 2

<211> 663

<212> DNA

<213> Fusarium proliferatum

<400> 2

atgcgacgcg tcctcggccc catcgctcac gacaaatgga aaaacaagtc gacaatgata 60

ggctggtgtt tatatcgggc tgaggccggc gaatttactc acttactaag gcattggaat 120

gctacagagg tggaaacggc tgggaggtta atagcatggg gagtaccaaa ttttgtcctt 180

ccagctctgc tgggtctacc gttggcagag gctcgaaccg gggatgatga gacgatttac 240

cgatgggtga aggatgaaga gaggatactg gagcatcaat atgatccgtt ccaagagggg 300

cgattcaacg atggtggaag cagtgccgac aatgggtatg ggagaagtga gaatccgtat 360

aggggacggg agaacatatc ggggcctttg ggggtgactc acgtatcagc aagacgtggg 420

aactccggga gtttgcagca agacaatcgt cttcaggagg agagacccgg gagggctggt 480

aacagtaccg agacgtcaca tgagacggaa gcgcatacct tgggggagat agacgggcta 540

ggaggtttcg acaactttgg gtatagggag ccaagcaatc gtacccgagg agagggaccc 600

aggagtgttg gtaacggtac caagaacccg tacaagtcga accgggatgg tttagaccgt 660

taa 663

<210> 3

<211> 34

<212> DNA

<213> Artificial sequence

<400> 3

aacggctggg aggttaatag catggggagt acca 34

<210> 4

<211> 34

<212> DNA

<213> Artificial sequence

<400> 4

atacggattc tcacttctcc catacccatt gtcg 34

<210> 5

<211> 45

<212> DNA

<213> Artificial sequence

<400> 5

gctcgaaccg gggatgatga gacgatttac gatgggtgaa ggatg 45

<210> 6

<211> 660

<212> DNA

<213> Fusarium proliferatum

<400> 6

atgagccaag agctaaatga caagcagttt taccaagctt cggccccatt attaacgatc 60

gaaaggaaag catttatcaa tgctacatgg aagtcttcca aagccttcaa cgaatttgaa 120

ttgtcaggct actttaggtt ccttgaaaca gagcgaacaa gtaagactag ggtcgacgat 180

cccgcatact ctcacctttg ttttaaacac attttcgaca ttcaaagtat tctctacgaa 240

aacctcaatg aacctccgct acgcctacaa gacttagtcc aaagaagctt agtcttgtgg 300

gaactagagc tcgaagtcgt tcaggactta atcattctcg ttattaagtt aacatttatg 360

gttcgggccg agttcccaaa ctcctactcg catccttcgc cattccaaat gcagatgcaa 420

gacaaccaaa gccttaaaga cacgcttagg gagttgcaaa atgtgccacc tttacagaat 480

ttgggtacac aaaatgagct gccgtcgtgg tttaatgtta ttgatctgga gaaaaaggct 540

aacctgagaa ttggttggac tgaccatctt gatgaacatc tgactttcca aagtggaact 600

cttgtgatat ttcgacatat cgcagtcctc atgtatatga gagaatcagg aatcttgtga 660

<210> 7

<211> 34

<212> DNA

<213> Artificial sequence

<400> 7

aaacagagcg aacaagtaag actagggtcg acga 34

<210> 8

<211> 34

<212> DNA

<213> Artificial sequence

<400> 8

gtggcacatt ttgcaactcc ctaagcgtgt cttt 34

<210> 9

<211> 660

<212> DNA

<213> Fusarium proliferatum

<400> 9

atgactcgat tcagcaccac ggtagaagat gttcagaaca tcccgcaagg cggtgttagg 60

ctactcttac gtagagagaa tgctggagaa acagacactt ggtatgagga ggatttcgat 120

catcttgtcg tcgcgacggg ccacaacagt gtccccccgcg tgcccaagat acccggcctc 180

gaggcctgga acggaagcct gcaacatgcc tccacatggc gatcggcaca agagttcaag 240

ggcaagaaaa tcttagtggt cggtaccagt gagagtgcca tcgatctcgt tcttcagtct 300

cttcctcatg ccaagggcga tattcatgtg tctcaaagaa aaccgcaccc ccggtatcct 360

aacgtgtttg atcggcctgg cgtcaaactc gtgaccacga ttgaccattt taccgaagac 420

tctattcatc tagatgacgg ttctgtcttg ggaggcatcg atgtggtagt ttttgcgacg 480

gggtacttct acacgtaccc cttcctctcg aatgtccgcc cacctgtatc ctgcaggagt 540

ttagtctgtc ctgagagaga aaaacaagta gggtcgccaa tgcgtccaaa tttaacctgc 600

aaagcaacaa caaagggaaa ctggagctat ttcttaatcc gatggggttc aatcaactag 660

<210> 10

<211> 34

<212> DNA

<213> Artificial sequence

<400> 10

caacagtgtc ccccgcgtgc ccaagatacc cggc 34

<210> 11

<211> 34

<212> DNA

<213> Artificial sequence

<400> 11

cacatcgatg cctcccaaga cagaaccgtc atct 34

<210> 12

<211> 651

<212> DNA

<213> Fusarium proliferatum

<400> 12

atgtttgtat cagaaatcat cagccctctc ctcctcgtcg ccagcgccgc actggcggct 60

gccaatcctc agccctcctt tgcggctgtt gtggctcccc gtctgcaggt ttccgtcgaa 120

gcagtcgacg aactcctgat gagcaacact actgagcatc tcacaagcat tgatatcgcc 180

aaatgggctc ctgctctcgg gcagccagtc gaggttctca ccagcttgga ctctgaaacc 240

aagttcaagg tgttctattt cctccaccaa gccatttccg aggggcctgg atcgctttct 300

aagcgtgacc aggcgactgc tgataaagat gccgccatca tcagggagaa ggcagaatcc 360

taccaaagca cagtcacagt tgaggcagcg gaagatgagc ttcgttgcca gaataccgct 420

tcttgtgttc tctgtatcgg tgcagctgca actaccgcgg gaggtctcat ttcttcatgc 480

tctgcagttg cactacgagc caacaacctt cgtgttgcag gaaacgctag cccaacagct 540

gccgaggtta gcggtgctgt cattatcgcg gagctcttag catgcgccgc caagcctctt 600

