CN110373412A - Primer for detecting F.graminearum schw combines and detection method - Google Patents
Primer for detecting F.graminearum schw combines and detection method Download PDFInfo
- Publication number
- CN110373412A CN110373412A CN201910675938.6A CN201910675938A CN110373412A CN 110373412 A CN110373412 A CN 110373412A CN 201910675938 A CN201910675938 A CN 201910675938A CN 110373412 A CN110373412 A CN 110373412A
- Authority
- CN
- China
- Prior art keywords
- measured
- graminearum schw
- germ
- dna
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The primer that the invention discloses a kind of for detecting F.graminearum schw combines and detection method.The present invention provides a pair of for detecting the special primer of F.graminearum schw, and establishes accurate, the rapid detection method for F.graminearum schw.Designed primer can effectively expand target gene in the present invention, and specificity and sensitivity are higher, can be used for the quick detection by F.graminearum schw, and the generation and prevalence of the accurate prevention and control disease have highly important value in terms of secure agricultural production.
Description
Technical field
The present invention relates to plant protection arts, and in particular to a kind of primer combination and detection side for detecting F.graminearum schw
Method.
Background technique
Wheat is China and the important cereal crops of world's most area, is planted in China's large area.It is infected by fusarium
Caused head blight is fungal disease important in world wide, is widely current in the temperate zone of warm moist and subtropical zone,
China occurs mainly in Northeasten Spring Wheat Area of China, middle part and middle and south Winter Wheat Area and In Middle And Lower Reaches of Changjiang River.It can infect wheat, big
A variety of cereal crops such as wheat, corn and rice cause multifaceted crushing harm, not only seriously affect crop yield and cause
Economic loss can also generate the secondary of the Aflatrems such as deoxynivalenol (DON), zearalenone (ZEN)
Metabolite.This kind of mycotoxin, such as deoxynivalenol (DON), by inhibiting the synthesis of eukaryotic protein,
Triggering immune response, causes the vomiting of people and animal, and the severe reactions such as gastric disorder causing nausea, diarrhea, or even miscarriage endanger human and livestock health.Cause
This disease is considered as seriously threatening the important disease of agricultural production security.
The generation of wheat scab is affected with popular climate factor, and the weather morbidity of warm moist is more serious.
The disease can be caused by a variety of pathogens, mainly include F.graminearum schw (Fusarium graminearum), fusarium oxysporum
(F.oxysporum), scouring rush's fusarium (F.equiseti), oat fusarium (F.avenaceum), Fusorium moniliforme Sheldon
(F.moniliforme) and eggplant corruption fusarium (F.solani) etc..A large number of studies show that F.graminearum schw (F.graminearum)
It is the main pathogenic bacteria of wheat scab (Fusarium head blight), is distributed the most extensive.F.graminearum schw vitality is stupid
By force, plant can be infected in each growth period of host plant, the invalid body in infected seed or soil can cause seed not sprouted
Or disease declines after germination, causes the withered seedling of seedling rotten；The base portion browning of stem rots to cause brown foot rot, stalk rotten；It is rotten to endanger maximum fringe
It mostly occurs in the blooming stage of wheat, originally occurs scab from 1-2 small ear, then by morbidity small ear, cob is climing above and below mycelia
Prolong, leads to entire fringe portion morbidity browning necrosis.
Currently, production is upper not yet using the wheat resistant variety for being directed to gibberellic hypha, plant morbidity is depended on
After spray the controlling diseases such as fungicide, it is difficult to meet production on to crop quality and yield the needs of.Therefore to wheat scab
Pathogenic bacteria establish accurate, efficient early detection system, targetedly take control measure, are to control head blight from now on
With popular important channel.
In recent years, the further investigation and exploration with people to nucleic acid replication principle, isothermal amplification technique are developing progressively
It is ripe.Recombinase polymeric enzymatic amplification (Recombinase polymerase amplification, RPA) technology is to establish in recent years
A kind of beyond body nucleic acid isothermal amplification technique.The technology can get rid of in amplification process to accurate temperature control device according to
Rely, it is only necessary to the components such as recombinase, single strand binding protein, Bsu archaeal dna polymerase be added in normal PCR reaction system, in 37-
The exponential amplification of target gene is completed in 42 ° of isoperibol in 20min.Compared to traditional pathogen identification method and it is based on
The Molecular Detection means of PCR, RPA technology obtain extensive by the significant advantages such as the sensitivity of its height, specificity, easy to operate
Concern.Therefore, RPA technical application is established into accurate, efficient head blight early disease identification and detection in agricultural production
System can facilitate the generation and prevalence that control wheat scab in time to a certain extent.But it is carried out about using RPA technology
The technical application of F.graminearum schw context of detection has no relevant report.
