CN109825628B - A kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection Fusarium solani - Google Patents
A kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection Fusarium solani Download PDFInfo
- Publication number
- CN109825628B CN109825628B CN201910241240.3A CN201910241240A CN109825628B CN 109825628 B CN109825628 B CN 109825628B CN 201910241240 A CN201910241240 A CN 201910241240A CN 109825628 B CN109825628 B CN 109825628B
- Authority
- CN
- China
- Prior art keywords
- rpa
- solani
- primer
- fusarium solani
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses a kind of primer based on RPA- Sidestream chromatography technology detection Fusarium solani and probe combinations and its applications.The application specifically: 1) extract sample to be tested DNA；2) using DNA as template, RPA amplification is carried out；3) amplified production detection is carried out using Sidestream chromatography test strips；When two brown bands occur in test strips, one is located in quality control region, and one is located at detection zone, then result is the positive, shows to contain Fusarium solani in sample；When test strips only have quality control region a brown band occur, detection zone does not have band, then the result is that negative, shows in sample without containing Fusarium solani.Primer used in the present invention and probe groups RPA expanding effect are good, band high specificity, with other germ no cross reactions, there is positive control in quality control region, increase the sensitivity of detection, new technology platform is provided for the detection of Fusarium solani, while identifying pathogen at disease infestation initial stage, the Fusarium solani in nursery lot or disease plant can be detected.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to the side based on RPA- Sidestream chromatography technology detection Fusarium solani
Method and primer special and probe combinations.
Background technique
Fusarium solani (Fusariumsolani) to infect pine seedling blight caused by nursery stock be a kind of weight for endangering nursery stock
Disease is wanted, can result in 80% death of seedling when serious, has seriously affected the economic benefit at seedling growth family.Fusarium solani (F. solani) 25 DEG C of 4 d colony diameters of culture are 25-46 mm, 7 d colony diameter 65-70 mm in PDA culture medium.The raw bacterium of gas
Silk cashmere shape, white to light gray, most of bacterial strains not chromogenesis and in cream color, a small number of bacterial strain bacterium colonies back side can produce purple
Color pigment.A large amount of false first-born microconidias are generated, oval, oval or kidney shape is wider, and 0-1 separates, and 8-15 μm
× 2.5-4.5 μm.Large-scale spore the widest part is on middle line top, and both ends are more blunt, and terminal cell is slightly curved, and basal cell's heel is obvious or blunt
Circle, entire spore form is shorter more fat, referred to as horse special type.2-6 separates, and mostly 3 every 25-55 μm × 4-6 μm.It is raw in gas
The conidiogenous cell grown on mycelia is that the single bottle of long tubular is obstructed.It is also easy to produce blue-green pionnote type sporodochia.It is also easy to produce ball
Shape, Dan Sheng, to raw or concatenate, 5-10 μm of diameter of chlamydospore.
In order to prevent the continuous expansion of Fusarium solani spread scope, Fusarium solani root rot is controlled, is needed
It is quickly and accurately detected.Time-consuming for the traditional detection method of Fusarium solani, sensitivity is low, vulnerable to artificial and ring
The interference of the factors such as border cannot make diagnosis in disease incubation period and initial phase；Separating pathogen from soil may
A variety of pathogens and nonpathogenic bacteria are obtained simultaneously, pathogen identification difficulty is larger, and is difficult to estimate using traditional detection method
Cause of disease bacterium amount is difficult that disease occurs to carry out timely monitoring and effectively control, so traditional detection method is gradually by molecule
Replaced detection technique.In recent years, the molecular method of many detection pathomycetes has been developed.DNA probe detection technique is very
The plant pathogenic fungi detection that already be used to research and develop.In China, this technology is also used for the inspection of fungal pathogens
It surveys.However, because nucleic acid probe prepares relative difficulty, this technical operation is complicated, hybridization and sample in terms of practical application
Processing cost is expensive and time-consuming.In addition, repeatability false positive or false negative poor, and may cause, are all this skills
Art some problems that may be present.Since round pcr occurs, a kind of quick, accurate, sensitive, operation letter has been had proven to
Single detection technique, and be widely used in detecting plant pathogenic fungi, the fields such as fungi identification and systematic growth research.It is real
When quantitative PCR be that Applied biosystems 1996 develop, just have quick, sensitive, accurate, quantitative, repeatable
The advantages that strong.This technology has become an important tool of molecular biology.However, it is contemplated that practicability, detection is caused a disease
Fungi needs quickly, easy to operate, cost is reduced as far as possible, as far as possible independent of expensive equipment.Need can on farm or
The relatively backward unit of these equipment of base is promoted the use of.Recombinase-mediated isothermal duplication (Recombinase Polymerase
Amplification, RPA) technology is recognized is the nucleic acid detection technique that can substitute PCR.Its principle be using recombinase with
Primer combines and forms Protein-DNA mixtures, and homologous sequence can be found in double-stranded DNA.Once primer located homologous sequence,
Exchange reaction of chain will occur to be formed and start DNA synthesis, exponential amplification is carried out to the target area in template.In addition, RPA
Technology has the matching of multiple tools enzyme effectively to be expanded, and amplification efficiency is much higher than traditional round pcr, and the time used is shorter, most
It is short to be realized in 5min.Due to RPA technology have the characteristics that expand the used time it is short, be not required to expensive instrument, specificity it is good, answer it
With more and more extensive.The maximum feature of RPA technology is only to need 1 pair of primer that can realize mould under 37 DEG C or so of constant temperature
The amplification of plate nucleic acid does not need to recycle by high and low temperature and realizes nucleic and melting and annealing, therefore do not need expensive instrument and set
It is standby.And 37 DEG C of popular response temperature is easily met, and is suitble to quick detection of the base to pathogen.Currently, RPA technology is
It is widely used in human body, the viral diagnosis on animal or plant, but in the context of detection of pathogenic oomycetes, especially for
The RPA of Fusarium solani is detected, and has no that related application is reported.