accggtttcc tcgttgctac tggtgtctgc ctcaaggtta caggccatta a 651

<210> 13

<211> 34

<212> DNA

<213> Artificial sequence

<400> 13

acactactga gcatctcaca agcattgata tcgc 34

<210> 14

<211> 34

<212> DNA

<213> Artificial sequence

<400> 14

gacctcccgc ggtagttgca gctgcaccga taca 34

<210> 15

<211> 507

<212> DNA

<213> Fusarium proliferatum

<400> 15

atggcaactc cgatttccca agaaccctct gggccgtgtt cagaacaaga acaaatgaat 60

gaaatgtcta gaaatttcta ttacgttaga aagagagaag tccgtatgtt tccaggcgca 120

acggctttgc taaaaatgtc gattcagaag tacatggcga agtacgaggt agaatttatg 180

gatgacgacc aaaagcttcg cgttttgctg cctctggatg tgaataggga ggactctgat 240

aagaaattcc aactgctgat ggaaatgccc gataatatga agaaggcgaa gcttttgacc 300

ttctttcgtg tcgatacgat caaggaattc gaaaaacatg tccagatgac agagatctct 360

atcttaggcc tcgaaaggag aaatacctgc acaagtcgga gaggcaggac ctcaaagatc 420

aacgagattt ctagcaatac acaaggcaga actggcaaaa cagaaacaaa ttcagggaga 480

atagaagagc tgagactcag gagctag 507

<210> 16

<211> 34

<212> DNA

<213> Artificial sequence

<400> 16

aatttctatt acgttagaaa gagagaagtc cgta 34

<210> 17

<211> 34

<212> DNA

<213> Artificial sequence

<400> 17

gatcgtatcg acacgaaaga aggtcaaaag cttc 34

<210> 18

<211> 558

<212> DNA

<213> Fusarium proliferatum

<400> 18

atgcctcgta attcgtctcg cagaaagtct cgccgcagcg agaggtctgc ttcccagtct 60

acacctgagt ctacatcccc atctgcaacc ccgcctactt cacaggattc cccgcgccct 120

cggtcttcga gaccgaccac tcccggctct tcaggccctc agtcttcgag accgaccact 180

cccggctctt caggccctca gtctccctgg tcaagcggct ttgaggaaca gggtgtaact 240

ggtctgccca gtcctccagc atcacaatct ccgtctcttg gaacctcgag ccctgctaat 300

gtcgctctat catcctctgg aatctcaaca ccatcaattg aggaacatga accttatcgc 360

tccgccactc cgatagagga tatgactgca cccccatcta cgactgctag tcagtcgtcg 420

gccaaatcta ttaaggctga ccctttggag gatgaaactc tacccaacga tcaggataca 480

ggctacgtga tcgagacaat ttaccttctc cattccaaag ccatctggag ttacatccag 540

ttcatacttg ggaactag 558

<210> 19

<211> 34

<212> DNA

<213> Artificial sequence

<400> 19

gctcttcagg ccctcagtct tcgagaccga ccac 34

<210> 20

<211> 34

<212> DNA

<213> Artificial sequence

<400> 20

agatgggggt gcagtcatat cctctatcgg agtg 34

Claims (5)

1. the application of Fusarium sp. FPRO_09882 as a specific detection target in the detection of Fusarium sp. of non-disease diagnosis and therapeutic purpose, it is characterized in that, the amino acid sequence of described FPRO_09882 is as shown in SEQ ID NO: 1 , the nucleotide sequence of the FPRO_09882 is shown in SEQ ID NO:2. 2. the application of the detection reagent of layering FPRO_09882 in the preparation detection layer of Fusarium spp. kit, is characterized in that, described detection reagent comprises primer and probe combination, and described primer comprises forward primer and reverse Primers, the forward primer sequence is shown in SEQ ID NO: 3, the reverse primer sequence is shown in SEQ ID NO: 4, and the probe sequence is shown in SEQ ID NO: 5. 3. The application according to claim 2, wherein the kit comprises at least one dose of the primer and probe combination. 4. application according to claim 3, is characterized in that, described test kit also comprises: TwistAmp reaction unit tube containing lyophilized enzyme powder, buffer solution Buffer, MgAc, deionized water, HybriDetect assay buffer, side flow Chromatography test strips. 5. the detection method of the Fusarium stratumella of a kind of non-disease diagnosis and therapeutic purpose, is characterized in that, 1) Extract the DNA of the sample to be tested; 2) using DNA as a template, using the primer and probe combination or kit described in claim 2 to carry out RPA amplification; 3) Use lateral flow chromatography test strips to detect RPA amplification products; when two brown bands appear on the test strip, one in the quality control area and the other in the detection area, the result is positive, indicating that the sample contains layers Fusarium spores; when the test strip only has a brown band in the quality control area, and there is no band in the detection area, the result is negative, indicating that the sample does not contain Fusarium spp.

Images