Summary of the invention
The object of the present invention is to provide the primer combinations and detection method for detecting F.graminearum schw.
The present invention protects primer pair first, is made of primers F and primer R；
The primers F is following (a1) or (a2):
(a1) single strand dna shown in the sequence 1 of sequence table；
(a2) sequence 1 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 1
The DNA molecular of identical function；
The primer R is following (a3) or (a4):
(a3) single strand dna shown in the sequence 2 of sequence table；
(a4) sequence 2 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 2
The DNA molecular of identical function.
The primers F is designed according to coding strand；The primer R is designed according to complementary strand.
The purposes of the primer pair is following (b1) or (b2) or (b3) or (b4):
(b1) it identifies or assists to identify whether germ to be measured is F.graminearum schw；
(b2) prepare for identify or assist to identify germ to be measured whether be F.graminearum schw kit；
(b3) detect in biological sample to be measured whether contain F.graminearum schw；
(b4) preparation for detect in biological sample to be measured whether the kit containing F.graminearum schw.
The present invention also protects the application of the primer pair, for as follows (b1) or (b2) or (b3) or (b4):
(b1) it identifies or assists to identify whether germ to be measured is F.graminearum schw；
(b2) prepare for identify or assist to identify germ to be measured whether be F.graminearum schw kit；
(b3) detect in biological sample to be measured whether contain F.graminearum schw；
(b4) preparation for detect in biological sample to be measured whether the kit containing F.graminearum schw.
The present invention also protects the kit containing the primer pair；The purposes of the kit is following (c1) or (c2):
(c1) it identifies or assists to identify whether germ to be measured is F.graminearum schw；
(c2) detect in biological sample to be measured whether contain F.graminearum schw.
The present invention also protects the preparation method of the kit, includes the steps that individually packing each primer.
The present invention also protect it is a kind of identify or assist to identify whether germ to be measured is the method for F.graminearum schw, including walk as follows
It is rapid:
(1) total DNA of germ to be measured is extracted；
(2) total DNA extracted using step (1) carries out recombinase polymeric enzymatic amplification using the primer pair as template, if
DNA fragmentation, germ to be measured in pcr amplification product containing 194bp ± 5bp are or candidate is F.graminearum schw, if PCR amplification produces
DNA fragmentation, germ to be measured in object without containing 194bp ± 5bp are or candidate is non-F.graminearum schw.
The present invention also protect it is a kind of identify or assist to identify whether germ to be measured is the method for F.graminearum schw, including walk as follows
It is rapid:
It detects in the total DNA of germ to be measured and whether contains specific DNA fragment, if containing specific DNA fragment, germ to be measured
For or candidate be F.graminearum schw, if without containing specific DNA fragment, germ to be measured be or candidate is non-F.graminearum schw；
The specific DNA fragment is the target sequence of primer pair described in the total DNA of F.graminearum schw.
The present invention also protect it is a kind of detect in biological sample to be measured whether the method containing F.graminearum schw, including walk as follows
It is rapid:
(1) total DNA of biological sample to be measured is extracted；
(2) total DNA extracted using step (1) carries out recombinase polymeric enzymatic amplification using the primer pair as template, if
Contain in DNA fragmentation, biological sample to be measured in pcr amplification product containing 194bp ± 5bp or doubtful containing F.graminearum schw, such as
It is not contained in DNA fragmentation, biological sample to be measured in fruit pcr amplification product without containing 194bp ± 5bp or doubtful without containing cereal
Fusarium.
The present invention also protect it is a kind of detect in biological sample to be measured whether the method containing F.graminearum schw, including walk as follows
It is rapid:
It detects in the total DNA of sample to be tested and whether contains specific DNA fragment, if containing specific DNA fragment, biology to be measured
Contain in sample or doubtful containing F.graminearum schw, if do not contained without containing specific DNA fragment, in biological sample to be measured or doubtful
Without containing F.graminearum schw；
The specific DNA fragment is the target sequence of primer pair described in the total DNA of F.graminearum schw.