Summary of the invention
For the deficiencies in the prior art, the object of the present invention is to provide one kind to be based on RPA- Sidestream chromatography test strips
The method that technology detects Fusarium solani, to establish the New Method for Rapid of Fusarium solani.It provides and is suitable for the detection
The detection primer special of method, and the kit containing the primer special are another goals of the invention of the invention.System of the present invention
The method that quickly detection Fusarium solani is established using RPA- Sidestream chromatography technology for the first time, and commented by specificity and sensitivity
Valence can be used for the detection of actual sample, provide a kind of sensitive, reliable new method for the on-site test of Fusarium solani.
To achieve the above object, the present invention adopts the following technical solutions:
On the one hand, the present invention provides one kind based on RPA- Sidestream chromatography technology detection Fusarium solani (F. solani)
Primer and probe combination, the primer sequence are as follows: forward primer RPA-FsRPA-F:5 '-ACAAAGCCCTGATCCCTGCAC
ACAAAAAACACCA-3 ' (SEQ ID NO:1)；Reverse primer RPA-FsRPA-R:5 '-CATAGTAGCGGGGAGTCTCGAAC
TTCCAGAGGGC-3 ' (SEQ ID NO:2)；The probe sequence are as follows: FsRPA-P:5 '-CGACTCAACAATAGGAAGCCG
CTGAGCTCGCAAGGGTTCCTTCAA-3 ' (SEQ ID NO:3)；Preferably, the 5 ' ends of the reverse primer RPA-FsRPA-R
Added with Biotin, the 5 ' ends of the probe FsRPA-P are added with FAM, and 3 ' ends are added with C3-spacer.
On the other hand, the present invention provides one kind detects Fusarium solani based on RPA- Sidestream chromatography technology
(Fusariumsolani) method, comprising the following steps:
1) sample to be tested DNA is extracted；
2) using DNA as template, RPA amplification is carried out；Wherein, forward primer RPA-FsRPA-F:5'-ACAAAGCCCTGA
TCCCTGCACACAAAAAACACCA-3'(SEQ ID NO:1)；Reverse primer is RPA-FsRPA-R:5'-CATAGTAGCGGG
GAGTCTCGAACTTCCAGAGGGC-3 ' (SEQ ID NO:2)；Probe is FsRPA-P:5 '-CGACTCAACAATAGGAAGCC
GCTGAGCTCGCAAGGGTTCCTTCAA-3 ' (SEQ ID NO:3)；Meanwhile 5 ' the ends of the reverse primer RPA-FsRPA-R
Added with Biotin, the 5 ' ends of the probe FsRPA-P are added with FAM, and 3 ' ends are added with C3-spacer；
3) amplified production detection is carried out using Sidestream chromatography test strips；When two brown bands, a position occur in test strips
In in quality control region, one is located at detection zone, then result is the positive, show in sample containing Fusarium solani (F. solani)；When
Test strips only have quality control region a brown band occur, and detection zone does not have band, then the result is that negative, show not containing in sample
Fusarium solani (F. solani).
Further, RPA is expanded in the step 2: to the 0. 2 mLTwistAmp reaction members equipped with freeze-drying enzyme powder
Buffer solution B uffer 29.5 μ L, 10 μM of upstream primer 2.1 μ L, 10 μM of downstream primer 2.1 μ L, 0.6 μ of probe are added in pipe
L, DNA 2.0 μ L, MgAc 2.5 μ L be added in inside PCR pipe lid, deionized water complements to 50 μ L；RPA amplification system is sufficiently mixed
Even, 5,000 × g is centrifuged 10s, is placed on 39 DEG C of metal baths and reacts 30min, incubates 4 minutes, reaction tube is mixed again, is centrifuged
3-5 s is put into 39 DEG C of water-bath the reaction was continued 30 min.