The method of any description above recombinase polymeric enzymatic amplification is concretely as follows:
(1) ddH is sequentially added into 1.5ml centrifuge tube212.2 μ L of O, dry powder dissolve buffer (Rehydration
Buffer) each 2.4 μ L of 29.5 μ L, primers F solution, primer R solution, 1 μ L of template DNA solution.
The concentration of primers F is 10 μm of ol/L in primers F solution, and the concentration of primer R is 10 μm of ol/L in primer R solution.
(2) the rehydrated solution that (1) configures is transferred to freeze-drying TwistBasic reacts in microballoon, and piping and druming mixes
Until entire microballoon is resuspended, 2.5 μ L 280mM magnesium acetates (MgOAc) of addition are simultaneously mixed well, and obtain reaction system.By reactant
System, which is placed on 39 DEG C of metal bath, reacts 20min.
The DNA fragmentation of the DNA fragmentation of any description above 194bp ± 5bp concretely 194bp.
Any description above germ to be measured concretely F.graminearum schw (F.graminearum), fusarium oxysporum
(F.oxysporum), layer goes out fusarium (F.proliferatum), eggplant corruption fusarium (F.solani), rattan storehouse fusarium
(F.fujikuroi) or scouring rush's fusarium (F.equiseti).
Any description above biological sample to be measured concretely biological tissue, more specifically can be wheat, barley or rice group
It knits.
The present invention provides a pair of for detecting the special primer of F.graminearum schw, and establishes the essence for F.graminearum schw
Quasi-, rapid detection method.Designed primer can effectively expand target gene in the present invention, and specificity and sensitivity are higher, can
For the quick detection by F.graminearum schw, the generation and prevalence of the accurate prevention and control disease have very in terms of secure agricultural production
Important value.
Detailed description of the invention
Fig. 1 is the agarose gel electrophoresis for carrying out specific screening to wheat scab F.graminearum schw using primer pair
Figure.Wherein M is molecular weight marker (marker) DL2000, and 1-7 is corresponding in turn to the related material of F.graminearum schw (F.graminearum)
Material, fusarium oxysporum (F.oxysporum) associated materials, layer go out fusarium (F.proliferatum) associated materials, eggplant corruption fusarium
(F.solani) associated materials, rattan storehouse fusarium (F.fujikuroi) associated materials material related to scouring rush's fusarium (F.equiseti)
The amplified production of material and negative control.
Fig. 2 is the agarose gel electrophoresis for carrying out sensitivity screening to wheat scab F.graminearum schw using primer pair
Figure.Wherein M is that molecular weight marker (marker) DL2000,1-7 is corresponding in turn to 10-1、10-2、10-3、10-4、10-5、10-6Totally 6
The amplified production of dilution DNA and negative control.
Specific embodiment
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly
What routine biochemistry reagent shop was commercially available.Quantitative test in following embodiment is respectively provided with three repeated experiments, as a result makes even
Mean value.
F.graminearum schw (F.graminearum, specially bacterial strain PH-1) is recorded in document: Zheng great Wei ustilaginoidea virens gene
The foundation of knockout system and HOG1 gene functional verification [D] .2015. in ustilaginoidea virens and Fusarium graminearum；The public can be from
China Agricultural University obtains.
Scouring rush's fusarium (F.equiseti, specially bacterial strain y-35-1) is recorded in document: the Sichuan Province Wei Jianli gibberella saubinetii
Research [D] .2015. of disease and corn stalk rot disease correlation；The public can obtain from China Agricultural University.
Rattan storehouse fusarium (F.fujikuroi, specially YC3 bacterial strain) is recorded in document: Chen Zihao rattan storehouse sickle-like bacteria is to more bacterium
Clever molecular basis of insecticide resistance and detection method research [D] .2014.；The public can obtain from China Agricultural University.
Fusarium oxysporum (F.oxysporum, specially Fox-A8-wild bacterial strain) is recorded in document: Yan Jing Fusarium oxysporum
Correlation Dicer gene functional research [D] .2018. occurs for tiny RNA；The public can obtain from China Agricultural University.