On the other hand, the present invention also provides one kind based on RPA- Sidestream chromatography technology detection Fusarium solani (F. solani) kit, which is characterized in that including at least primer and probe group described in claim 1 more than 1 dosage
It closes.
Further, final concentration of 0.42 μm of ol/L of the primer, final concentration of 0.12 μm of ol/L of the probe.
Further, shown kit further include: standard positive DNA, buffer, aseptic double-distilled water, reaction driving liquid, produce
Object dilution and Sidestream chromatography reagent.
Further, wherein the RPA Sidestream chromatography detection reagent includes Sidestream chromatography test strips, hybridization check buffer
(1 × PBS+0.1%Tween20).The aseptic double-distilled water can be used as negative control or supply reaction system use, preparation method
It is distilled water after high pressure sterilization, is dispensed into the tubule of sterilizing.
Further, reaction member pipe, the MgAc of buffer solution B uffer, RPA nucleic acid amplification agents detection dry powder
It is commercially available in market.
On the other hand, the present invention also provides the primer and probe combine detection Fusarium solani (F. solani) in application.
Further, the primer sets and probe can be used in production practices Fusarium solani in incidence tissue and soil
Fast and reliable Testing and appraisal.When there are when Fusarium solani, extracting eggplant corruption sickle using NaOH rapid cleavage method in incidence tissue
The DNA of spore bacterium, detailed process is as follows: taking the tissue sample of one section of morbidity, every milligram of tissue is added 10 μ L 0.5M NaOH, is grinding
It is transferred to after being fully ground in alms bowl in the EP pipe of 1.5mL, 12000rpm is centrifuged 5min, takes 5 μ L supernatants that 495 μ L 0.1mM are added
Tris(pH 8.0), take 1 μ L to be directly used in RPA reaction after mixing.Each reaction is at least in triplicate.
Testing goal sequence of the present invention be Fusarium solani translation elongation factor (TEF-1α) sequence, the sequence is in eggplant corruption
It is very conservative in genome in Fusariumsp spore, using Bioedit software by Fusarium solaniTEF-1αSequence and other sickles
Spore bacteriumTEF-1αSequence is compared, and chooses distinctive one section of Fusarium solaniTEF-1αSequence design specific primer, and
Screening is optimized to designed primer by experiment, a pair is obtained and draws for RPA detection the dedicated of Fusarium solani bacterium
Object and probe.Different from routine PCR reaction, the length of primer needed for RPA reacts is usually 30-35bp, the length of probe sequence
For 46-52bp, formed inside primer when design of primers and between secondary structure, the increase of length also makes primer
Design and the increase of selection difficulty, therefore, the design and selection of primer are most important to the result of RPA.RPA technology has been in
Walk conceptual phase, there is no special primer, probe design software, also without a large amount of data for its design of primers principle provide according to
According to.Therefore, primer and probe of the invention combination is to need to design multipair primer from target sequence both ends to optimize, screen
It can obtain.
Compared with prior art, present invention has the advantage that
1) present invention selectsTEF-1αGene primer is to screen to obtain through many experiments, and specificity is good, with other diseases
Opportunistic pathogen no cross reaction.Primed probe expanding effect used in the present invention is good, band high specificity, can be in detection zone shape
At the primer-probe heterodimer of higher concentration, thus make test strips that strong positive reaction be presented, increases the sensitivity of detection, this
Inventing established detection method can detect the Fusarium solani genome of 100pg.
2) RPA technology of the invention and the method for combining Sidestream chromatography technology detection Fusarium solani, had both had molecule raw
Object detects highly sensitive, high-throughput, and has the advantages that the specificity of immunology detection is good, easy to operate, is further without complexity
Instrument, particularly suitable for the Fusarium solani rapid screening detection of laboratories and quarantine scene.
3) for method of the invention compared with Standard PCR, detection speed is fast, it is not necessary to by denaturation, annealing, extend three steps
Suddenly, the optimum temperature of RPA reaction is between 37 DEG C -40 DEG C, and without denaturation, reaction is can be completed in 20min or so at normal temperature.No
Complicated instrument and equipment is needed, on-site test is suitable for.Constant-temperature amplification is realized, unlike PCR method has to thermal cycle, thus
The dependence to thermal cycler instrument is got rid of, as long as there is stable heat source RPA reaction, greatly extending RPA makes
Range can really realize portable live Rapid nucleic acid detection.
4) present invention can be used for carrying disease germs the quick detection of Fusarium solani in plant tissue, only need an about 2h that inspection can be completed
Survey process is a kind of effective means for detecting Fusarium solani.Detection method can also be used in the morbidity of Fusarium solani
The prediction of early period detection and disease has a very important significance for determining proper control time, effectively preventing disease.