Layer goes out fusarium (F.proliferatum, specially F.proliferatum bacterial strain Fp1) and is recorded in document: Jiao Zhu
Bright and beautiful maize kernel rot causes a disease, and fusarium prolifertum infects the cell of host, biochemical and molecular basis studies [D] .2015.；The public can
To be obtained from China Agricultural University.
Eggplant corruption fusarium (F.solani) is recorded in document: Guan Rui climbs .Dirigent gene and participates in Radix Notoginseng-Fusarium solani
Molecular mechanism research [D] of interaction；The public can obtain from China Agricultural University.
Embodiment 1, primer combined sorting
One, design of primers
1. carrying out a large amount of sequence analyses, comparing 6 primers (as shown in table 1) obtained for detecting F.graminearum schw.
Table 1 is used to detect the RPA primer sequence of F.graminearum schw
| Primer | Primer sequence (5'-3') |
| F1 | TGCTGCTAGTGGTGCTTGGCTTCTTCTCAA |
| F2 | ACAGCACATTCGCCACTCTCTACCGCCATC |
| F3 | TCTCCGTCTTCACAGTCCAATCCACTCCAT |
| R1 | GTCGGAGGATGGAGTGGATTGGACTGTGAA |
| R2 | CATATCCGTCTCGTCGCCTTGATTGCCAGTCTC |
| R3 | CGAGAGGTTCAATCTTGTCCCAACGATGAGG |
2. 6 primers that step 1 is designed are combined into 3 pairs of primer combinations (as shown in table 2).
The combination of table 2RPA primer and primer size
| Number | Primer combination | Primer size (bp) |
| T1 | F1R1 | 200 |
| T2 | F2R2 | 188 |
| T3 | F3R3 | 194 |
Two, the screening of best primer combination
1. F.graminearum schw is seeded on PDA plate, 25 DEG C dark culturing 7 days, scrape mycelia to nothing with aseptic inoculation needle
Bacterium centrifuge tube, CTAB method extract mycelia DNA.
2. the mycelia DNA obtained using step 1 carries out RPA reaction as template, using 3 kinds of primer combinations shown in table 2 respectively.
The configuration method of RPA reaction system is as follows:
(1) rehydrated solution is configured
DdH is sequentially added into 1.5ml centrifuge tube212.2 μ L of O, dry powder dissolve buffer (Rehydration
Buffer) each 2.4 μ L of 29.5 μ L, upstream primer solution, downstream primer solution, 1 μ L of template DNA solution.
The concentration of upstream primer solution middle and upper reaches primer is 10 μm of ol/L,
The concentration of downstream primer solution middle and lower reaches primer is 10 μm of ol/L.
In template DNA solution, the concentration of DNA is 349ng/ μ L.
(2) the rehydrated solution that (1) configures is transferred to freeze-drying TwistBasic reacts in microballoon, and piping and druming mixes
Until entire microballoon is resuspended, 2.5 μ L 280mM magnesium acetates (MgOAc) of addition are simultaneously mixed well, and obtain reaction system.
Reagent used in above-mentioned reaction is all from TwistBasic kit (Britain TwistDx), reagent are used
Amount is referring to TwistBasic kit specification.
Reaction system is placed on 39 DEG C of metal bath and reacts 20min.
It is arranged simultaneously using ddH2O replaces the negative control of F.graminearum schw mycelia DNA.
3. after completing step 2,50 μ L reaction products and isometric (Tri saturated phenol: chloroform=1:1, volume ratio) are mixed
It closes, 12000rpm room temperature is centrifuged 10min, and the 5 μ L of supernatant product after taking centrifugation is in 2% agarose gel electrophoresis 30min, in gel
Result is observed in imaging system.
The amplified band of primer pair (F3 and R3) is the most clear special, no miscellaneous band, and amplified band size is 194bp, for inspection
Survey the best PRA primer combination of F.graminearum schw.Remaining primer pair amplifies effect is poor, and band is not clear enough and non-specific miscellaneous band
It is more.
Based on the above results, the primer pair detected for the RPA of F.graminearum schw is obtained, by primers F and primer R group
At；
F:5'-TCTCCGTCTTCACAGTCCAATCCACTCCAT-3'(sequence 1)；
R:5'-CGAGAGGTTCAATCTTGTCCCAACGATGAGG-3'(sequence 2).