Detailed description of the invention
It, below will be to specific in order to illustrate more clearly of the specific embodiment of the invention or technical solution in the prior art
Attached drawing needed in embodiment description is briefly described.
Fig. 1 is the Sidestream chromatography test strips specific detection result figure of RPA sensitivity；In figure, 1: Fusarium solani strain (point
From from the root Song Miao)；2: Fusarium solani strain (is isolated from soybean root)；3: pinch outs；4: Fusarium graminearum；5: beading sickle
Spore bacterium；6: scouring rush's Fusariumsp；7: oat Fusariumsp；8: negative control.
Fig. 2 is specific detection result figure testing result figure of the Sidestream chromatography test strips of RPA sensitivity between category；1: eggplant
Rotten fusarium bacterial strain；2: Pythium ultimum；3: tack anthrax-bacilus；4: soyabean phytophthora；5: verticillium dahliae；6: Rhizoctonia solani Kuhn；7:
Pyricularia oryzae；8: negative control.
Fig. 3 is the sensitivity test result figure of RPA Sidestream chromatography test strips detection method.
Fig. 4 is that artificial infection Fusarium solani carries out sample detection.1-5: it is stood caused by artificial infection Fusarium solani withered
The Plant samples RPA testing result of disease；6: healthy plant RPA testing result；7: negative control.
Specific embodiment
It is described in detail below in conjunction with embodiment of the attached drawing to technical solution of the present invention.Following embodiment is only used for
Clearly illustrate technical solution of the present invention, therefore be intended only as example, and cannot be used as a limitation and limit protection of the invention
Range.It should be noted that unless otherwise indicated, technical term or scientific term used in this application should be institute of the present invention
The ordinary meaning that category field technical staff is understood.
Embodiment 1
The genomic DNA for trying cause of disease bacteria strain is extracted, specific extraction process is as follows:
A small amount of hypha powder is taken, adds 900 μ L, 2% CTAB extracting solution and 90 μ L, 10% SDS, whirlpool mixes, in 60 DEG C of water-baths
1h, intermediate every 10min turn upside down several times.12000rpm is centrifuged 10min, takes supernatant that isometric phenol/chloroform/isoamyl alcohol is added
(25:24:1), is mixed by inversion, and 12000rpm is centrifuged 10min；Supernatant is transferred in new pipe, isometric chloroform is added, gently
It is gently mixed by inversion, 12000rpm is centrifuged 5min.It takes supernatant to be transferred in new pipe, adds the dehydrated alcohol and 1/10 body of 2 times of volumes
Long-pending 3M NaAc(pH5.2), -20 DEG C of precipitatings (> 1h).12000rpm is centrifuged 10min, and incline supernatant, precipitates 70% ethyl alcohol
It washes twice, room temperature is dried.Add appropriate sterilizing ultrapure water or TE(pH8.0) precipitating is dissolved (containing 20 μ g mL-1RNase), at 37 DEG C
After managing 1h, -20 DEG C are saved backup.Each soil sample is dried pulverize first, then weighed respectively by the extraction for DNA in soil
0.5g soil sample is as sample is extracted, using FastDNA® SPIN kit (Q-Biogene Ltd, USA) carries out mentioning for DNA
It takes.The specific steps that soil DNA extracts are referring to kit specification.
Embodiment 2
Using the DNA of extraction as template, using the RPA primer of design, RPA reaction is carried out in following reaction systems:
Sample detection: to 0. 2 mLTwistAmp reaction member pipe (the TwistAmp Basic equipped with freeze-drying enzyme powder
Kits, Twist) in be added buffer solution B uffer 29.5 μ L, 10 μM of upstream primer 2.1 μ L, 10 μM of 2.1 μ of downstream primer
L, probe 0.6 μ L, DNA 2.0 μ L, MgAc 2.5 μ L be added in inside PCR pipe lid, deionized water complements to 50 μ L；RPA is expanded
System mixes well, and 5,000 × g is centrifuged 10s, is placed on 39 DEG C of metal baths and reacts 30min, incubation 4 minutes, again by reaction tube
Secondary mixing is centrifuged 3-5 s, is put into 39 DEG C of water-bath the reaction was continued 30 min.
Wherein, the RPA primer length is generally 30 to 35 nucleotide.The too short work that can seriously affect recombinase of primer
Property, long primer may not be able to improve amplification capability, will increase a possibility that forming secondary structure instead, increase from primer
Noise.In addition, secondary structure easy to form, primer-primer interaction, the sequence of hairpin structure should be avoided when design of primers as far as possible,
Reduce the formation of primer dimer.Amplified production size is no more than 500bp.
According to Fusarium solaniTEF-1αSequence (AF178356.1), is devised just using Primer Premier 5.0
To primer sequence RPA-FsRPA-F, reverse primer sequences RPA-FsRPA-R, probe sequence FsRPA-P.Particular sequence is as follows:
RPA-FsRPA-F:ACAAAGCCCTGATCCCTGCACACAAAAAACACCA;RPA-FsRPA-R:Biotin-CA
TAGTAGCGGGGAGTCTCGAACTTCCAGAGGGC;FsRPA-P:FAM-CGACTCAACAATAGGAAGCCGCTGAGCTCG-
THF-CAAGGGTTCCTTCAA-C3 space。
Negative control: 2.0 μ L template DNAs are changed to that 2.0 μ L sterilizing ddH is added by the same sample detection of operating procedure2O。RPA
After reaction, amplified production detection is carried out using Sidestream chromatography test strips.When two brown bands, a position occur in test strips
In in quality control region, one is located at detection zone, then result is the positive, shows to contain Fusarium solani in sample；When test strips only have
There is a brown band in quality control region, and detection zone does not have band, then the result is that negative, shows in sample without containing eggplant corruption fusarium
Bacterium.
Embodiment 3
In order to verify the specificity of RPA Sidestream chromatography test strips detection method, with Fusarium solani bacterial strain and other fusariums
Bacterium and pathogen are material to be tested (table 1), the examination of the Fusarium solani as the result is shown of RPA Sidestream chromatography test strips detection method
There are two brown bands in paper slip, and one is located in quality control region, and one is located at detection zone, then result is the positive, other Fusariumsps
And the test strips of pathogen only have quality control region a brown band occur, and detection zone does not have band, then the result is that it is negative, show
Fusarium solani is not contained in sample.
Selection and Fusarium solani (Fusarium solani not of the same race；Pinch outs；Fusarium graminearum；Fusarium moniliforme；Scouring rush
Fusariumsp；Oat Fusariumsp etc.) and the bacterium (Pythium ultimum that does not belong to；Tack anthrax-bacilus；Soyabean phytophthora；Verticillium dahliae；It is vertical
Withered silk kernel fungus；Pyricularia oryzae etc.) DNA as template, carry out the detection of RPA- Sidestream chromatography test strips.
Table 1 is used to detect fungi and the oomycetes bacterial strain of Fusarium solani specificity
| Kind name | Host | Source | Bacterial strain quantity |
| Fusariumsolani | Song Miao | Jiangsu | 4 |
| F. solani | Soybean | Anhui | 4 |
| F. equiseti | Song Miao | Jiangsu | 3 |
| F. equiseti | Song Miao | Anhui | 2 |
| F. equiseti | Soybean | Sichuan | 2 |
| F. graminerum | Soybean | Jiangsu | 2 |
| F. graminerum | Wheat | Jiangsu | 5 |
| F. oxysporum | Song Miao | Jiangsu | 1 |
| F. proliferatum | Song Miao | Jiangsu | 1 |
| F. moniforme | Rice | Jiangsu | 1 |
| F. culmorum | Soybean | Sichuan, Nanchong | 1 |
| F. nivale | Wheat | Jiangsu | 1 |
| F. avenaceum | Soybean | Jiangsu | 1 |
| Phytophthorasojae | Soybean | Jiangsu | 1 |
| Alternariatenussima | Soybean | Shandong | 1 |
| Aspergillusoryzae | It is unknown | The U.S. | 1 |
| Colletotrichumtruncatum | Soybean | Shandong | 1 |
| C. gloeosporiodes | Soybean | Shandong | 1 |
| Legionellasp. | It is unknown | The U.S. | 1 |
| Macrophomamame | Soybean | The U.S. | 1 |
| Magnaportheoryzae | Rice | Jiangsu | 1 |
| Macrophominaphaseolina | Soybean | Jiangsu | 1 |
| Nigreosporasphaerica | Soybean | Sichuan | 1 |
| Phakopsorapachyrhizi | Soybean | Yunnan | 1 |
| Phomapsislongicolla | Soybean | Hubei | 1 |
| Botrytis cinerea | Cucumber | Zhejiang | 1 |
| Endothiaparasitica | Chinese chestnut | Jiangsu | 3 |
| Ascochytagossypii | Soybean | Jiangsu | 1 |
It is detected according to the method for embodiment 1-2, testing result is as depicted in figs. 1 and 2.
Fig. 1 is RPA- Sidestream chromatography test strips in specific detection result figure, and 1: Fusarium solani strain (is isolated from Song Miaogen
Portion)；2: nursery stock Fusarium solani strain (being isolated from soybean root)；3: pinch outs；4: Fusarium graminearum；5: Fusarium moniliforme；
6: scouring rush's Fusariumsp；7: oat Fusariumsp；8: negative control；There are two brown bands in test strips, and one is located in quality control region,
One is located at detection zone, then result is the positive, shows to contain Fusarium solani in sample；When test strips only have quality control region to occur one
Brown band, detection zone do not have band, then the result is that negative, show in sample without containing Fusarium solani；The 1st is shown in figure
Article and the 2nd article all show 2 bands, be positive, show to contain Fusarium solani in sample；Remaining is negative.