Embodiment 2, specificity
Strains tested: F.graminearum schw (F.graminearum), fusarium oxysporum (F.oxysporum), layer go out fusarium
(F.proliferatum), eggplant corruption fusarium (F.solani), rattan storehouse fusarium (F.fujikuroi) and scouring rush's fusarium
(F.equiseti)。
1. strains tested is seeded on PDA plate, 25 DEG C dark culturing 7 days, scrape mycelia to nothing with aseptic inoculation needle
Bacterium centrifuge tube, CTAB method extract mycelia DNA.
2. the DNA sample for taking step 1 to obtain, using the DNA sample as template, using the primer of primers F and primer R composition
To progress RPA reaction (reaction method is shown in the step 2 of second part and 3 in embodiment 1).Setting uses ddH20 as template
Negative control group.
As a result as shown in Figure 1.The result shows that the only corresponding RPA amplified production of F.graminearum schw contains 1 size and is
Without band, the RPA primer pair for thus proving that the present invention designs has for the purpose band of 194bp, other bacterial strains and negative control
High degree of specificity.
Embodiment 3, sensitivity
1. F.graminearum schw is seeded on PDA plate, 25 DEG C dark culturing 7 days, scrape mycelia to nothing with aseptic inoculation needle
Bacterium centrifuge tube, CTAB method extract mycelia DNA (DNA concentration is 349ng/ μ L).
2. the mycelia DNA that step 1 obtains is diluted step by step with 10 times of gradients, respectively 100、10-1、10-2、10-3、10-4、
10-5Totally 6 dilutions, obtaining concentration is 349ng/ μ L, 34.9ng/ μ L, 3.49ng/ μ L, 3.49 × 10-1ng/μL、3.49×
10-2Ng/ μ L and 3.49 × 10-3The DNA solution of ng/ μ L.
3. the primer pair that the DNA sample for carrying out different gradient dilutions using step 2 as template, is formed using primers F and primer R
It carries out RPA reaction (reaction method is shown in the step 2 of second part and 3 in embodiment 1).
Setting uses ddH20 negative control group as template.
As a result as shown in Figure 2.
The result shows that the sensitivity concentration of this method is 3.49ng/ μ L.
Sequence table
<110>China Agricultural University
<120>for detecting the primer combination and detection method of F.graminearum schw
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 30
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
tctccgtctt cacagtccaa tccactccat 30
<210> 2
<211> 31
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
cgagaggttc aatcttgtcc caacgatgag g 31
Claims (8)
1. primer pair is made of primers F and primer R；
The primers F is following (a1) or (a2):
(a1) single strand dna shown in the sequence 1 of sequence table；
(a2) have by sequence 1 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 1 identical
The DNA molecular of function；
The primer R is following (a3) or (a4):
(a3) single strand dna shown in the sequence 2 of sequence table；
(a4) have by sequence 2 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 2 identical
The DNA molecular of function.
2. the application of primer pair described in claim 1, for as follows (b1) or (b2) or (b3) or (b4):
(b1) it identifies or assists to identify whether germ to be measured is F.graminearum schw；
(b2) prepare for identify or assist to identify germ to be measured whether be F.graminearum schw kit；
(b3) detect in biological sample to be measured whether contain F.graminearum schw；
(b4) preparation for detect in biological sample to be measured whether the kit containing F.graminearum schw.
3. the kit containing primer pair described in claim 1；The purposes of the kit is following (c1) or (c2):
(c1) it identifies or assists to identify whether germ to be measured is F.graminearum schw；
(c2) detect in biological sample to be measured whether contain F.graminearum schw.
4. the preparation method of kit described in claim 3 includes the steps that individually packing each primer.
5. it is a kind of identify or assist to identify germ to be measured whether be F.graminearum schw method, include the following steps:
(1) total DNA of germ to be measured is extracted；
(2) total DNA extracted using step (1) carries out the expansion of recombinase polymerase using primer pair described in claim 1 as template
Increase, if containing the DNA fragmentation of 194bp ± 5bp, germ to be measured being in pcr amplification product or candidate is F.graminearum schw, if
DNA fragmentation, germ to be measured in pcr amplification product without containing 194bp ± 5bp are or candidate is non-F.graminearum schw.