Fig. 2 is specific detection result figure testing result figure of the RPA- Sidestream chromatography test strips between category；1: eggplant corruption fusarium
Bacterial strain；2: Pythium ultimum；3: tack anthrax-bacilus；4: soyabean phytophthora；5: verticillium dahliae；6: Rhizoctonia solani Kuhn；7: rice blast
Bacterium；8: negative control；There are two brown bands in test strips, and one is located in quality control region, and one is located at detection zone, then result is
The positive shows to contain Fusarium solani in sample；When test strips only have quality control region a brown band occur, detection zone does not have item
Band, then the result is that it is negative, show in sample without containing Fusarium solani；The 1st article of aobvious 2 bands are shown in figure, are positive, are shown sample
Contain Fusarium solani in this；Remaining is negative.
As it can be seen that Sidestream chromatography test strips testing result shows 2 after carrying out RPA amplified reaction with the primer that embodiment 1 designs
Brown band (Fig. 1, Fig. 2), target stripe is analysed clearly, can effectively detect Fusarium solani.And other fungies and oomycetes only have
There is a brown band in quality control region, negative control also only a brown band occurs in quality control region.
Embodiment 4
Measuring embodiment 1 to extract the concentration of DNA using 2000 micro-spectrophotometer of Nanodro is 100ng μ L-1.It will
It is successively diluted to 10ng μ L-1 、1ng·μL-1 、100pg·μL-1、10pg·μL-1、1pg·μL-1,
The primer that is used according to embodiment 1-2, reaction system and reaction condition, to the DNA of various concentration carry out RPA and
PCR detection.
As a result as shown in figure 3, containing 100ng μ L in the reaction system of 25 μ L respectively-1、10ng·μL-1、1ng·μL-1、
100pg·μL-1There are two brown bands in the test strips of Fusarium solani DNA, are positive, and divide in the reaction system of 25 μ L
It Han You not 10pg μ L-1、1pg·μL-1There is a brown band in the paper slip of Fusarium solani DNA, negative；Colour developing
The result shows that the sensitivity of RPA- Sidestream chromatography Lateral Flow Strip reaches 100pg μ L-1；RPA detection time only needs 30min, and
The instrument and equipment of the valuableness such as PCR instrument is not needed, operation sequence is easy, more favorably promotes and applies in production.
Embodiment 5
The present embodiment carries out actual sample experiment detection from artificial infection nursery lot.
First using the pathogen DNA in the method rapidly extracting morbidity nursery lot of embodiment 1.Then, using embodiment 2
Method RPA reaction is carried out to the pathogen DNA of extraction and application Sidestream chromatography test strips carry out amplified production detection.As a result such as
Shown in Fig. 4, when two brown bands occur in test strips, one is located in quality control region, and one is located at detection zone, then result is sun
Property, show to contain Fusarium solani in inoculation sample 1-5；When test strips only have quality control region a brown band, detection occur
Area does not have band, then the result is that negative, shows in negative control sample 6 without containing Fusarium solani.And healthy plant 7 do not have
Band is amplified, it is accurate and reliable to again demonstrate RPA- Sidestream chromatography test strips detection method testing result, there is very strong reality
The property used.
Unless specifically stated otherwise, the numerical value otherwise illustrated in these embodiments is not limit the scope of the invention.?
In all examples shown and described herein, unless otherwise prescribed, any occurrence should be construed as merely illustratively, and
Not by way of limitation, therefore, other examples of exemplary embodiment can have different values.
Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention., rather than its limitations；To the greatest extent
Pipe present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that: its according to
So be possible to modify the technical solutions described in the foregoing embodiments, or to some or all of the technical features into
Row equivalent replacement；And these are modified or replaceed, various embodiments of the present invention technology that it does not separate the essence of the corresponding technical solution
The range of scheme should all cover within the scope of the claims and the description of the invention.
Sequence table
<110>Nanjing Forestry University
<120>a kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection Fusarium solani
<130> 2019
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 34
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 1
acaaagccct gatccctgca cacaaaaaac acca 34
<210> 2
<211> 34
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 2
catagtagcg gggagtctcg aacttccaga gggc 34
<210> 3
<211> 45
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 3
cgactcaaca ataggaagcc gctgagctcg caagggttcc ttcaa 45
Claims (8)
1. one kind based on RPA- Sidestream chromatography technology detection Fusarium solani (F. solani) primer and probe combination, it is special
Sign is, the primer nucleotide sequences are as follows:
Forward primer RPA-FsRPA-F:5 '-ACAAAGCCCTGATCCCTGCACACAAAAAACACCA-3 ' (SEQ ID NO:
1)；
Reverse primer RPA-FsRPA-R:5 '-CATAGTAGCGGGGAGTCTCGAACTTCCAGAGGGC-3 ' (SEQ ID NO:
2)；
The nucleotide sequence of the probe are as follows: FsRPA-P:5 '-CGACTCAACAATAGGAAGCCGCTGAGCTCGCAAGGGT
5 ' the ends of TCCTTCAA-3 ' (SEQ ID NO:3), the reverse primer RPA-FsRPA-R are added with Biotin, the probe
5 ' the ends of FsRPA-P are added with FAM, and 3 ' ends are added with C3-spacer.
2. one kind based on RPA- Sidestream chromatography technology detection Fusarium solani (F. solani) method, which is characterized in that including
Following steps:
1) sample to be tested DNA is extracted；
2) using DNA as template, RPA amplification is carried out；Wherein, forward primer RPA-FsRPA-F:5'-ACAAAGCCCTGATCCC
TGCACACAAAAAACACCA-3'(SEQ ID NO:1)；Reverse primer is RPA-FsRPA-R:5'-CATAGTAGCGGGGAGT
CTCGAACTTCCAGAGGGC-3 ' (SEQ ID NO:2)；Probe is FsRPA-P:5 '-CGACTCAACAATAGGAAGCCGCT
GAGCTCGCAAGGGTTCCTTCAA -3 ' (SEQ ID NO:3)；And 5 ' the end additions of the reverse primer RPA-FsRPA-R
There is Biotin, the 5 ' ends of the probe FsRPA-P are added with FAM, and 3 ' ends are added with C3-spacer；
3) amplified production detection is carried out using Sidestream chromatography test strips；When two brown bands occur in test strips, one is located at matter
Control area in, one be located at detection zone, then result be the positive, show in sample containing Fusarium solani (F. solani)；Work as test paper
Item only has quality control region a brown band occur, and detection zone does not have band, then the result is that negative, shows rotten without containing eggplant in sample
Fusariumsp (F. solani).
3. it is according to claim 2 based on RPA- Sidestream chromatography technology detection Fusarium solani (F. solani) method,
It is characterized in that, in step 2, RPA amplification: to the 0. 2 mL TwistAmp reaction member Guan Zhongjia equipped with freeze-drying enzyme powder
Enter buffer solution B uffer 29.5 μ L, 10 μM of upstream primer 2.1 μ L, 10 μM of 2.1 μ L of downstream primer, probe 0.6 μ L, DNA
2.0 μ L, MgAc 2.5 μ L be added in inside PCR pipe lid, deionized water complements to 50 μ L；RPA amplification system is mixed well, 5,
000 × g is centrifuged 10s, is placed on 39 DEG C of metal baths and reacts 30min, incubates 4 minutes, reaction tube is mixed again, is centrifuged 3-5
S is put into 39 DEG C of water-bath the reaction was continued 30 min.
4. one kind based on RPA- Sidestream chromatography technology detection Fusarium solani (F. solani) kit, which is characterized in that extremely
It less include the primer and probe described in claim 1 combination of 1 dosage or more.
5. it is according to claim 4 based on RPA- Sidestream chromatography technology detection Fusarium solani (F. solani) reagent
Box, which is characterized in that final concentration of 0.42 μm of ol/L of the primer, final concentration of 0.12 μm of ol/L of the probe.
6. it is according to claim 4 based on RPA- Sidestream chromatography technology detection Fusarium solani (F. solani) reagent
Box, which is characterized in that shown kit further include: standard positive DNA, buffer, aseptic double-distilled water, reaction driving liquid, product
Dilution and Sidestream chromatography reagent.
7. primer and probe described in claim 1 combination detection Fusarium solani (F. solani) in application.