6. it is a kind of identify or assist to identify germ to be measured whether be F.graminearum schw method, include the following steps:
Detect in the total DNA of germ to be measured and whether contain specific DNA fragment, if containing specific DNA fragment, germ to be measured be or
Candidate is F.graminearum schw, if not containing specific DNA fragment, germ to be measured is or candidate is non-F.graminearum schw；
The specific DNA fragment is the target sequence of primer pair described in claim 1 in the total DNA of F.graminearum schw.
7. it is a kind of detect in biological sample to be measured whether the method containing F.graminearum schw, include the following steps:
(1) total DNA of biological sample to be measured is extracted；
(2) total DNA extracted using step (1) carries out the expansion of recombinase polymerase using primer pair described in claim 1 as template
Increase, if containing containing in the DNA fragmentation of 194bp ± 5bp, biological sample to be measured or doubtful containing cereal in pcr amplification product
Fusarium, if in pcr amplification product without containing do not contained in the DNA fragmentation of 194bp ± 5bp, biological sample to be measured or it is doubtful not
Contain F.graminearum schw.
8. it is a kind of detect in biological sample to be measured whether the method containing F.graminearum schw, include the following steps:
It detects in the total DNA of sample to be tested and whether contains specific DNA fragment, if containing specific DNA fragment, biological sample to be measured
In contain or doubtful containing F.graminearum schw, if without containing not containing or doubtful being free of in specific DNA fragment, biological sample to be measured
There is F.graminearum schw；
The specific DNA fragment is the target sequence of primer pair described in claim 1 in the total DNA of F.graminearum schw.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910675938.6A CN110373412A (en) | 2019-07-25 | 2019-07-25 | Primer for detecting F.graminearum schw combines and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910675938.6A CN110373412A (en) | 2019-07-25 | 2019-07-25 | Primer for detecting F.graminearum schw combines and detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110373412A true CN110373412A (en) | 2019-10-25 |
Family
ID=68255884
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910675938.6A Pending CN110373412A (en) | 2019-07-25 | 2019-07-25 | Primer for detecting F.graminearum schw combines and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110373412A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116926235A (en) * | 2023-09-18 | 2023-10-24 | 三亚中国检科院生物安全中心 | Fusarium RPA-CRISPR/Cas detection kit and method |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101988121A (en) * | 2010-08-06 | 2011-03-23 | 南京农业大学 | Quantitative detection technique for fusarium graminearum infestation quantity in wheat grains |
| CN106868176A (en) * | 2017-03-28 | 2017-06-20 | 中国农业科学院作物科学研究所 | The specific PCR amplimer and detection architecture of F.graminearum schw and application |
| CN108977562A (en) * | 2018-08-05 | 2018-12-11 | 安徽农业大学 | It is a kind of for detecting RPA primer, probe, kit and the detection method of rhizoctonia cerealis in soil |
| CN108998552A (en) * | 2018-08-05 | 2018-12-14 | 安徽农业大学 | It is a kind of for detecting RPA primer, probe, kit and the detection method of gaeumannomyces graminis in soil |
| CN109825628A (en) * | 2019-03-28 | 2019-05-31 | 南京林业大学 | A kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection Fusarium solani |
| CN109897910A (en) * | 2019-03-25 | 2019-06-18 | 南京林业大学 | A method of pinch outs are detected based on RPA- Sidestream chromatography Lateral Flow Strip fast accurate |
-
2019
- 2019-07-25 CN CN201910675938.6A patent/CN110373412A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101988121A (en) * | 2010-08-06 | 2011-03-23 | 南京农业大学 | Quantitative detection technique for fusarium graminearum infestation quantity in wheat grains |
| CN106868176A (en) * | 2017-03-28 | 2017-06-20 | 中国农业科学院作物科学研究所 | The specific PCR amplimer and detection architecture of F.graminearum schw and application |
| CN108977562A (en) * | 2018-08-05 | 2018-12-11 | 安徽农业大学 | It is a kind of for detecting RPA primer, probe, kit and the detection method of rhizoctonia cerealis in soil |
| CN108998552A (en) * | 2018-08-05 | 2018-12-14 | 安徽农业大学 | It is a kind of for detecting RPA primer, probe, kit and the detection method of gaeumannomyces graminis in soil |
| CN109897910A (en) * | 2019-03-25 | 2019-06-18 | 南京林业大学 | A method of pinch outs are detected based on RPA- Sidestream chromatography Lateral Flow Strip fast accurate |
| CN109825628A (en) * | 2019-03-28 | 2019-05-31 | 南京林业大学 | A kind of primer and probe combination and its application based on RPA- Sidestream chromatography technology detection Fusarium solani |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116926235A (en) * | 2023-09-18 | 2023-10-24 | 三亚中国检科院生物安全中心 | Fusarium RPA-CRISPR/Cas detection kit and method |
| CN116926235B (en) * | 2023-09-18 | 2023-12-05 | 三亚中国检科院生物安全中心 | Fusarium RPA-CRISPR/Cas detection kit and method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Avila et al. | Fusarium incarnatum-equiseti species complex associated with Brazilian rice: Phylogeny, morphology and toxigenic potential | |
| Covarelli et al. | Characterization of Fusarium verticillioides strains isolated from maize in Italy: Fumonisin production, pathogenicity and genetic variability | |
| Edwards et al. | Molecular studies to identify the Fusarium species responsible for HT-2 and T-2 mycotoxins in UK oats | |
| Palacios et al. | Genetic variability and fumonisin production by Fusarium proliferatum isolated from durum wheat grains in Argentina | |
| Spanic et al. | Morphological and molecular identification of Fusarium species associated with head blight on wheat in East Croatia | |
| Cerón-Bustamante et al. | Regional differences in the composition of Fusarium head blight pathogens and mycotoxins associated with wheat in Mexico | |
| Wagacha et al. | Diversity in mycotoxins and fungal species infecting wheat in Nakuru District, Kenya | |
| CN102796812B (en) | PCR (Polymerase chain reaction) primer capable of simultaneously detecting five soil-borne fungal diseases of wheat paddock and detecting method thereof | |
| Lanza et al. | Prevalence of fumonisin-producing Fusarium species in Brazilian corn grains | |
| Zhang et al. | Analysis of potential fumonisin‐producing Fusarium species in corn products from three main maize‐producing areas in eastern China | |
| Yörük et al. | Characterization of high-level deoxynivalenol producer Fusarium graminearum and F. culmorum isolates caused head blight and crown rot diseases in Turkey | |
| van Rensburg et al. | Grain colonization by fumonisin-producing Fusarium spp. and fumonisin synthesis in South African commercial maize in relation to prevailing weather conditions | |
| CN110117592A (en) | A method of quickly detecting fusarium moniliforme rattan storehouse fusarium based on RPA | |
| Abedi-Tizaki et al. | Morphological and molecular identification of'Fusarium'head blight isolates from wheat in north of Iran | |
| Mentewab et al. | Chromosomal location of Fusarium head blight resistance genes and analysis of the relationship between resistance to head blight and brown foot rot | |
| Monda et al. | A review of agricultural aflatoxin management strategies and emerging innovations in sub-Saharan Africa | |
| CN104046690A (en) | Multiple polymerase chain reaction (PCR) detection method for three fungaltoxins and fusarium graminearum in grains | |
| Zhou et al. | Development of a loop‐mediated isothermal amplification method for the rapid detection of Venturia carpophila on peach | |
| Wang et al. | Development of loop-mediated isothermal amplification (LAMP) assay for rapid detection of Fusarium proliferatum causing ear and kernel rot on maize | |
| CN110373412A (en) | Primer for detecting F.graminearum schw combines and detection method | |
| Desjardins et al. | Gibberella ear rot of maize (Zea mays) in Nepal: distribution of the mycotoxins nivalenol and deoxynivalenol in naturally and experimentally infected maize | |
| Hernandez Nopsa et al. | Characterization of Nebraska isolates of Fusarium graminearum causing head blight of wheat | |
| CN105349655A (en) | Peronophythora litchii molecular detection primers and detection method thereof | |
| Mohammed-Ameen et al. | Morphogenetic identification, description and pathogenicity of novel pathogens on Iraqi wheat plant (Triticum aestivum) causing head blight and crown rot diseases | |
| Awad et al. | PCR and nanotechnology unraveling detection problems of the seed-borne pathogen Cephalosporium Maydis, the causal agent of late wilt disease in maize |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191025 |
|
| RJ01 | Rejection of invention patent application after publication |