8. any kit of claim 4-6 detection Fusarium solani (F. solani) in application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910241240.3A CN109825628B (en) | 2019-03-28 | 2019-03-28 | A kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection Fusarium solani |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910241240.3A CN109825628B (en) | 2019-03-28 | 2019-03-28 | A kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection Fusarium solani |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109825628A CN109825628A (en) | 2019-05-31 |
| CN109825628B true CN109825628B (en) | 2019-10-18 |
Family
ID=66872425
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910241240.3A Active CN109825628B (en) | 2019-03-28 | 2019-03-28 | A kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection Fusarium solani |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109825628B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110373412A (en) * | 2019-07-25 | 2019-10-25 | 中国农业大学 | Primer for detecting F.graminearum schw combines and detection method |
| CN117004751B (en) * | 2023-04-11 | 2024-03-01 | 南京林业大学 | Molecular detection target g7594 of Fusarium solani (Fusarium solani) and application thereof |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140120546A1 (en) * | 2011-06-14 | 2014-05-01 | 3M Innovative Properties Company | Method of processing a sample for analysis |
| CN103352078B (en) * | 2013-07-11 | 2015-03-11 | 南京农业大学 | Method and primer composition for detecting soybean fusarium oxysporum based on LAMP (loop-mediated isothermal amplification) technology |
| WO2016040595A1 (en) * | 2014-09-11 | 2016-03-17 | Agrofresh Inc. | Methods for pathogen detection and disease management on meats, plants, or plant parts |
| CN105483278A (en) * | 2016-02-04 | 2016-04-13 | 中国人民解放军第二军医大学 | Histoplasma capsulatum infectious molecular diagnosis reagent kit based on recombinase and polymerase amplification technological principle and application thereof |
| CN106868166A (en) * | 2017-03-23 | 2017-06-20 | 山东师范大学 | Primer, probe and kit for field quick detection johne's bacillus |
| CN108841985A (en) * | 2018-06-29 | 2018-11-20 | 苏州百源基因技术有限公司 | It is a kind of for detecting nucleotide sequence group, kit and the method for Fusarium solani |
-
2019
- 2019-03-28 CN CN201910241240.3A patent/CN109825628B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN109825628A (en) | 2019-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Castle et al. | Morphological and molecular identification of Trichoderma isolates on North American mushroom farms | |
| CN107299155A (en) | A kind of primer and probe of goose astrovirus real-time fluorescence quantitative PCR detection | |
| CN110066885A (en) | A kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection chestnut Heisui River phytophthora | |
| CN109825628B (en) | A kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection Fusarium solani | |
| CN107988326A (en) | Prawn Acute Hepatic pancreatic necrosis（AHPND）RAA constant temperature fluorescence detection method and reagent | |
| CN106987626A (en) | For a variety of fungies of quick detection and identify primer and probe and its application of strain | |
| CN109652586A (en) | A method of identifying four kinds of sickle-like bacteria | |
| CN114032331B (en) | Fusarium proliferatum specific detection target FPRO-09882 and application thereof | |
| CN101481742B (en) | Detection kit for Mycoplasma hyopneumoniae and use thereof | |
| CN102952881B (en) | Enterobacter cloacae specific PCR (polymerase chain reaction) detection primer | |
| Wang et al. | Fusarium species causing postharvest rot on Chinese cherry in China | |
| CN106350609A (en) | Reagent and detection method for detecting vesicular stomatitis virus, and applications | |
| CN109988823A (en) | Recombinase-mediated isothermal duplication-Sidestream chromatography technology detection Oak Tree phytophthora primer and probe combination and its application | |
| CN104313128A (en) | Loop-mediated isothermal amplification (LAMP)-based method and primer composition for detection of fusarium graminearum | |
| CN104372092B (en) | The LAMP detection primer composition of a kind of banksia rose phytophthora and LAMP detection kit thereof and LAMP detection method | |
| CN110846433B (en) | KASP marker related to drug resistance of wheat powdery mildew and application thereof | |
| CN116516058A (en) | Method and kit for visually detecting phytophthora sojae | |
| CN110093446A (en) | Recombinase-mediated isothermal duplication-Sidestream chromatography technology detection camphor tree phytophthora primer and probe combination and its application | |
| CN109897910A (en) | A method of pinch outs are detected based on RPA- Sidestream chromatography Lateral Flow Strip fast accurate | |
| CN109825627B (en) | A kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection cloves phytophthora | |
| CN101906482B (en) | Kit for diagnosing reovirus genes of grass carps and application thereof | |
| CN109943624A (en) | A kind of method and its primer special and probe combinations based on RPA- Sidestream chromatography technology detection soybean phytophthora | |
| CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit | |
| CN103667538A (en) | Gene chip, kit and method for detecting three viruses for immunosuppression disease of chickens | |
| CN108384881A (en) | The fluorescent quantitative PCR detection method of coal dirt vacation tail spore |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20190531 Assignee: Nanjing Forest Protection Bird Biotechnology Co., Ltd. Assignor: Nanjing Forestry University Contract record no.: X2019320000149 Denomination of invention: Primer and probe composition for detecting fusarium solani based on RPA-lateral flow chromatographic technology and application of composition License type: Common License Record date: 20191022 Application publication date: 20190531 Assignee: Nanjing Dawson Biotechnology Co., Ltd Assignor: Nanjing Forestry University Contract record no.: X2019320000151 Denomination of invention: Primer and probe composition for detecting fusarium solani based on RPA-lateral flow chromatographic technology and application of composition License type: Common License Record date: 20191022 Application publication date: 20190531 Assignee: MAANSHAN Panshi Biotechnology Co., Ltd. Assignor: Nanjing Forestry University Contract record no.: X2019320000150 Denomination of invention: Primer and probe composition for detecting fusarium solani based on RPA-lateral flow chromatographic technology and application of composition License type: Common License Record date: 20191022 |
|
| EE01 | Entry into force of recordation of patent licensing contract |